Luận văn Nghiên cứu và thu nhận enzyme protease từ các chủng nấm sợi ở rừng ngập mặn Cần Giờ

MỞ ĐẦU Lí do chọn đề tài. Enzyme là chất xúc tác sinh học không chỉ có ý nghĩa cho quá trình sinh trưởng, sinh sản của sinh vật mà còn có vai trò rất lớn trong công nghiệp chế biến thực phẩm, y học, kĩ thuật phân tích, công nghệ gen và bảo vệ môi trường. Do có khả năng ứng dụng rộng rãi trong nhiều lĩnh vực mà ngành công nghiệp enzyme đã đem lại lợi nhuận to lớn cho nhiều nước. Ở Việt Nam, ngành công nghệ enzyme vẫn chưa thật sự phát triển. Mỗi năm, nước ta phải nhập ngoại một lượng lớn các enzyme để ứng dụng vào sản xuất công, nông nghiệp, giải quyết ô nhiễm MT Trong các loại enzyme, protease là enzyme được sử dụng nhiều nhất. Năm 1995, tổng doanh thu từ enzyme này ở các nước châu Âu lên đến 187,2 triệu USD, cao nhất trong các loại enzyme. Protease được ứng dụng rộng rãi trong nhiều ngành như công nghiệp thực phẩm, công nghiệp dược phẩm, nông nghiệp Nguồn protease chủ yếu hiện nay thu được từ VSV, đặc biệt là các chủng NS thuộc chi Aspergillus, Penicillium, Paecilomyces, Mucor. Việc nghiên cứu và phân lập các chủng NS trong tự nhiên để thu nguồn protease mới có giá trị là vấn đề đang được khoa học quan tâm nghiên cứu. Để thu được nguồn protease mới có giá trị cần phải phân lập các chủng mới có trong tự nhiên. Một trong những hướng nghiên cứu mà khoa học đang quan tâm là tìm các chủng VSV mới có đặc tính ưu việt từ RNM. Chính điều kiện sống khắc nghiệt ở RNM tạo ra nhiều cơ hội tìm thấy các nguồn gen VSV quí hiếm, trong đó có NS sinh protease. Ở nước ta, RNM Cần Giờ là nơi HST phong phú, đa dạng. Tuy nhiên, những nghiên cứu về đa dạng sinh thái của RNM Cần Giờ chủ yếu tiến hành ở hệ động thực vật. VSV, trong đó NS là một đối tượng được phân bố rộng rãi và có giá trị kinh tế chỉ mới được quan tâm nghiên cứu trong thời gian gần đây. NS ở RNM Cần Giờ có nhiều đặc tính quí báu như khả năng chịu đựng được điều kiện sống khắc nghiệt, khả năngsinh nhiều enzyme ngoại bào, trong đó có protease. Do RNM Cần Giờ có thảm TV dày đặc, xác động thực vật bị phân hủy tạo thành nguồn cơ chất cho các chủng NS sinh các enzyme ngoại bào. Cho đến hiện nay, các công trình nghiên cứu về NS ở RNM Cần Giờ vẫn còn thưa thớt, trong đó vẫn chưa có công trình nghiên cứu về khả năng sinh protease của các chủng NS. Chính vì những lí do trên mà tôi chọn đề tài “Nghiên cứu và thu nhận enzyme protease từ các chủng NS ở RNM Cần Giờ”. Đối tượng và phạm vi nghiên cứu: các chủng NS phân lập tại 5 xã Long Hòa, Lí Nhơn, Tam Thôn Hiệp, An Thới Đông, Bình Khánh ở RNM Cần Giờ. Địa điểm nghiên cứu: PTN Vi sinh-Trường Đại học Sư Phạm Thành Phố Hồ Chí Minh. Mục tiêu của đề tài: Tìm ra một số chủng NS có khả năng sinh protease mạnh từ RNM Cần Giờ và nghiên cứu các điều kiện nuôi cấy tối ưu để thu nhận protease. Nhiệm vụ của đề tài: Phân lập các chủng NS từ RNM Cần Giờ. Tuyển chọn các chủng NS có khả năng sinh protease cao. Nghiên cứu đặc điểm hình thái và một số đặc tính sinh học của các chủng NS tuyển chọn. Nghiên cứu ảnh hưởng của điều kiện MT đến ST và hoạt độ protease của các chủng NS được tuyển chọn, từ đó tìm ra MT tối ưu để nuôi cấy NS thu protease. Thu nhận các chế phẩm enzyme bán tinh khiết.

pdf67 trang | Chia sẻ: maiphuongtl | Ngày: 18/06/2013 | Lượt xem: 1499 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Luận văn Nghiên cứu và thu nhận enzyme protease từ các chủng nấm sợi ở rừng ngập mặn Cần Giờ, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
NaOH 0,5N (ml) 2 2 Thuốc thử Folin (ml) 0,6 0,6 Lắc đều, để yên 10 phút, đo OD ở bước sóng 660nm 2.5.8. Phương pháp kiểm tra hoạt tính KS. Nguyên tắc. Chất KS do nấm tiết ra ức chế sự phát triển của VSV kiểm định làm cho VSV không phát triển được xung quanh lỗ khoan chứa dịch KS hay khối thạch tạo thành vòng vô khuẩn trong suốt. Cách tiến hành. Cấy NS trên môi trường MEA, nuôi 3 ngày. Dùng khoan nút chai đường kính 8mm khoan các khối KL nấm. Môi trường MPA sau khi hấp khử trùng, để nguội khoảng 45-50 độ, dùng que cấy vòng lấy một vòng VK kiểm định (B. subtilis hoặc E. coli) hòa vào MT, đổ MT vào đĩa petri. Khi môi trường MPA trong đĩa petri đã đông cứng lại, dùng kim mũi mác đặt khối thạch có KL nấm vào. Để vào tủ lạnh 4oC trong 8h để dịch KS khuyết tán vào trong thạch, sau đó chuyển sang nhiệt độ phòng để trong 24h. Kiểm tra kết quả. Khả năng sinh KS được đánh giá bằng hiệu số D-d (D: đường kính vòng vô khuẩn, d=8mm: đường kính của lỗ khoan nút chai. D-d ≥ 25mm: hoạt tính KS rất mạnh. D-d ≤ 20mm: mạnh. D-d ≥ 10: trung bình. D-d < 15mm: yếu. 2.5.9. Phương pháp xác định sự ảnh hưởng của các yếu tố MT lên khả năng ST của NS. Đánh giá khả năng ST của NS bằng cách đo đường kính KL Qui ước: d = 0mm: không mọc. d = 1-2mm: mọc yếu. d = 2,1-5: mọc trung bình. d = 5,5-10: mọc tốt. d = 11-30mm: mọc rất tốt. 2.5.9.1. Phương pháp xác định ảnh hưởng của thời gian lên ST của NS. Cấy chấm điểm các chủng NS cần nghiên cứu vào MT1, mỗi ngày đo đường kính KL, đo trong 7 ngày. 2.5.9.2. Phương pháp xác định ảnh hưởng của độ mặn lên ST của NS. Chuẩn bị MT1 có pha NaCl để tạo các nồng độ muối: 1%, 3%, 5%, 10%, 20%. Cấy chấm điểm các chủng NS cần nghiên cứu lên MT. Nuôi nấm trong 3 ngày ở 30oC. Đo đường kính KL. 2.5.9.3. Phương pháp xác định ảnh hưởng của nhiệt độ lên ST của NS. Cấy chấm điểm các chủng NS lên MT1 nuôi ở các nhiệt độ khác nhau: 20oC, 25oC, 30oC, 35oC, 40oC trong 3 ngày. Đo đường kính KL. 2.5.9.4. Phương pháp xác định ảnh hưởng của pH lên ST của NS. Chuẩn bị MT1 được điều chỉnh pH bằng NaOH 10% và HCl 10% để tạo các giá trị pH = 3,4,5,6,7,8. Cấy chấm điểm các chủng NS cần nghiên cứu. Nuôi trong 3 ngày ở 30oC. Đo đường kính KL. 2.5.9.5. Phương pháp xác định ảnh hưởng của nguồn N lên ST của NS. Sử dụng MT1. Nguồn NaNO3 lần lượt được thay thế bằng cao thịt, cao nấm men, casein, bột ĐN, (NH4)2SO4. Mẫu đối chứng là MT1. Cấy chấm điểm các chủng NS cần nghiên cứu. Nuôi trong 3 ngày ở 30oC. Đo đường kính KL. 2.5.10. Phương pháp lên men bán rắn để thu nhận protease. [6] Chuẩn bị MT lên men: cho vào bình tam giác 250ml 15g MT bán rắn, hấp khử trùng 121oC trong 30 phút. Chuẩn bị giống bào tử: Chuẩn bị ống nghiệm chứa 15ml nước cất vô trùng. Hoà lượng nước cất vô trùng này vào ống giống. Dùng que cấy mốc cà nhẹ lên bề mặt thạch để lấy bào tử, đánh nhẹ cho bào tử ở dạng huyền phù. Tiến hành đếm bào tử bằng phòng đếm hồng cầu. Nuôi cấy: Cho vào các erlen chứa MT một thể tích huyền phù sao cho mật độ bào tử là 105- 106 bào tử/gam MT (2ml). Nuôi cấy ở 30oC. Canh trường nuôi cấy được thu nhận sau 1 khoảng thời gian xác định. Thu dịch enzyme thô: Sau thời gian nuôi cấy NS, cho vào mỗi bình tam giác 100ml nước cất. Lắc 1h, sau đó lọc qua vải lọc thu lấy dịch lọc. Đem dịch lọc ly tâm 5000 vòng trong 10 phút. Thu lấy dịch ly tâm rồi định mức 100ml, ta được dung dịch enzyme thô. 2.5.11. Phương pháp xác định ảnh hưởng của các yếu tố MT đến hoạt độ protease của NS. 2.5.11.1. Ảnh hưởng của độ mặn. Chuẩn bị MT9. Cho vào MT nuôi cấy 2 ml thể tích dịch huyền phù bào tử, dùng NaCl để thay đổi độ mặn: 0%, 1%, 3%, 5%, 10%, 20%. Nuôi cấy ở nhiệt độ 30oC trong ba ngày. Thu dịch enzyme thô và đo hoạt độ protease để xác định độ mặn tối ưu. 2.5.11.2. Ảnh hưởng của nguồn N. - Chuẩn bị MT9, thay 5% bột ĐN bằng các nguồn N khác nhau: cao thịt, cao nấm men, casein, (NH4)2SO4. Nuôi cấy ở độ mặn tối ưu, nhiệt độ phòng, thời gian 3 ngày. Thu dịch enzyme thô và đo hoạt độ protease để xác định nguồn N thích hợp nhất. -Sau khi chọn được nguồn N thích hợp, tiến hành chọn tỉ lệ N tối ưu cho hoạt độ protease của các chủng NS nghiên cứu. Các tỉ lệ khảo sát: 0%, 1%, 3%, 5%, 7%, 10%. 2.5.11.3. Phương pháp xác định ảnh hưởng của nhiệt độ nuôi cấy. Chuẩn bị MT nuôi cấy thích hợp, độ mặn tối ưu. Cho vào MT nuôi cấy 2 ml thể tích dịch huyền phù bào tử. Nuôi cấy ở các nhiệt độ khác nhau: 20oC, 25 oC, 30 oC, 35 oC, 40 oC. Sau ba ngày thu enzyme thô và xác định hoạt độ protease. Từ đó xác định giá trị nhiệt độ tối ưu để thu protease. 2.5.11.4. Ảnh hưởng của độ ẩm. Chuẩn bị MT thích hợp, độ mặn và nhiệt độ nuôi cấy tối ưu. Cho vào MT nuôi cấy 2 ml thể tích dịch huyền phù bào tử. Độ ẩm thay đổi 50%, 55%, 60%, 65%, 70%, 75%. Sau ba ngày, thu dịch enzyme thô và đo hoạt độ protease từ đó xác định độ ẩm tối ưu. 2.5.11.5. Ảnh hưởng của pH. [1] Chuẩn bị MT thích hợp, độ mặn, nhiệt độ và độ ẩm nuôi cấy tối ưu. Dùng NaOH và HCl để thay đổi pH của MT ở các giá trị khác nhau: 3,4,5,6,7,8. Sau ba ngày, thu dịch enzyme thô và đo hoạt độ protease từ đó xác định pH tối ưu. 2.5.11.6. Ảnh hưởng của thời gian nuôi cấy. Nguyên tắc: Mỗi loài VSV có đường cong tăng trưởng khác nhau. Tại mỗi thời điểm khác nhau của quá trình tăng trưởng, chúng sử dụng các nguồn cơ chất khác nhau của MT nuôi cấy bằng cách tiết ra hệ enzyme thuỷ phân đặc hiệu với các hoạt độ khác nhau. Cách tiến hành. Chuẩn bị MT xốp nuôi cấy. Cho vào MT nuôi cấy 2 ml thể tích dịch huyền phù bào tử. Nuôi cấy ở độ mặn, độ ẩm, pH tối ưu. Thu dịch enzyme thô sau các khoảng thời gian nuôi cấy khác nhau: 24h, 36h, 48h, 60h, 72h, 84h, 96h. Tiến hành khảo sát hoạt độ protease tại mỗi thời điểm. Từ đó xác định thời gian nuôi cấy để hoạt độ protease cao nhất. 2.5.12. Thu nhận enzyme bán tinh khiết [21]. Chế phẩm enzyme thô từ canh trường nuôi cấy được giã bằng cối sứ với sự trợ giúp của cát, thạch anh hoặc bột thuỷ tinh. Sau đó, cho vào 1 lượng nước gấp 4-5 lần khối lượng canh trường để hòa tan enzyme từ canh trường. Tiến hành lọc và thu dịch lọc ở 4oC. Phương pháp kết tủa bằng muối (amonium sulfat) Nguyên tắc: nồng độ muối cao có tác dụng với phân tử nước bao quanh protein enzyme và làm chuyển hóa điện tích, làm thay đổi tính hòa tan của enzyme. Phương pháp kết tủa bằng dung môi hữu cơ (cồn, axeton) Nguyên tắc: dung môi hữu cơ có ảnh hưởng lớn đến khả năng hòa tan của enzyme, ảnh hưởng solvate hóa của phân tử nước xung quanh phân tử enzyme bị thay đổi, tương tác giữa các phân tử sẽ tăng lên. Cách tiến hành: Lấy cồn (hoặc aceton hoặc các muối trung tính…) đã làm lạnh đổ từ từ vào dịch lọc enzyme, khuấy nhẹ để cồn hòa đều với dịch enzyme. Để hỗn hợp này vào tủ lạnh. Sau 15-24 giờ hỗn hợp này sẽ phân thành 2 lớp. Đem ly tâm hoặc lọc để thu enzyme dạng tủa. Sấy tủa này ở nhiệt độ < 40oC ta được chế phẩm enzyme bán tinh khiết. 2.5.13. Định danh hai chủng NS bằng phương pháp di truyền phân tử Bước 1. Chạy PCR. Nguyên tắc. Tất cả các DNA polymerase khi hoạt động tổng hợp một mạch DNA mới từ mạch khuôn đều cần sự hiện diện của những mồi chuyên biệt. Mồi là những đoạn DNA ngắn có khả năng bắt cặp bổ sung với một đầu của mạch khuôn, và DNA polymerase sẽ nối dài mồi để hình thành mạch mới. Phương pháp PCR được hình thành dựa vào những đặc tính đó của các DNA polymerase. Qui trình. Phản ứng PCR là một chuỗi nhiều chu kì nối tiếp nhau, mỗi chu kì gồm 3 giai đoạn: - Giai đoạn biến tính: Trong một dung dịch phản ứng bao gồm các thành phần cần thiết cho sự sao chép, phân tử DNA được biến tính ở nhiệt độ cao hơn Tm của phân tử, thường là 94-95oC trong vòng 30 giây đến 1 phút. - Giai đoạn lai: Nhiệt độ được hạ thấp hơn Tm của các mồi (40-70oC), cho phép các mồi bắt cặp với khuôn, tuỳ thuộc Tm của các mồi sử dụng và kéo dài từ 30 giây đến 1 phút. - Giai đoạn tổng hợp: Nhiệt độ được tăng lên 72oC giúp cho DNA polymerase hoạt động tổng hợp tốt nhất. Thời gian này tùy thuộc vào độ dài trình tự DNA cần khuyếch đại . Một chu kì gồm 3 bước trên được lặp đi lặp lại nhiều lần, mỗi lần làm tăng số lượng mẫu gấp đôi của lần trước. Đây là sự khuyếch đại theo cấp số nhân. Cách tiến hành. Lấy mẫu nấm nuôi cấy một lượng khoảng ½ hạt gạo cho vào một tube eppendorf. Cho thêm 180µl TE1X vào 20 µl Prokprep rồi đem ủ ở 560C qua đêm. Thêm 500 µl phenol Buffer và 500µl L2 vào vortex khoảng 15 giây rồi đun sôi ở 100oC trong 15 phút. Sấy nhẹ rồi thêm vào 250 µl Chloroform/Isoamyl Alcohol vào vortex, lắc đều. Ly tâm 14000 vòng/ phút trong 10 phút. Hút 450 µl dịch nổi sang một tube eppendorf mới. Sau đó thêm vào 500 µl Isopropanol. Giữ tube ở nhiệt độ -20oC trong 1 đến 2 giờ. Ly tâm 14000 vòng /phút trong 15 phút ở 4 oC. Đổ bỏ dịch nổi. Rửa cặn DNA 2 lần, mỗi lần cho 500 µl Ethanol 70% vào, úp ngửa tube 3-4 lần. Ly tâm 14000 vòng/ phút trong 15 phút. Đổ bỏ dịch nổi. Làm khô cặn DNA ở 56oC trong 10-15 phút. Hòa tan cặn DNA trong 50 µl TE1X. Lấy 5µl dịch ly trích này để thực hiện kĩ thuật PCR. Lấy 5µl DNA của vi nấm sau ly trích cho vào PCR mix. Bước 2. Điện di kiểm tra trên gel agarose. Phát hiện sản phẩm PCR bằng phương pháp điện di DNA chip trên hệ thống Bio Analyzer. Bước 3. Sản phẩm PCR được tinh chế bằng kit QIAEXII của Qiagen. Bước 4. Giải trình tự đoạn RNA 28s. Sản phẩm PCR được giải trình tự trên hệ thống ABI 3130 hoặc CEQ 8000. Sau khi giải trình tự gen của NS nghiên cứu, tiến hành so sánh với trình tự gen trong hệ thống ngân hang gen của Mỹ để xác định chi và loài của chúng. 