Luận văn Tách dòng và xác định trình tự nucleotit một số đoạn trong genome của virut vàng lùn lúa (RGSV) tại Việt Nam

LỜI CAM ĐOAN Tôi xin cam đoan đây là công trình nghiên cứu của riêng tôi. Các số liệu, kết quả nghiên cứu trong luận văn là trung thực và chưa được ai công bố. Tôi xin bày tỏ lòng biết ơn sâu sắc tới TS. Nguyễn Trung Nam (Viện Công nghệ Sinh học) đã tận tình hướng dẫn và tạo mọi điều kiện giúp đỡ tôi hoàn thành công trình nghiên cứu này. Tôi cũng xin bày tỏ lòng biết ơn chân thành tới GS. TS Lê Trần Bình, TS. Chu Hoàng Hà, TS. Nguyễn Hữu Cường, KS. Hoàng Thị Thu Hằng và tập thể cán bộ Phòng Công nghệ Tế bào thực vật – Viện Công nghệ Sinh học đã nhiệt tình giúp đỡ, truyền đạt nhiều kinh nghiệm đồng thời hỗ trợ tôi trong suốt thời gian thực nghiệm và hoàn thành khóa luận này. Tôi xin bày tỏ lòng biết ơn chân thành tới TS. Nguyễn Như Cường (Viện Bảo vệ Thực vật) chủ nhiệm đề tài cấp Nhà nước “Nghiên cứu đặc tính sinh học của virut gây bệnh và môi giới truyền bệnh vàng lùn, lùn xoắn lá, các biện pháp quản lý tổng hợp cây trồng (ICM) trong sản xuất lúa” đã cung cấp mẫu bệnh và cộng tác trong quá trình tôi thực hiện công trình nghiên cứu này. Tôi xin chân thành cảm ơn Ban lãnh đạo Trường Đại học sư phạm – Đại học Thái Nguyên, Ban chủ nhiệm khoa Sau đại học, Ban chủ nhiệm khoa Sinh – KTNN, các thày cô giáo, và cán bộ trong Khoa đã truyền đạt kiến thức cũng như tạo điều kiện cho tôi được thực hiện khóa luận này. Cuối cùng, tôi xin chân thành cảm ơn gia đình, bạn bè đã tạo điều kiện, động viên, giúp đỡ tôi trong suốt quá trình học tập, nghiên cứu và hoàn thành luận văn. MỤC LỤC Trang LỜI CẢM ƠN 2 MỤC LỤC 3 DANH MỤC TỪ VIẾT TẮT . 5 DANH MỤC CÁC BẢNG . 7 MỞ ĐẦU 9 Chương 1. TỔNG QUAN TÀI LIỆU 11 1.1. TÌNH HÌNH DỊCH BỆNH VL&LXL TRÊN THẾ GIỚI VÀ VIỆT NAM 11 1.1.1. Thế giới . 11 1.1.2. Việt Nam . 12 1.2. TRIỆU CHỨNG LÖA NHIỄM BỆNH VL&LXL 13 1.3. ĐẶC ĐIỂM CỦA CÁC LOẠI VIRUT GÂY BỆNH VL&LXL Ở LÖA . 14 1.3.1. Virut vàng lùn lúa (RGSV) . 14 1.3.2. Các loại virut khác . 16 1.3.2.1. Virut lùn xoắn lá lúa (RRSV) . 16 1.3.2.2. Virut tungro hình cầu (RTSV) . 17 1.3.2.3. Virut tungro hình nhộng (RTBV) 18 1.4. ĐẶC ĐIỂM SINH HỌC CỦA RẦY NÂU – MÔI GIỚI CHỦ YẾU TRUYỀN BỆNH VL&LXL 19 1.4.1. Đặc điểm hình thái 19 1.4.2. Đặc điểm sinh học, sinh thái và gây hại 19 1.5. PHÕNG TRỪ BỆNH VL&LXL . 20 1.6. MỘT SỐ ENZYM VÀ KỸ THUẬT SINH HỌC PHÂN TỬ TRONG NGHIÊN CỨU BỆNH VIRUT 21 1.6.1. Một số enzym sử dụng trong sinh học phân tử . 21 1.6.2. Kỹ thuật RT-PCR 22 1.6.3. Kỹ thuật PCR . 23 1.6.4. Kỹ thuật biến nạp plasmit vào E.coli 24 1.6.5. Kỹ thuật tách dòng gen 24 1.6.6. Kỹ thuật PCR trực tiếp từ khuẩn lạc (colony – PCR) 25 Chương 2. VẬT LIỆU VÀ PHưƠNG PHÁP NGHIÊN CỨU 26 2.1. VẬT LIỆU 26 2.2. HÓA CHẤT, THIẾT BỊ, ĐỊA ĐIỂM 27 2.2.1. Hóa chất 27 2.2.2. Thiết bị 27 2.2.3. Địa điểm nghiên cứu 27 2.3. PHưƠNG PHÁP NGHIÊN CỨU . 27 2.3.1. Thu mẫu thí nghiệm . 27 2.3.2. Thiết kế mồi đặc hiệu . 28 2.3.3. Tách chiết RNA tổng số của virut ở lúa 28 2.3.4. Phản ứng RT-PCR . 29 2.3.5. Tạo plasmit tái tổ hợp mang gen mong muốn (Ligation) . 29 2.3.6. Biến nạp vectơ tái tổ hợp vào tế bào khả biến E.coli DH5α bằng phương pháp sốc nhiệt . 30 2.3.7. Colony-PCR 31 2.3.8. Tách chiết plasmit 32 2.3.9. Cắt gen bằng enzym giới hạn . 32 Chương 3. KẾT QUẢ NGHIÊN CỨU VÀ THẢO LUẬN . 34 3.1. THIẾT KẾ MỒI 34 3.2. TÁCH DÕNG CÁC ĐOẠN TRONG GENOME CỦA RGSV . 34 3.2.1. RT-PCR 34 3.2.2. Biến nạp vectơ tái tổ hợp vào tế bào khả biến E.coli DH5α . 37 3.2.3. Chọn lọc plasmit tái tổ hợp bằng colony-PCR 37 3.2.4. Tách plasmit và cắt kiểm tra sự có mặt của gen . 39 3.3. XÁC ĐỊNH TRÌNH TỰ NUCLEOTIT CỦA MỘT SỐ ĐOẠN TRONG GENOME CỦA RGSV . 40 3.4. SO SÁNH TRÌNH TỰ GEN CP-RGSV CỦA HAI TỈNH NINH THUẬN VÀ BÌNH THUẬN VỚI CÁC TRÌNH TỰ TưƠNG ỨNG TRÊN GENBANK. 41 KẾT LUẬN VÀ ĐỀ NGHỊ 46 CÔNG TRÌNH NGHIÊN CỨU ĐÃ CÔNG BỐ . 47 TÀI LIỆU THAM KHẢO . 48 PHỤ LỤC . 53

pdf58 trang | Chia sẻ: maiphuongtl | Ngày: 12/06/2013 | Lượt xem: 383 | Lượt tải: 1download
Tóm tắt tài liệu Luận văn Tách dòng và xác định trình tự nucleotit một số đoạn trong genome của virut vàng lùn lúa (RGSV) tại Việt Nam, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
ẹ ở nhiệt độ phòng trong 10 phút; Bổ sung 200 µl chloroform : isoamyl (24:1), đảo nhẹ và ly tâm 10.000v/p trong 10 phút; Hút dịch nổi, kết tủa RNA bằng Isopropanol. Ly tâm Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 29 ở 10.000v/p trong 10 phút, bỏ dịch nổi, thu tủa; Rửa tủa bằng cách bổ sung 700µl ethanol 70%, ly tâm ở 7000v/p trong 5 phút (lặp lại 2 lần), làm khô và pha loãng RNA trong nƣớc khử DEPC 0,01%; Cất mẫu ở -840C. 2.3.4. Phản ứng RT-PCR - Thành phần: Thành phần phản ứng RT-PCR (one-step) trong thể tích 25l: 5l đệm RT-PCR 5X; 10pg- 5g RNA tổng số (1l); 75pmol mỗi loại mồi đặc hiệu (0,75l); 1l 10mM dNTP mix (10mM mỗi loại dATP, dGTP, dTTP và dCTP, ở pH trung tính); 1l hỗn hợp enzym (Reverse transcriptase và Taq polymerase); 0,2 l chất ức chế Ribonuclease tái tổ hợp RNase OUTTM (40u/l); Bổ sung nƣớc khử ion đã đƣợc khử trùng tới thể tích 25l. - Chu kỳ nhiệt: Thực hiện phản ứng RT-PCR theo chu kỳ nhiệt sau: bƣớc 1: 50 0C, 30 phút; bƣớc 2: 950C, 15 phút; bƣớc 3: 940C, 30 giây; bƣớc 4: 530C, 30 giây; bƣớc 5: 720C, 3 phút; từ bƣớc 3 đến bƣớc 5 lặp lại 10 chu kỳ; bƣớc 6: 940C, 30 giây; bƣớc 7: 550C, 30 giây; bƣớc 8: 720C, 5 phút; từ bƣớc 6 đến bƣớc 8 lặp lại 30 chu kỳ; bƣớc 9: 720C, 10 phút; bƣớc 10: 40C, bảo quản mẫu. Sản phẩm PCR đƣợc điện di trên gel agarose 1% trong đệm 1X TAE [45], nhuộm gel trong dung dịch ethidium bromide và thôi gel bằng bộ Kit của QIAGEN. 