2.5.14. Phương pháp xử lý số liệu thực nghiệm. Dùng xác suất thống kê để xử lý các số liệu thu được . Tính giá trị trung bình. Giá trị trung bình bằng tổng giá trị thực của mỗi lần đo chia cho số lần đo. N: số lần đo xi: giá trị của một lần đo :giá trị trung bình Tính toán độ lệch mẫu và độ lệch chuẩn. Độ lệch mẫu: là sự khác biệt giữa giá trị của một lần đo với giá trị trung bình. Độ lệch mẫu = xi – Trong đó: xi: giá trị của một lần đo :giá trị trung bình Độ lệch chuẩn: Là sai số có thể có trong một lần đo. Với s: độ lệch chuẩn xi: giá trị của một lần đo :giátrị trung bình N: số lần đo CHƯƠNG III: KẾT QUẢ THẢO LUẬN. 3.1. Phân lập và tuyển chọn. 3.1.1. Phân lập. Tiến hành lấy mẫu từ đất mặt, đất sâu, lá mục, lá vàng, cành khô, cành mục tại 5 xã An Thới Đông, Lí Nhơn, Tam Thôn Hiệp, Long Hòa, Bình Khánh ở RNM Cần Giờ theo phương pháp 2.5.1, phân lập mẫu theo phương pháp 2.5.2. Kết quả thu được 409 chủng NS với sự phân bố như sau. Bảng 3.1. Sự phân bố các chủng NS theo nguồn cơ chất ở RNM Cần Giờ Cơ chất phân lập Số lượng chủng NS Tỉ lệ (%) Đất mặt 64 15,64 Đất sâu 53 12,96 Cành khô 59 14,43 Cành mục 81 19,8 Lá vàng 71 17,36 Lá mục 81 19,8 Biểu đồ 3.1. Sự phân bố các chủng NS theo nguồn cơ chất ở RNM Cần Giờ Từ kết quả trên cho thấy NS phân bố trên tất cả các nguồn cơ chất đã phân lập ở RNM. Tuy nhiên, trên các nguồn cơ chất khác nhau, sự phân bố của NS không như nhau. Ở đất sâu, do điều kiện yếm khí và chất dinh dưỡng ít nên có số lượng NS ít nhất. Ở thân và lá mục, số lượng NS nhiều hơn cả do ngoài chức năng cung cấp chất dinh dưỡng, thân và lá cây còn là giá thể vững chắc giúp cho NS không bị sóng triều cuốn ra biển cả [12]. Kết quả này phù hợp với kết quả nghiên cứu của Khưu Phương Yến Anh khi nghiên cứu khu hệ NS ở RNM Cần Giờ (2007) và Mai Thị Hằng khi nghiên cứu khu hệ NS ở Nam Định, Thái Bình (2002). 3.1.2. Tuyển chọn sơ bộ các chủng có hoạt tính protease Để đánh giá sơ bộ khả năng sinh protease của NS ở RNM Cần Giờ chúng tôi tiến hành tuyển chọn các chủng NS có hoạt tính protease theo phương pháp 2.5.7 Kết quả thu được ở bảng 3.2 Như vậy, trong 409 chủng NS phân lập, có 257 chủng có khả năng sinh protease, chiếm tỉ lệ 62,84%, cao hơn so với khả năng sinh cellulase (58,65%) (Khưu Phương Yến Anh, 2007) và amylase (51,04%) (Nguyễn Thị Lan Hương, 2009). Điều đó chứng tỏ rằng ngoài nguồn cơ chất phổ biến là cellulose thì nguồn cơ chất protein ở RNM cũng khá phong phú, đó là xác của các ĐV thủy sinh, kể cả lá cây khi phân hủy cũng trở thành nguồn protein dồi dào cho NS. Trong quá trình phân huỷ, lượng đạm trên các mẩu lá tăng 2 – 3 lần so với ban đầu (Kaushik và Hynes, 1971) [46], và trở thành nguồn cơ chất cảm ứng sinh protease cho các chủng NS. Kết quả này phù hợp với kết quả nghiên cứu của Mai Thị Hằng về khu hệ NS ở RNM thuộc Nam Định và Thái Bình (2002) [12]. Từ kết quả này cộng với các công trình nghiên cứu của Nguyễn Thị Lan Hương, Võ Thị Bích Viên (2009), Khưu Phương Yến Anh (2007) chứng tỏ NS là tác nhân tích cực phân giải các cơ chất tinh bột, xelluloza, protein ở RNM Cần Giờ. Do đó, chúng là tác nhân góp phần giải quyết sự ô nhiễm ở RNM, đồng thời, giữ vai trò quan trọng trong vòng tuần hoàn vật chất. Chúng là nguồn gen quí đặc thù cho hệ sinh thái và hứa hẹn tiềm năng ứng dụng trong thực tiễn. Bảng 3.2. Vòng phân giải casein của 257 chủng NS có hoạt tính protease Stt Kí hiệu chủng D-d (mm) Stt Kí hiệu chủng D-d (mm) Stt Kí hiệu chủng D-d (mm) Stt Kí hiệu chủng D-d (mm) 1 295CK5.1 3 36 298CM2 19 71 291ĐM5.1 15 106 281LM 16 2 296CK5.2 11 37 303CM5.3 18 72 300ĐM4.1 16 107 284LM 15 3 315CK2.3 19 38 310CM3.2 5 73 338ĐM1.3 27 108 292LM1 7 4 342CK2 10 39 313CM3.1 7 74 359ĐM2 19 109 301LM2.3 17 5 343CK4.1 7 40 332CM2 18 75 381ĐM4.1 17 110 316LM1 23 6 360CK3.2 8.5 41 336CM2 21.5 76 389ĐM5.1 23 111 317LM1.5 4 7 373CK1.2 10 42 337CM1 17 77 460ĐM3.2 7 112 319LM1.1 5 8 375CK3.3 7 43 365CM1 14 78 464ĐM3.1 18 113 322LM5.3 9 9 376CK2.5 12 44 372CM3.3 12 79 472ĐM1.6 4 114 341LM3 22 10 377CK1.3 5 45 383CM5.5 11 80 475ĐM5.1 16 115 345LM3 20.5 11 378CK2.3 22 46 384CM5.4 7.5 81 483ĐM5.4 3 116 346LM1.1 7 12 396CK2.1 20.5 47 391CM4.2 10 82 486ĐM3.2 10 117 348LM4.3 26 13 450CK5.2 2 48 407CM1.1 20 83 493ĐM1.3 6.5 118 353LM3 2 14 499CK3.3 10 49 408CM1.2 20 84 496ĐM2.3 4 119 354LM2 8 15 518CK4.2 4 50 409CM4.3 14 85 500ĐM2.2 3 120 355LM4 4.5 16 564CK1.3 8 51 411CM2.2 20 86 501ĐM1.2 9.5 121 382LM3.4 9 17 737CK4 4 52 413CM3.2 20 87 507ĐM2.4 4 122 390LM5.4 8 18 738CK1 4 53 414CM3.3 17 88 530ĐM1.1 11 123 400LM2.4 10 19 740CK4.2 4 54 415CM3.4 20 89 534ĐM2.1 2 124 401LM2.5 6 20 741CK3.1 4 55 416CM5.1 6 90 567ĐM1.1 7 125 402LM2.5 6 21 742CK5.2 11 56 433CM4.3 7 91 571ĐM1 11 126 404LM4.1 2.5 22 801CK4.2 8 57 442C5.3 10 92 573ĐM5.3 11 127 417LM5.2 5 23 802CK5.1 8 58 443CM4.4 20 93 574ĐM1.3 15 128 423LM4.3 10 24 803CK1.1 12 59 497CM3.2 4 94 579ĐM3.2 12 129 424LM1.1 2 25 804CK1 13 60 512CM4.1 10 95 582ĐM.2 10 130 425LM3.5 3 26 805CK5.3 4 61 517CM5.8 15 96 607ĐM1.2 12 131 434LM3.1 21 27 807CK1.1 15 62 522CM5.1 5 97 728ĐM3.2 4 132 436LM3.2 4 28 808CK3.1 8 63 525CM3.4 12 98 729ĐM5.1 2 133 438LM4.4 10 29 35CK2.2 8.5 64 526CM3.3 6 99 732ĐM2 4 134 444LM3.6 15 30 42CK2.2 3 65 531CM1.3 6 100 733ĐM3.1 4 135 463LM2.1 15 31 43CK3.1 4 66 533CM2.4 5 101 735ĐM3.1 4 136 515LM5.5 17 32 326LV2.1 4 67 548CM4.5 12 102 603ĐM2.3 4 137 538LM5.4 7 33 327LV4 10 68 558CM3.6 14 103 611ĐM3 4 138 551LM3 24 34 331LV1 20 69 559CM3.5 5 104 770ĐM1 8 139 587LM2.2 6 35 339LV2 18 70 561CM5.2 22 105 771ĐM1.4 2.5 140 597LM1 4 Bảng 3.2. Vòng phân giải casein của 257 chủng NS có hoạt tính protease (tt) Stt Kí hiệu chủng D-d (mm) Stt Kí hiệu chủng D-d (mm) Stt Kí hiệu chủng D-d (mm) Stt Kí hiệu chủng D-d (mm) 141 350LV2 12 171 562CM5.2 7 200 772ĐM4 2 229 601LM3 4 142 351LV4 20 172 583CM5.5 8 201 817ĐM1.4 3.5 230 608LM1.3 15 143 385LV1.2 10 173 599CM5.6 6 202 819ĐM5.4 10 231 715LM1 2 144 386LV3.2 14 174 602CM5.7 7 203 820ĐM5.1 14 232 716LM1.2 2 145 387LV1.1 14 175 745CM5 5 204 39ĐM3.3 10 233 717LM5 2 146 388LV4.3 14 176 746CM1 5 205 45ĐM3.1 5 234 718LM3.2 4 147 428LV2.1 2 177 749CM5.2 5 206 60ĐS1.2 13 235 719LM3.1 4 148 431LV4.1 13 178 750CM2.1 4 207 77ĐM3.2 10 236 720LM3.1 7 149 432LV5.1 5 179 751CM5.3 5.5 208 28ĐM3.2 8.5 237 721LM1.1 4 150 447LV4.5 14 180 752CM3.1 5 209 335ĐS5 16 238 723LM2.2 3 151 449LV2.2 9 181 753CM3.2 5 210 362ĐS2 2 239 727LM2 18 152 461LV5.1 5 182 754CM4 4.5 211 363ĐS3 16 240 730LM4 4 153 476LV3.2 4 183 755CM3.1 11 212 364ĐS2 2 241 739LM1.2 4 154 578LV5.3 17 184 765CM1.3 11 213 370ĐS7 2 242 790LM3.2 13 155 591LV3.3 4 185 809CM5.1 3.5 214 371ĐS5 20 243 5LM3 20 156 606LV1.3 4 186 811CM3.3 2 