2.3.5. Tạo plasmit tái tổ hợp mang gen mong muốn (Ligation) Sản phẩm PCR của gen quan tâm đƣợc kiểm tra bằng điện di trên gel agarose 1% và đƣợc làm sạch theo bộ kit QIAquick Gel Extraction rồi gắn vào vectơ tách dòng pBT (Hình 2.2). Các bƣớc tiến hành nhƣ sau: - Thôi gel sản phẩm PCR: Điện di sản phẩm PCR trên gel agarose 1% và cắt lấy băng quan tâm, có kích thƣớc khoảng 1kb; bổ sung dung dịch QG theo tỷ lệ: Vmẫu : VQG = 1 : 3 (1mg mẫu tƣơng ứng với 1µl); ủ ở 50 0 C trong 10- 15 phút, cứ 3 phút đảo mẫu nhẹ một lần, sau khi gel tan hết ủ thêm 5 phút để đảm bảo gel tan hoàn toàn; chuyển hỗn hợp dung dịch lên cột thôi gel Qiaquick spin, ly tâm 13.000 v/p trong 1 phút, loại bỏ dịch chảy qua cột; bổ sung 500µl dung dịch QG, ly tâm 13.000v/p trong 1 phút; thêm 750µl dung dich PE vào cột, để ở nhiệt độ phòng trong 5 phút; ly tâm 13.000 v/p trong 1 phút, đổ dịch chảy qua cột, ly tâm bổ sung 1 phút để loại bỏ hết dung dịch PE; hòa tan DNA trong 30- 50µl nƣớc cất hoặc dung dịch EB, đã đƣợc làm ấm đến 500C, để ở nhiệt độ phòng 1 phút, ly tâm 13.000v/p để thu DNA. - Gắn gen vào vectơ: Sản phẩm thôi gel đƣợc gắn vào vectơ pBT với sự xúc tác của T4 ligase. Phản ứng gắn dựa vào sự hình thành mối liên kết photphodieste Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 30 giữa nucleotit Adenin của sản phẩm PCR và nucleotid Thymin của vectơ. Các thành phần của vectơ pBT đƣợc thể hiện trong hình 2.2. Hỗn hợp phản ứng đƣợc ủ ở nhiệt độ phòng trong 02 giờ để phản ứng xảy ra hoàn toàn. Vectơ tái tổ hợp sau đó đƣợc biến nạp vào tế bào khả biến E.coli DH5α và đƣợc cấy trải trên môi trƣờng LB đặc có bổ sung ampicillin 0,01mg/l ampicillin, X-gal 0,004‰, IPTG 100µM. Thành phần phản ứng gắn gen vào vectơ pBT: Buffer T4 ligase 10X (2µl); DNA (8µl); plasmit pBT (1µl); T4 ligase 2u/µl (1µl); H2O (8µl). Tổng thể tích 20µl. Hỗn hợp đƣợc ủ ở 220C trong 2 giờ, sau đó đƣợc biến nạp vào tế bào khả biến E.coli DH5α bằng phƣơng pháp sốc nhiệt. Hình 2.2. Sơ đồ vectơ pBT. 2.3.6. Biến nạp vectơ tái tổ hợp vào tế bào khả biến E.coli DH5α bằng phƣơng pháp sốc nhiệt - Chuẩn bị tế bào khả biến: Tế bào E.coli DH5α đƣợc cấy ria trên môi trƣờng LB đặc và nuôi qua đêm ở 370C. Chọn một khuẩn lạc nuôi cấy trong 3ml LB lỏng, lắc 200 v/p, ở 370C trong 2- 3 giờ, đo OD600nm đạt 0,4- 0,6 thì chuyển dịch nuôi cấy sang ống ly tâm, để 15 phút ở trong đá (hoặc ở 40C). Ly tâm 4000v/p, ở 40C, trong 15 phút (lặp lại ba lần, để trong đá lần thứ hai 30 phút, lần thứ ba 60 phút). Đổ dịch CaCl2, hòa tan trong 1ml CaCl2/100ml LB ban đầu. Bổ sung 15- 20% glycerol. Chia 50µl dịch tế bào khả biến vào mỗi ống eppendorf 1,5ml. Bảo quản tế bào khả biến trong tủ lạnh -840C. - Biến nạp: Bổ sung 20µl vectơ tái tổ hợp vào ống đựng tế bào khả biến và trộn nhẹ, đặt ngay vào đá trong 30 phút rồi ủ ở 420C chính xác trong 1,5 phút, sau Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 