215 374ĐS6.2 2 244 7LM4.2 7 157 702LV3.3 5 187 812CM1.2 2.5 216 380ĐS1.1 5 245 8LM2.2 14 158 705LV3.1 4 188 814CM1.1 5 217 397ĐS2 20 246 9LM4.1 7 159 709LV2 4 189 815CM1.4 4.5 218 421ĐS1.2 2 247 11LM3 8 160 714LV2 3 190 12CM3.4 24 219 435ĐS5.3 6 248 13LM5.1 20 161 787LV3.2 4 191 18CM3.2 10 220 454ĐS5 5 249 16LM5.2 12 162 793LV1.2 16 192 19CM5.1 17 221 455ĐS4 2 250 17LM3.3 3 163 795LV4.5 24 193 21CM3.4 10 222 456ĐS3 12 251 20LM4.2 22 164 30LV3.3 3 194 32CM2.1 12 223 457ĐS5 7 252 23LM2.2 15 165 65LV2.1 5 195 33CM1.3 4 224 469ĐS3.1 10 253 27LM2 12 166 74LV4 8 196 36CM1.1 6.5 225 509ĐS3 7 254 31LM2.2 18 167 290ĐS2 16 197 41CM4.2 14 226 777ĐS5.2 6 255 38LM3.1 6 168 302ĐS1 20 198 46CM3.3 16 227 782ĐS2.1 5 256 56LM3.4 8 Từ kết quả trên, có thể tóm tắt được khả năng sinh protease của các chủng NS phân lập được qua bảng 3.3, bảng 3.4 và biểu đồ 3.2 Bảng 3.3. Tóm tắt khả năng sinh protease của các chủng NS phân lập Không có hoạt tính Rất mạnh Mạnh Trung bình Yếu Số chủng Tỉ lệ (%) Số chủng Tỉ lệ (%) Số chủng Tỉ lệ (%) Số chủng Tỉ lệ (%) Số chủng Tỉ lệ (%) 210 44.97 2 0.43 26 5.57 88 18,84 94 20.13 Biểu đồ 3.2. Khả năng sinh protease của các chủng NS ở RNM Cần Giờ Bảng 3.4. Sự phân bố các chủng NS có hoạt tính protease theo nguồn cơ chất Cơ chất phân lập Số chủng có hoạt tính protease/ tổng số Tỉ lệ (%) Đất mặt 43/63 67,18 Đất sâu 25/53 47,17 Cành khô 31/59 52,54 Cành mục 65/81 80,25 Lá vàng 30/71 42,25 Lá mục 63/81 77,78 169 308ĐS4.1 3 199 48CM4 4 228 53ĐS5.1 4 257 289ĐS 10 170 78CM2.2 5 Từ kết quả trên cho thấy số chủng NS có khả năng sinh protease khá nhiều, nhưng đa số có hoạt tính protease trung bình và yếu, chỉ có một số ít chủng có hoạt tính protease rất mạnh và mạnh (6%). Trên các nguồn cơ chất khác nhau, khả năng sinh protease cũng khác nhau do khả năng sinh enzyme này phụ thuộc rất nhiều vào chất cảm ứng protein. Nguồn cơ chất lá vàng có số chủng sinh protease thấp nhất do đây không phải là nguồn cơ chất phù hợp cho sinh tổng hợp protease của NS. Ngược lại, trên thân mục, cành mục và đất mặt số chủng có khả năng sinh protease lại rất cao. Nguyên nhân là ở các cơ chất này có nguồn protein phong phú hơn từ xác các SV bị phân hủy. Trong tổng số 28 chủng có hoạt tính protease mạnh, chúng tôi chọn 10 chủng có hoạt tính protease cao nhất tiếp tục nghiên cứu. Hình 3.1. Vòng phân giải casein của 10 chủng NS có hoạt tính protease cao nhất. 12CM3.4 551LM3 348LM4 341LM3 338ĐM1.3 795LV4.5 389ĐM5. 336CM2 316LM1 378CK2. 3.1.3. Tuyển chọn lần 2. Để đánh giá chính xác khả năng sinh protease của các chủng NS tuyển chọn, chúng tôi tiến hành xác định hoạt độ protease theo phương pháp 2.5.7 của 10 chủng NS có đường kính vòng phân giải lớn nhất. Bảng 3.5. Hoạt độ protease của 10 chủng NS tuyển chọn. Stt Kí hiệu chủng NS D-d (mm) Hoạt độ protease (UI/ml) Sai số 1 338Đ1.3. 27 1.929 0.009 2 341LM3 22 1.306 0.006 3 348LM4.3 26 1.889 0.012 4 795LV4.5 24 1.603 0.010 5 378CK2.3 22 1.646 0.012 6 551LM3 23 1.918 0.003 7 12CM3.4 24 2.054 0.012 8 336CM2 21 1.611 0.002 9 389Đ5.1 23 1.733 0.001 10 316LM1 23 1.754 0.019 Kết quả cho thấy 4 chủng NS có hoạt độ protease cao nhất là: 338Đ1.3 (1.929UI/ml) 348LM4.3 (1.889UI/ml) 551LM3 (1.918 UI/ml) 12CM3.4 (2.054 UI/ml). Kết quả được minh họa ở biểu đồ 3.3. Biểu đồ 3.3. Hoạt độ protease của 10 chủng NS có đường kính vòng phân giải lớn nhất. - Khả năng chịu mặn là một đặc trưng quan trọng của các chủng NS có nguồn gốc RNM. Đặc trưng của điều kiện sống ở RNM Cần Giờ là độ mặn cao, dao động khoảng từ 1.8% - 3%. Các chủng NS ở đây phát triển tốt ở MT có độ mặn khá cao. Hơn nữa, khả năng chịu mặn còn ảnh hưởng rất lớn đến phạm vi ứng dụng của các chủng NS. Vì vậy, chúng tôi tiếp tục tuyển chọn bằng cách nghiên cứu ảnh hưởng của độ mặn đến khả năng ST của 4 chủng NS trên. Kết quả được trình bày ở bảng 3.6 và biểu đồ 3.4. Bảng 3.6. Khả năng chịu mặn của bốn chủng NS Độ mặn (%) Khả năng sinh trưởng (mm) 12CM3.4 338Đ1.3 348LM4.3 551LM3 0 5 2.5 5 8 1 6.5 6 7 9 3 12.5 5.5 4.5 8 5 8 2 1 5.5 10 5 0 0 1 20 0 0 0 0 Kết quả nghiên cứu cho thấy trong số 4 chủng NS được tuyển chọn, 2 chủng có khả năng chịu mặn tốt hơn là 12CM3.4 và 551LM3. Ở nồng độ muối 5%, hai chủng này vẫn có khả năng ST tốt. Ở nồng độ muối rất cao là 10%, hai chủng này vẫn có khả năng ST. Chủng có khả năng chịu mặn cao nhất là 12CM3.4. Hai chủng 338ĐM1.3 và 348LM4.3 chịu mặn kém hơn, mọc yếu ở nồng độ muối 5%, và không mọc ở nồng độ muối 10%. Tử kết quả trên chúng tôi quyết định chọn hai chủng NS có khả năng chịu mặn cao nhất là 12CM3.4 và 551LM3 để đi sâu nghiên cứu. Đồ thị 3.1. Ảnh hưởng của độ mặn đến ST của bốn chủng NS 3.2. Phân loại hai chủng NS. 3.2.1. Phân loại đến chi. Tiến hành cấy 2 chủng NS đã tuyển chọn vào MT1 theo phương pháp 2.5.5 và 2.5.6 để xác định các đặc điểm hình thái đại thể và vi thể của chúng. Sau đó định danh đến chi hai chủng này dựa trên khóa phân loại của Bùi Xuân Đồng. (2003) Hình 3.2. Mặt phải KL của hai chủng 551LM3 và 12CM3.4 12CM3.4551LM3 Hình 3.3. Mặt trái KL của hai chủng 551LM3 và 12CM3.4 Hình 3.4. Cơ quan sinh bào tử của hai chủng 551LM3 và 12CM3.4 Bảng 3.7. Đặc điểm hình thái đại thể, vi thể và phân loại đến chi hai chủng NS Kí hiệu chủng Đặc điểm hình thái Đặc điểm phân loại tương ứng theo Bùi Xuân Đồng (2003) 12CM3.4 551LM 12CM3.4 551LM3 12CM3.4 KL: Mặt phải tròn, nhung mịn, màu xanh lục, không có vết khía xuyên tâm, có vòng đồng tâm, mép viền trắng. Mặt trái màu hơi nâu, không tiết sắc tố. Hình thái vi thể: Sợi nấm ngăn vách, phân nhánh, bộ máy mang bào tử trần dạng chổi, bào tử trần hình elip, gần cầu. Chi Penicillium - Hình thái đại thể: KL màu lục,vàng lục, xanh lục, lục xám. Mặt trái không màu hoặc có màu sắc khác nhau. KL có hoặc không có vết khía xuyên tâm hay đồng tâm. - Hình thái vi thể: Sợi nấm ngăn vách, phân nhánh. Bộ máy mang bào tử trần dạng chổi. Bào tử trần không có vách ngăn, hình cầu, gần cầu, hình trứng, elip, đôi khi hình trụ. 551LM3 KL: Mặt phải tròn, dạng bột xốp bông nhẹ, màu tím nhạt, có vòng đồng tâm, mép viền trắng. Mặt trái không màu, không tiết sắc tố. Hình thái vi thể: Sợi nấm ngăn vách, phân nhánh, bộ máy mang bào tử trần dạng chổi, thể bình có phần gốc hình trụ, phần ngọn thon nhỏ đột ngột tạo thành cổ dài, bào tử trần hình elip. Chi Paecilomyces -Hình thái đại thể: KL màu trắng, lục, tím nhạt hoặc vàng nâu. - Hình thái vi thể: Giá bào tử trần đơn độc hoặc thành bó giá, phân nhánh không đều hoặc thành vòng. Thể bình gồm phần gốc hình trụ hoặc hình gần trứng, phần ngọn thon nhỏ đột ngột tạo thành một cổ dài. Bào tử không ngăn vách, không có màu hoặc màu nhạt. Kết luận: chủng 12CM3.4 thuộc chi Penicillium. chủng 551LM3 thuộc chi Paecilomyces 3.2.2. Phân loại đến loài bằng di truyền học phân tử. Chúng tôi tiến hành định danh tới loài 2 chủng NS trên tại Công ty Nam Khoa bằng phương pháp giải trình tự gen 28s rRNA, kết quả như sau: Kết quả giải trình tự gen 28s rRNA của chủng NS kí hiệu 12CM3.4 AGCCGGCATTCGTGCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGG CGGCCGGTCAAAGGCCCCTGGAATGTAACGCCTCTCGGGGCGTCTTATAGCCAGGGGT GCCATGCGGCCTGCCCGGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGT CGAAGCGACCCGTCTTGAAACACGGACCAAGGAGTC Trình tự này đối chiếu với trình tự 28s rRNA của các chủng NS đã được định loại trong ngân hàng gen Blast. Kết quả đối chiếu cho thấy chủng 12CM3.4 là Penicillium paxilli. Sự trùng khớp 206/207. Độ chính xác 99%. Kết quả giải trình tự gen 28s rRNA của chủng NS kí hiệu 551LM3 GTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCCCGGTGGATCCA GCGTTCTCGCTGGTTGCACTCCGCCGGGTTCAGGCCAGCATCAGTTCGCCGCGGGGGAA AAAGGCTTCGGGAACGTGGCTCCTACGGGAGTGTTATAGCCCGTTGCATAATACCCTG GGGCGGACTGAGGTTCGCGCTCCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCG TCTTGAAACACGGACCAAGGAGTC Kết quả đối chiếu cho thấy chủng NS kí hiệu 551LM3 là Paecilomyces lilacinus. Sự trùng khớp 255/255. Độ chính xác 100%. 3.3. Nghiên cứu ảnh hưởng của điều kiện MT đến ST và hoạt độ protease của hai chủng NS tuyển chọn. 3.3.1. Ảnh hưởng của độ mặn. 3.3.1.1. Ảnh hưởng của độ mặn đến ST Nuôi cấy các chủng NS ở MT1. Thay đổi độ mặn bằng NaCl để tạo các nồng độ muối khác nhau ở MT nuôi cấy: 1%, 3%, 5%, 10%, 20% MT đối chứng là MT không có NaCl (0%) Kết quả ở bảng 3.8 và minh họa trong biểu đồ 3.4. Bảng 3.8. Ảnh hưởng của độ mặn đến ST của hai chủng NS Độ mặn (%) Khả năng sinh trưởng (mm). Penicillium paxalli Paecilomyces lilacinus 0 5 8 1 6.5 9 3 12.5 8 5 8 5.5 10 5 1 20 0 0 Biểu đồ 3.4. Ảnh hưởng của độ mặn đến ST của hai chủng NS Chủng Paecilomyces lilacinus phát triển ngang nhau ở MT có độ mặn dao động từ 1%-3% và tương đương với MT đối chứng (8mm). Độ mặn thích hợp nhất cho ST của chủng này là 1% (9mm). Sự ST của chủng Penicillium paxalli tăng tỉ lệ thuận với độ mặn của MT và đạt cực đại ở 3% (12,5mm), mạnh hơn hẳn so với đối chứng (5mm), sau đó ST giảm hẳn ở nồng độ 5%-10%. Đặc điểm chung của cả hai chủng NS là chúng đều phát triển tốt ở MT nước ngọt lẫn nước lợ. Điều đó cho thấy hai chủng NS được du nhập từ đất liền và thích nghi lâu dài với điều kiện sống ở RNM. Chúng là những VSV chịu mặn tuỳ tiện. Tuy nhiên, khi độ mặn của MT quá cao (>5%) không phù hợp cho ST của cả hai chủng NS. Penicillium paxilli 0% 1% 3% 5% 10% Paecilomyces lilacinus Hình 3.5. Ảnh hưởng của độ mặn đến ST của hai chủng NS. Ở MT 1% và 3% cả hai chủng NS đều phát triển bằng hoặc tốt hơn MT đối chứng (0%). Điều này chứng tỏ hai chủng NS đã có quá trình thích nghi lâu dài với điều kiện sống ở RNM Cần Giờ. Kết quả này phù hợp với kết quả nghiên cứu khả năng chịu mặn của Mai Thị Hằng (2002) về khả năng chịu mặn của các chủng NS ở RNM Nam Định và Thái Bình đã xác định được 122/137 chủng NS phát triển tốt trên MT có độ mặn 3%-5% [12] 3.3.1.2. Ảnh hưởng của độ mặn đến hoạt độ protease. Mục đích của thí nghiệm này là tìm ra được độ mặn tối ưu cho hoạt độ protease của hai chủng NS nghiên cứu. Tiến hành nuôi cấy 2 chủng NS vào MT9. Thay đổi độ mặn bằng NaCl tạo độ mặn khác nhau ở MT nuôi cấy: 0%, 1%, 3%, 5%, 10%. Sau ba ngày nuôi cấy, thu dịch enzyme thô, xác định hoạt tính protease theo phương pháp Anson. Kết quả thu được ở bảng 3.9 và minh họa bằng đồ thị 3.2. Bảng 3.9. Ảnh hưởng của độ mặn đến hoạt độ protease của hai chủng NS. Độ mặn (%) Hoạt độ protease (UI/ml) Penicillium paxilli Sai số Paecilomyces lilacinus Sai số 0 0.985 0.047 0.690 0.005 1 1.443 0.006 1.874 0.001 0% 1% 3% 5% 10% 3 2.158 0.004 1.939 0.004 5 1.824 0.005 1.661 0.019 10 0.550 0.005 0.057 0.001 Ở MT có độ mặn 0%, hai chủng NS vẫn có khả năng ST khá tốt (chủng Penicillium paxilli đạt 5mm, chủng Paecilomyces lilacinus đạt 8mm), nhưng khả năng sinh protease rất thấp (hoạt độ protease của chủng Penicillium paxalli là 0.985 UI/ml, của chủng Paecilomyces lilacinus 0.690UI/ml). Trong khi đó, ở độ mặn từ 1% đến 3%, khả năng ST và hoạt độ protease của chúng đều rất cao, đạt cực đại ở 3%. Đây cũng chính là độ mặn trung bình ở RNM Cần Giờ. Kết quả nghiên cứu của Khưu Phương Yến Anh về cellulase (2007) và Nguyễn Thị Lan Hương và amylase (2007) đều xác định hoạt độ của các enzyme này mạnh nhất ở MT có độ mặn từ 1-3%. Điều đó chứng tỏ rằng hoạt độ protease nói riêng và các enzyme ngoại bào nói chung của nấm sợi RNM ở MT nước lợ cao hơn MT nước ngọt. Đây là điểm đặc trưng của NS rừng ngập mặn. Như vậy độ mặn có ảnh hưởng rất lớn đến khả năng sinh protease của NS ở RNM. Nhờ khả năng sinh protease cao ở MT nước lợ mà các chủng NS đã góp phần tham gia vào giải quyết vấn đề ô nhiễm MT. Đồ thị 3.2. Ảnh hưởng của độ mặn đến hoạt độ protease của hai chủng NS. 3.3.2. Ảnh hưởng của nguồn N. 3.3.2.1. Ảnh hưởng của nguồn N đến ST. Dùng MT1 làm đối chứng, bổ sung các nguồn N khác nhau: cao thịt, cao nấm men, casein, bột đậu nành, (NH4)2SO4. Kết quả ở bảng 3.10 và minh họa ở biểu đồ 3.5. Từ kết quả trên cho thấy cả hai chủng NS đều có khả năng ST tốt trên các nguồn N khác nhau. Sự ST của hai chủng NS ở các nguồn N khác nhau tương đương hoặc thấp hơn MT đối chứng (nguồn N là NaNO3). Trong MT cao thịt, casein và bột ĐN, chủng Penicillium paxilli ST mạnh hơn chủng Paecilomyces lilacinus, trong MT có nguồn N là cao nấm men thì ngược lại, Paecilomyces lilacinus ST mạnh hơn. Cả hai chủng NS đều có khả năng đồng hóa tốt nguồn N vô cơ. Hai chủng NS đều phát triển ở MT casein tốt hơn bột ĐN vì so với bột ĐN casein là nguồn N dễ tiêu hơn. Bảng 3.10. Ảnh hưởng của nguồn N đến ST của hai chủng NS. Nguồn nitơ Khả năng sinh trưởng (mm) Penicillium paxalli Sai số Paecilomyces lilacinus Sai số Đối chứng 10.0 0.000 11.7 0.333 (NH4)2SO4 9.3 0.167 10.5 0.000 Cao thịt 5.8 0.167 10.0 0.000 Cao nấm men 8.7 0.333 6.7 0.167 Casein 11.0 0.000 12.2 0.167 Bột đậu nành 9.0 0.000 10.5 0.000 Biểu đồ 3.5. Ảnh hưởng của nguồn N đến ST của hai chủng NS 3.3.2.2.