31 đó đặt vào đá 5 phút. Bổ sung 700µl môi trƣờng LB lỏng, hỗn hợp đƣợc nuôi ở 37 0C, lắc 200v/p trong 1 giờ. Sử dụng que cấy trải, trải 150- 250µl dịch khuẩn lên đĩa môi trƣờng LB đặc có chứa 0,1mg/l ampicillin, X-gal 0,004‰, IPTG 100µM. Ủ đĩa ở 370C trong 16 giờ. 2.3.7. Colony-PCR Sau khi nuôi khuẩn đã biến nạp trên môi trƣờng chọn lọc, thu đƣợc những khuẩn lạc xanh và trắng. Nguyên lý của khuẩn lạc xanh và trắng: Toàn bộ khuẩn lạc phát triển trên môi trƣờng có ampicillin đều là khuẩn lạc mang plasmit (vectơ). Vì sự có mặt của gen kháng ampicillin trong plasmit giúp vi khuẩn có khả năng kháng kháng sinh ampicillin. Những khuẩn lạc xanh xuất hiện do trong vectơ mang gen lac-operon hoạt động bình thƣờng, không có đoạn gen đƣợc xen vào, khi có chất cảm ứng của IPTG sẽ tổng hợp enzym β-galactosidase, enzym này sẽ chuyển hóa cơ chất X-gal thành hợp chất có mầu xanh. Còn những khuẩn lạc trắng có thể là do nhận đƣợc plasmit mang lac-operon không hoạt động, chính vì vậy khi có chất cảm ứng IPTG thì gen không tổng hợp enzym β-galactosidase và không xảy ra hiện tƣợng chuyển hóa X-gal. Lac-operon bị bất hoạt là do đoạn DNA ngoại lai xen vào giữa promoter của operon gen lacZ. Do đó, lac-promoter không thể điều khiển gen cấu trúc phiên mã, nên không cóc sự dịch mã thành enzym. Tuy nhiên, không phải tất cả các khuẩn lạc trắng đều mang plasmit tái tổ hợp chứa đoạn DNA quan tâm. Mặc dù vậy, việc chọn khuẩn lạc trắng để nghiên cứu tiếp đã loại bỏ đƣợc phần lớn các trƣờng hợp không mong muốn. Để phản ứng hiệu quả hơn cần kiểm tra bằng cách chạy phản ứng colony-PCR. Khuẩn lạc trắng của mỗi mẫu đƣợc chọn lọc và đánh số thứ tự, thực hiện phản ứng colony-PCR với cặp mồi pUC18 để xác định khuẩn lạc có plasmit mang gen quan tâm. Sản phẩm colony-PCR đƣợc điện di kiểm tra trên gel agarose 0,9% để chọn ra các khuẩn lạc mang gel có kích thƣớc nhƣ mong muốn, đồng thời nuôi những khuẩn lạc này trong 3ml LB lỏng có bổ sung ampicillin 100mg/l để tách plasmit. Thành phần phản ứng colony-PCR: Dung dịch đệm PCR 10X (2µl); MgCl2 25mM (2µl); dNTPs 2,5mM (2µl); Mồi pUC18-xuôi 10 pmol/µl (1µl); Mồi pUC18- ngƣợc 10 pmol/µl (1µl); DNA polymerase 1u/1µl (1 µl); H2O khử ion (11µl). Tổng thể tích là 20µl. Chu kỳ nhiệt của phản ứng colony-PCR: bƣớc 1: 950C, 5 phút; bƣớc 2: 940C, 30 giây; bƣớc 3: 520C, 30 giây; bƣớc 4: 720C, 3 phút; từ bƣớc 2 đến bƣớc 4 lặp lại Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 32 10 chu kỳ; bƣớc 5: 940C, 30 giây; bƣớc 6: 550C, 30 giây; bƣớc 7: 720C, 5 phút; từ bƣớc 5 đến bƣớc 7 lặp lại 25 chu kỳ; bƣớc 8: 720C, 10 phút; bƣớc 9: 40C, bảo quản mẫu. 2.3.8. Tách chiết plasmit Sử dụng bộ kit QIAprep Spin Miniprep và chỉ dẫn của nhà sản xuất để tách chiết plasmit. Đây là phƣơng pháp tách plasmit lƣợng nhỏ từ 1 – 1,5 ml dịch