Ảnh hưởng của nguồn N đến hoạt độ protease. Nuôi cấy NS vào MT9 trong đó thay 5% bột ĐN bằng các nguồn N khác nhau: cao thịt, cao nấm men, casein, (NH4)2SO4 để tìm ra nguồn N tối ưu cho hoạt độ protease. Độ mặn MT là 3%. Kết quả thu đuợc thể hiện ở bảng 3.11 và biểu đồ 3.6. Bảng 3.11. Ảnh hưởng của nguồn N đến hoạt độ protease của hai chủng NS Nguồn nitơ Hoạt độ protease (UI/ ml) Penicillium paxalli Sai số Paecilomyces lilacinus Sai số Cao thịt 1.729 0.016 1.876 0.008 Cao nấm men 1.710 0.053 1.809 0.015 Casein 2.151 0.008 1.918 0.010 Bột đậu nành 2.187 0.029 1.928 0.017 (NH4)2SO4 1.344 0.149 1.237 0.177 Biểu đồ 3.6. Ảnh hưởng của nguồn N đến hoạt độ protease của hai chủng NS Từ kết quả khảo sát cho thấy trong các nguồn N khác nhau, hai chủng NS đều có khả năng tổng hợp protease khá cao. Trong môi trường có nguồn N là (NH4)2SO4 thì hoạt độ protease thấp nhất ở cả hai chủng vì đây không phải là chất cảm ứng sinh protease. Tuy nhiên, trong thành phần dinh dưỡng của cám đã có 10-12.2% protein thô đóng vai trò là chất cảm ứng nên 2 chủng NS vẫn có khả năng sinh protease nhưng hoạt độ kém hơn hẳn ở MT có bổ sung nguồn N hữu cơ. Cả 4 nguồn N cao thịt, cao men, casein và bột ĐN đều là nguồn chất cảm ứng tốt cho sinh tổng hợp protease. Casein và bột ĐN là nguồn N mà hai chủng NS hoạt độ protease cao nhất. Nguyên nhân bột ĐN cho hoạt độ protease cao so với các chất cảm ứng khác có thể liên quan đến thành phần phần acid amin. Hàm lượng cystein trong cao thịt (2.5%) và cao nấm men (1.3%) cao hơn hẳn trong bột ĐN (0.3%). Cystein có thể kiềm hãm khả năng sinh protease của một số chủng NS. Dù cả casein và bột ĐN đều cho hoạt lực protease cao. Tuy nhiên, xét về tính kinh tế, bột ĐN có giá thành rẻ hơn nhiều so với casein, nên chúng tôi chọn bột đậu nành làm nguồn N để tiếp tục nghiên cứu. Đối với protease, bột ĐN đóng vai trò là cơ chất cảm ứng. Hàm lượng chất cảm ứng cũng ảnh hưởng lớn đến hoạt độ protease nên chúng tôi tiếp tục nghiên cứu về ảnh hưởng của tỉ lệ bột ĐN đến hoạt độ protease. Kết quả trình bày ở bảng 3.12 và biểu đồ 3.7. Bảng 3.12. Ảnh hưởng của hàm lượng ĐN đến hoạt độ protease của hai chủng NS. Hàm lượng đậu nành (%) Hoạt độ protease (UI/ ml) Penicillium paxalli Sai số Paecilomyces lilacinus Sai số 0 0.850 0.028 1.229 0.005 1 1.783 0.015 1.857 0.015 3 2.173 0.012 1.954 0.012 5 2.191 0.023 1.922 0.006 7 1.434 0.005 1.232 0.004 10 1.356 0.021 1.129 0.011 Biểu đồ 3.7. Ảnh hưởng của hàm lượng ĐN đến hoạt độ protease của hai chủng NS. Từ kết quả trên cho thấy khi MT không có ĐN, hai chủng NS vẫn có khả năng tổng hợp protease nhưng hoạt độ rất yếu. Hoạt độ protease tăng tỉ lệ thuận với sự tăng tỉ lệ bột ĐN cho tới giá trị cực đại thì bắt đầu giảm xuống. Đối với chủng Penicillium paxalli thì ở hàm lượng ĐN 3-5% hoạt tính protease rất mạnh, nhưng cực đại là ở 5%. Chủng Paecilomyces lilacinus thì hoạt tính protease cao ở tỉ lệ ĐN 1-5%, nhưng cực đại ở 3%. 3.3.3. Ảnh hưởng của nhiệt độ. 3.3.3.1. Ảnh hưởng của nhiệt độ đến ST Cấy các chủng NS vào MT1, nuôi ở các điều kiện nhiệt độ khác nhau: 20oC, 25oC, 30oC, 35oC, 40oC . Đo đường kính vòng ST sau 3 ngày nuôi cấy. Kết quả được trình bày ở bảng 3.13 và biểu đồ 3.8. Nhiệt độ tốt nhất cho sự ST của hai chủng NS trên là 30oC. Nhiều nghiên cứu cũng chứng minh rằng nhiệt độ thích hợp cho đa số NS là 28-32oC[ 19]. Ở 20oC và 40oC, hai chủng NS đều ST rất yếu do nhiệt độ quá thấp hay quá cao làm ảnh hưởng đến nồng độ các chất hòa tan trong MT nuôi cấy và các phản ứng xúc tác trong tế bào NS, từ đó ức chế ST của chúng. Khoảng nhiệt độ thích hợp cho ST của hai chủng NS là 25oC-30oC. Khoảng nhiệt độ này phù hợp với nhiệt độ trung bình ở RNM là 25,8oC. Ở 40oC, hai chủng NS này đều ST yếu, điều đó cho thấy đây không phải là hai chủng ưa nhiệt và chúng đều thích nghi với điều kiện nhiệt độ ở RNM Cần Giờ. Bảng 3.13. Ảnh hưởng của nhiệt độ đến ST của hai chủng NS. Nhiệt độ (oC) Khả năng sinh trưởng (mm) Penicillium paxalli Paecylomyces lilacinus 20 2.5 3.8 25 10.7 10.2 30 12.0 12.3 35 2.2 4.0 40 1.0 1.0 Biểu đồ 3.8. Ảnh hưởng của nhiệt độ đến ST của hai chủng NS. 3.3.3.2. Ảnh hưởng của nhiệt độ đến hoạt độ protease Để xác định nhiệt độ nuôi cấy cho hoạt độ protease cao nhất, chúng tôi tiến hành nuôi cấy 2 chủng NS vào MT9, độ mặn 3%, hàm lượng bột ĐN 3% đối với chủng Paecilomyces lilacinus, 5% đối với Penicillium paxilli. Khảo sát ở các nhiệt độ khác nhau: 20oC, 25oC, 30oC, 35oC, 40oC. Sau 3 ngày, ly trích dịch enzyme thô và tiến hành xác định hoạt độ protease theo phương pháp Anson. Kết quả thu được trình bày ở bảng 3.14 và minh họa trong đồ thị 3.3. Nhiệt độ (oC) Bảng 3.14. Ảnh hưởng của nhiệt độ đến hoạt độ protease của hai chủng NS Nhiệt độ (oC) Hoạt độ protease (UI/ml) Penicillium paxalli Sai số Paecilomyces lilacinus Sai số 20 0.014 0.000 0.581 0.020 25 1.903 0.002 1.195 0.007 30 2.206 0.005 1.963 0.004 35 0.195 0.016 1.508 0.015 40 0.062 0.007 0.129 0.007 Đồ thị 3.3. Ảnh hưởng của nhiệt độ đến hoạt độ protease của hai chủng NS. Từ kết quả trên cho thấy, hoạt độ protease của hai chủng NS tăng nhanh từ 20oC đến 30oC, đạt cực đại ở 30oC và giảm nhanh từ 30oC đến 40oC. Khoảng nhiệt độ để hai chủng NS có hoạt độ protease cao là 25-30oC, phù hợp với nhiệt độ thích hợp cho ST của hai chủng NS này. Ở nhiệt độ quá thấp hay quá cao, khả năng sinh protease của hai chủng NS giảm vì các phản ứng sinh hóa trong các tế bào bị ức chế. Theo Nguyễn Đức Lượng, nhiệt độ MT thích hợp trong nuôi cấy NS thu protease là khoảng từ 29oC-31oC [21]. Như vậy, kết quả nghiên cứu trên cho thấy 2 chủng NS đều ST tốt và hoạt độ protease cao trong khoảng nhiệt độ từ 25oC -30oC, đây cũng là khoảng nhiệt độ trung bình ở RNM Cần Giờ. Điều đó chứng tỏ rằng cả 2 chủng NS này đều thích nghi với điều kiện nhiệt độ ở RNM Cần Giờ. 3.3.4. Ảnh hưởng của độ ẩm Chúng tôi tiến hành nuôi cấy 2 chủng NS vào MT9, độ mặn 3%, hàm lượng bột ĐN 3% đối với chủng Paecilomyces lilacinus, 5% đối với Penicillium paxilli. Nuôi cấy ở 30oC. Điều chỉnh các Nhiệt độ (oC) Nhiệt độ (oC) giá trị độ ẩm khác nhau: 50%, 55%, 60%, 65%, 70%, 75%. Sau ba ngày nuôi cấy, thu dịch enzyme thô và xác định hoạt độ protease theo phương pháp Anson. Kêt quả thu ở bảng 3.15 và minh họa ở đồ thị 3.4. Từ kết quả trên cho thấy tác động của độ ẩm lên hoạt độ protease của hai chủng NS khác nhau. Chủng Penicillium paxalli có hoạt độ protease cao trong khoảng độ ẩm dao động từ 50% đến 60%, cao nhất ở ở 55% (2,337UI/ml). Ở độ ẩm 60-75%, hoạt độ protease của chủng này giảm. Trong khi đó, chủng Paecilomyces lilacinus cho hoạt độ protease tốt ở khoảng độ ẩm từ 60%-65%, độ ẩm tối ưu là 65% (2,053UI/ml). Ở các điều kiện độ ẩm khác, chủng này có hoạt độ protease kém. Độ ẩm là một yếu tố ảnh hưởng rất lớn đến quá trình lên men bề mặt. Khi độ ẩm thấp quá thì sẽ kéo dài thời gian ST và từ đó kéo dài thời gian tạo enzyme của NS. Ngược lại, độ ẩm quá cao làm cho MT bị kết dính làm cho nấm sợi ST và tạo enzyme yếu. RNM Cần Giờ có độ ẩm trung bình tương đối cao, dao động từ 73%-85%. Tuy nhiên, độ ẩm này thay đổi phụ thuộc vào mùa và địa điểm. Vào mùa mưa độ ẩm cao hơn mùa khô. Mẫu được thu vào giao điểm giữa mùa khô và mùa mưa (tháng 11), ở địa điểm tương đối khô ráo, nên độ ẩm thấp hơn so với độ ẩm tương đối trong năm. Do đó có thể nói hai chủng NS nghiên cứu thích nghi được với điều kiện sống ở RNM. Bảng 3.15. Ảnh hưởng của độ ẩm đến hoạt độ protease của hai chủng NS Độ ẩm (%) Hoạt độ protease (UI/ml) Penicillium paxalli Sai số Paecilomyces lilacinus Sai số 50 2.039 0.005 0.463 0.000 55 2.337 0.005 1.676 0.001 60 2.255 0.019 1.937 0.008 65 1.424 0.001 2.053 0.014 70 1.420 0.005 1.095 0.007 75 1.325 0.027 0.957 0.010 Đồ thị 3.4. Ảnh hưởng của độ ẩm đến hoạt độ protease của hai chủng NS 3.3.5. Ảnh hưởng của pH. 3.3.5.1. Ảnh hưởng của pH đến ST. pH ảnh hưởng rất lớn đến sự phát triển của NS. Mục đích của thí nghiệm này là xác định điều kiện pH tối ưu cho ST của hai chủng NS. Dùng MT1 làm đối chứng (pH 6,5). Điều chỉnh bằng NaOH 10% và HCl 10% để tạo MT có pH 3,4,5,6,7, 8. Kết quả thu được trình bày ở bảng 3.16 và biểu đồ 3.9. Bảng 3.16. Ảnh hưởng của pH đến ST của hai chủng NS pH Khả năng sinh trưởng (mm) Penicillium paxalli Paecilomyces lilacinus Đối chứng 10 12 3 2.5 3.0 4 10.0 12.7 5 13.2 15.0 6 9.3 14.7 7 8.8 12.3 8 5.0 10.2 Biểu đồ 3.9. Ảnh hưởng của pH đến ST của hai chủng NS. Kết quả cho thấy khi pH quá acid (3-4) hoặc quá kiềm (pH=8) đều không thích hợp cho ST của hai chủng NS. Ở các giá trị này, hai chủng NS đều sinh trưởng kém hơn nhiều trên MT đối chứng (pH 6.5). Nhiều nghiên cứu đều xác định pH quá thấp hoặc quá cao sẽ không thích hợp cho ST của đa số NS [6]. Hai chủng NS có thể ST tốt trong khoảng pH rất rộng dao động từ 4-7. Ở các giá trị pH này, chúng đều ST không chênh lệch nhiều so với MT đối chứng. pH tối ưu cho ST của cả hai chủng NS là 5. Đặc biệt, chủng Paecilomyces lilacinus có mức ST tương đương trong khoảng pH từ 4-8. Kết quả trên phù hợp với nghiên cứu của Ingold (1967) đã xác định pH tối ưu cho NS sinh trưởng dao động trong khoảng 5-6.5. Mặt khác cũng chứng tỏ hai chủng NS thích hợp với môi trường sống ở RNM Cần Giờ, pH trung bình ở đây dao động trong khoảng 5.8-6.5 [61]. 3.3.5.2. Ảnh hưởng của pH đến hoạt độ protease. Nuôi cấy 2 chủng NS vào MT9, nhiệt độ 30oC, độ mặn 3%. Hàm lượng ĐN 5%, độ ẩm 55% đối với Penicillium paxalli; hàm lượng ĐN 3%, độ ẩm 65% đối với Paecilomyces lilacinus .Thay đổi pH của MT từ 3-8. Kết quả thu được trình bày ở bảng 3.17 và đồ thị 3.5. Bảng 3.17. Ảnh hưởng của pH đến hoạt độ protease của hai chủng NS. pH Hoạt độ protease (UI/ml) Penicillium paxalli Sai số Paecilomyces lilacinus Sai số 3 0.305 0.022 0.192 0.009 4 1.423 0.003 2.026 0.043 Điểm khác biệt của hai chủng này là ở pH =8, chủng Paecilomyces lilacinus vẫn có khả năng tổng hợp protease khá cao, trong khi đó, chủng Penicillium paxilli tổng hợp protease rất yếu. Nguyên nhân là do điểm pH này, chủng Paecilomyces lilacinus vẫn phát triển tốt, trong khi đó, chủng Penicillium paxilli phát triển rất kém. Khoảng pH mà hai chủng NS có hoạt độ protease mạnh dao động từ 5-7, phù hợp với điều kiện pH ở RNM. Nhiều nghiên cứu cũng cho thấy pH thích hợp để nuôi cấy NS thu protease là 5.6- 6.2 [19]. pH tối ưu của cả hai chủng là 5, phù hợp với pH tối ưu cho sinh trưởng của hai chủng NS. Khi pH quá cao hoặc quá thấp làm ức chế quá trình trao đổi chất của và khả năng hoạt hóa của NS, do đó sự ST và hoạt độ protease giảm. Đồ thị 3.5. Ảnh hưởng của pH đến hoạt độ protease của hai chủng NS 3.3.6. Ảnh hưởng của thời gian . 5 2.377 0.011 2.101 0.018 6 2.250 0.003 1.986 0.020 7 2.250 0.005 1.941 0.006 8 0.151 0.023 1.703 0.007 3.3.6.1. Ảnh hưởng của thời gian đến ST Cấy các chủng NS vào MT1, mỗi ngày đo đường kính KL, đo trong 7 ngày liên tiếp. Kết quả trình bày ở bảng 3.18 và biểu đồ 3.10. Kết quả nghiên cứu cho thấy hai chủng NS có tốc độ ST tương đối bằng nhau. Thời gian ST mạnh nhất của chủng Penicillium paxalli là từ ngày thứ 4 đến ngày thứ 5, đường kính vòng ST từ ngày 4 đến ngày 5 tăng 6,7mm, trong khi đó, từ ngày 1 đến ngày 4, sự tăng trưởng tương đối đồng đều, mỗi ngày đường kính vòng tăng trưởng tăng khoảng 4mm. Từ ngày thứ 5 đến ngày thứ 7, tốc độ tăng trưởng giảm rõ rệt. Chủng Paecilomyces lilacinus có thời gian tăng trưởng mạnh nhất là từ ngày 2 đến ngày 3, đường kính vòng tăng trưởng tăng 5,7mm. Từ ngày 3 trở đi, sự tăng trưởng giảm lại, mỗi ngày tăng từ 2-3mm. Bảng 3.18. Ảnh hưởng của thời gian đến ST của hai chủng NS. Thời gian (ngày) Khả năng sinh trưởng (mm) Penicillium paxalli Paecilomyces lilacinus 1 2.0 1.7 2 6.2 6.3 3 10.0 12.0 4 14.0 15.2 5 20.7 18.7 6 22.3 22.8 7 22.8 25.0 Biểu đồ 3.10. Ảnh hưởng của thời gian đến sự ST Theo nghiên cứu của S. S. Tzean và S. C. Chiu (1988) xác định rằng chủng Penicillium paxilli sau 7 ngày nuôi cấy đường kính ST đạt 52mm [67], gấp đôi so với kết quả chúng tôi nghiên cứu. Như vậy, so với các chủng NS ở đất liền, khả năng ST của NS ở RNM là chậm hơn. Đây là điểm đặc trưng về sinh trưởng của NS ở RNM. Kết quả này phù hợp với các kết quả nghiên cứu của Khưu Phương Yến Anh (2007) và Nguyễn Thị Lan Hương (2009). 3.3.6.2. Ảnh hưởng của thời gian nuôi cấy đến hoạt độ protease. Nuôi cấy các chủng NS vào MT9 ở độ mặn 3%, pH 5, hàm lượng ĐN 5%, độ ẩm 55% đối với Penicillium paxalli; hàm lượng ĐN 3%, độ ẩm 65% đối với Paecilomyces lilacinus. Thời gian nuôi cấy khác nhau: 24h, 36h, 48h, 60h, 72h, 84h, 96h. Sau khi nuôi cấy, ly trích enzyme và xác định hoạt độ protease theo phương pháp Anson. Kết quả thu được như sau trình bày ở bảng 3.19 và minh họa ở đồ thị 3.6. Bảng 3.19. Ảnh hưởng của thời gian đến hoạt độ protease của hai chủng NS Thời gian (h) Hoạt độ protease (UI/ml) Penicillium paxalli Sai số Paecilomyces lilacinus Sai số 24 0.099 0.002 0.198 0.001 36 0.421 0.007 0.454 0.004 48 0.639 0.011 0.972 0.012 60 1.555 0.004 2.310 0.004 72 2.342 0.013 2.024 0.009 84 2.432 0.008 1.242 0.003 96 1.261 0.010 0.697 0.001 Thời gian nuôi cấy có ảnh hưởng rất lớn đối với khả năng sinh enzyme ngoại bào. Khả năng tổng hợp enzyme ngoại bào của NS tăng dần và đạt tối ra lúc bắt đầu sinh bào tử và sau đó bắt đầu giảm dần. Từ kết quả trên cho thấy thời để hai chủng Penicillium paxalli và Paecilomyces lilacinus cho hoạt độ protease cao nhất lần lượt là 84h và 60h. Thời gian này phù hợp với khoảng thời gian có tốc độ ST mạnh nhất của hai chủng NS. Có thể thấy thời gian nuôi cấy NS thu protease của hai chủng NS ở RNM (60-84h) dài hơn các chủng NS từ đất liền (32-42h). Kết quả nghiên cứu của G.L. Maria, K.R. Sridhar và N.S. Raviraja cho thấy thời gian nuôi cấy tối ưu để thu protease của các chủng NS ở RNM ở Tây Nam Ấn Độ lên đến 144h [34]. Sở dĩ thời gian tối ưu để thu protease của hai chủng NS ở RNM dài hơn so với các chủng NS ở đất liền là do sự ST của các chủng NS ở RNM chậm hơn sự ST của các chủng NS ở đất liền. Đồ thị 3.6. Ảnh hưởng của thời gian đến hoạt độ protease của hai chủng NS - Như vậy, từ kết quả nghiên cứu trên, ta có thể rút ra một số điều kiện MT thích hợp cho sinh tổng hợp protease của hai chủng NS như sau: + Chủng Penicillium paxilli: chất cảm ứng là bột ĐN, hàm lượng 5%, nhiệt độ 30oC, độ mặn 3%, độ ẩm 55%, pH 5, thời gian 84h. + Chủng Paecilomyces lilacinus: chất cảm ứng là bột ĐN, hàm lượng 3%, nhiệt độ 30oC, độ mặn 3%, độ ẩm 65%, pH 5, thời gian 60h. - Hoạt độ protease của Penicillium paxalli sau tối ưu hóa là là 2.432 UI/ml, trước tối ưu hóa là 2.054 UI/ml (tăng 18%), của Paecilomyces lilacinus sau tối ưu hóa là 2.310 UI/ml, trước tối ưu hóa là 1.918UI/ml (tăng 20%). (a) ( b) Hình 3.6. Vòng phân giải casein của Penicillium paxalli trước (a) và sau khi tối ưu (b) 3.4. Nghiên cứu tách chiết protease bán tinh khiết từ dịch MT. Để tìm ra tác nhân kết tủa để thu được protease bán tinh khiết có hoạt tính cao nhất, chúng tôi tiến hành nuôi cấy 2 chủng NS vào MT9với các điều kiện tối ưu như đã trình bày. Sau đó ly trích dịch enzyme và tiến hành tủa enzyme bằng 3 tác nhân khác nhau: cồn 90o, axeton và (NH4)2SO4. Sau khi sấy khô, ta thu được enzyme bán tinh khiết. Tiến hành đo OD để xác định hoạt độ protease của enzyme thu được, kết quả được trình bày ở bảng 3.20, biểu đồ 3.11 và hình 3.6. Bảng 3.20. Hoạt độ protease theo các tác nhân kết tủa khác nhau Tác nhân kết tủa Hoạt độ protease (UI/ml) Penicillium paxalli Sai số Paecilomyces lilacinus Sai số Axêton 58.462 0.208 52.782 0.269 Cồn 53.503 0.219 41.078 0.243 (NH4)2SO4 43.152 0.079 37.459 0.016 Biểu đồ 3.11. Hoạt độ protease theo các tác nhân kết tủa khác nhau Axeton Cồn (NH4)2SO4 Paecilomyces lilacinus Tác nhân kết tủa Axeton Cồn (NH4)2SO4 Penicillium paxalli Hình 3.6. Vòng phân giải casein của hai chủng NS với các tác nhân kết tủa khác nhau Từ kết quả trên cho thấy trong ba tác nhân kết tủa trên, axeton là tác nhân kết tủa cho hoạt độ protease bán tinh khiết cao nhất ở cả hai chủng NS. Đối với chủng Penicillium paxalli, cồn cũng là tác nhân kết tủa tốt. Riêng ( NH4)2SO4 cho kết quả yếu hơn hẳn hai tác nhân kết tủa còn lại. Như vậy, axeton là tác nhân kết tủa cho hoạt độ protease bán tinh khiết cao nhất đối với cả 2 chủng NS. 3.5. Một số đặc điểm sinh học khác của hai chủng NS. Để hiểu rõ hơn về đặc điểm và vai trò của hai chủng NS, chúng tôi tiếp tục khảo sát khả năng sinh KS và một số enzyme ngoại bào như amylase, cellulase, kitinase của chúng. Kết quả được trình bày ở bảng 3.21 . Bảng 3.21. Một số đặc điểm sinh học của hai chủng NS. Đặc điểm sinh học Đặc điểm sinh học (D-d) ( mm) Penicillium paxalli Paecilomyces lilacinus Hoạt tính kháng E. coli 3 7 Hoạt tính kháng B. Subtilis 13 3 Hoạt tính amylase 2.5 8 Hoạt tính cellulase 7 8 Hoạt tính kitinase 10 12 Chúng tôi nhận thấy hai chủng NS đều có khả năng đối kháng với 2 loại VK kiểm định nhưng ở mức trung bình và yếu. Ngoài khả năng sinh protease mạnh, hai chủng NS trên cũng có khả năng sinh được cả ba loại enzyme amylase, cellulase, kitinase, trong đó hoạt tính kitinase là cao hơn cả. Chính các enzyme ngoại bào này giữ vai trò quan trọng trong quá trình phân giải nguồn cơ chất tự nhiên ở RNM Cần Giờ. Vì vậy mà NS giữ một vai trò quan trọng trong HST ở RNM, chúng góp phần khép kín chu trình sinh địa hóa các chất trong HST. Penicillium paxilli Paecilomyces lilacinus Penicillium paxilli Paecilomyces lilacinus Hình 3.7. Hoạt tính kháng E. coli của hai chủng NS. Penicillium paxilli Paecilomyces lilacinus Hình 3.8. Hoạt tính kháng B. subtilis của hai chủng NS Penicillium paxilli Paecilomyces lilacinus Hình 3.9. Hoạt tính amylase của hai chủng NS. Penicillium paxilli Paecilomyces lilacinus Hình 3.10.Hoạt tính kitinase của hai chủng NS. Penicillium paxilli Paecilomyces lilacinus Hình 3.11.Hoạt tính cellulase của hai chủng NS. CHƯƠNG IV. KẾT LUẬN VÀ ĐỀ NGHỊ 4.1. Kết luận Như vậy qua quá trình nghiên cứu, chúng tôi thu được một số kết quả như sau: 1. Từ 5 xã ở RNM Cần Giờ, chúng tôi phân lập được 409 chủng NS trong đó có 64 chủng từ đất mặt (15,64%), 53 chủng từ đất sâu (12,96%), 59 chủng từ cành khô (14,43%), 81 chủng từ cành mục (19.8%), 71 chủng từ lá vàng (17,36%), 81 chủng từ lá mục (19,8%). 2. Đã xác định được 257/409 chủng NS có hoạt tính protease (62,84%). Trong đó số chủng NS có hoạt tính protease thay đổi theo thứ tự: cành mục > lá mục > đất mặt > cành khô > lá vàng > đất sâu. Căn cứ vào hoạt độ protease và khả năng chịu mặn của các chủng NS chúng tôi chọn 2 chủng 12CM3.4 và 551LM3 để đi sâu nghiên cứu. 3. Tiến hành định danh đến loài bằng phương pháp sinh học phân tử xác định chủng 12CM3.4 là Penicillium paxilli, độ trùng khớp 99%, chủng 551LM3 là Paecilomyces lilacinus, độ trùng khớp 100%. 4. Xác định điều kiện tối ưu cho ST và hoạt độ protease của mỗi chủng NS như sau: - Chủng Penicillium paxilli: + Điều kiện ST: nguồn N casein, độ mặn 3%, nhiệt độ 30oC, pH 5 + Điều kiện cho hoạt độ protease: chất cảm ứng là bột ĐN, hàm lượng 5%, nhiệt độ 30oC, độ mặn 3%, độ ẩm 55%, pH 5, thời gian 84h. - Chủng Paecilomyces lilacinus: + Điều kiện sinh trưởng: nguồn N casein, độ mặn 1%, nhiệt độ 30oC, pH 5 + Điều kiện cho hoạt độ protease: chất cảm ứng là bột ĐN, hàm lượng 3%, nhiệt độ 30oC, độ mặn 3%, độ ẩm 65%, pH 5, thời gian 60h. 5. Cả 2 chủng NS đều có khả năng đối kháng với 2 loại VK kiểm định (B. subtilis và E. coli), khả năng sinh được cả ba loại enzyme amylase, cellulase, kitinase, trong đó hoạt tính kitinase cao hơn cả. 6. Để thu nhận protease bán tinh khiết từ 2 chủng NS có hoạt độ cao nhất có thể sử dụng tác nhân kết tủa axeton là thích hợp. 4.2. Đề nghị Trên đây là kết quả nghiên cứu bước đầu để có thể sớm đưa 2 chủng NS này vào ứng dụng. Chúng tôi đề nghị tiếp tục nghiên cứu một số các chỉ tiêu sau: - Nghiên cứu một số tính chất của chế phẩm protease thu được. - Thử nghiệm tác dụng của protease trong thực tiễn chăn nuôi.

Các file đính kèm theo tài liệu này:

  • pdfLVSHVSV013.pdf
Tài liệu liên quan