khuẩn E.coli, có số bản sao plasmit cao. Qui trình bao gồm: Hút 1,5ml dịch khuẩn E.coli đã nuôi qua đêm trong môi trƣờng LB lỏng cho vào ống eppendorf 1,5ml. Ly tâm 8.000v/p trong 5 phút để thu tế bào vi khuẩn. Hòa tan tế bào trong 250µl buffer RS có bổ sung RNase (sản phẩm tách không còn RNA). Bổ sung 250µl BL, đảo ống nhẹ nhàng 4-6 lần để trộn đều hỗn hợp. Cần thiết có thể đảo ống cho đến khi nhìn thấy dịch trắng sữa. Không để phản ứng phân giải quá 5 phút. Các dung dịch RS và BL có tác dụng phá vỡ thành tế bào, màng sinh chất... và giải phóng ra các thành phần trong tế bào. Bổ sung 350µl NE, đảo ống ngay lập tức nhƣng nhẹ nhàng 3- 4 lần. Tránh kết tủa cục bộ, đảo đều dung dịch nhẹ nhàng nhƣng liên tục ngay khi bổ sung NE. Dung dịch trở nên có màu trắng sữa. Dung dịch NE có tác dụng kết tủa protein, polysaccarit... tạo kết tủa bám vào thành ống eppendorf. Ly tâm 13.000v/p trong 15 phút. Hút dịch nổi cho vào cột QIAprep Spin Miniprep. Ly tâm 13.000v/p trong 1 phút, loại bỏ dịch chảy qua cột, rửa cột QIAprep Spin Miniprep bằng cách bổ sung 0,5ml buffer PB và ly tâm 13.000v/p trong 1 phút. Loại bỏ dịch chảy qua cột. Bƣớc này là rất cần thiết để loại bỏ hoạt tính của nuclease khi sử dụng chủng endA + nhƣ JM, HB101 hoặc các thế hệ khác của nó hoặc các chủng dại mà có mức độ hoạt tính cao của nuclease hoặc nồng đọ carbohydrate cao. Chủng tế bào chủ nhƣ XL-1 và DH5α không cần thiết phải thực hiện bƣớc rửa này. Rửa cột QIAprep Spin Miniprep bằng cách bổ sung 0,75ml buffer WP và ly tâm ở 13.000v/p. Loại bỏ dịch chảy qua cột, và ly tâm bổ sung 13.000v/p trong 1 phút để loại bỏ hết buffer rửa. Chuyển cột sang một ống eppendorf 1,5ml mới. Hòa tan DNA bằng cách bổ sung 50µl EL hoặc nƣớc cất tới tâm của mỗi cột QIAprep Spin Miniprep, để ở nhiệt độ phòng 1 phút rồi ly tâm ở 13.000v/p trong 1 phút. Tiến hành điện di kiểm tra sản phẩm tinh sạch plasmit trên gel agarose 0,9%. 2.3.9. Cắt gen bằng enzym giới hạn Bƣớc đầu tiên trong quá trình cắt gen bằng enzym giới hạn, chúng ta phải xác định những enzym có thể sử dụng để cắt đƣợc đoạn gen quan tâm. Những enzym đƣợc lựa chọn là những enzym dự tính không có điểm cắt trên đoạn gen quan tâm, không có quá nhiều vị trí cắt trên vectơ. Đặc biệt, những enzym cắt Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 33 không cho các đoạn gen có kích thƣớc chênh lệch nhỏ, vì nhƣ vậy, không thể xác định đƣợc đoạn gen quan tâm. Sau khi đã xác định đƣợc enzym cắt giới hạn, đối chiếu với bảng enzym để xác định đƣợc đệm phù hợp nhất, cho khả năng cắt cao nhất. Tiến hành cắt enzym, cho lần lƣợt các thành phần theo thứ tự: Đệm cho enzym cắt, chất phụ trợ (nếu có), plasmit, enzym. Hỗn hợp đƣợc cắt ở 37oC trong 02 tiếng, bất hoạt enzym ở 65oC trong 20 phút. Thành phần phản ứng cắt bằng enzym giới hạn : DNA plasmit 2,5- 3 µg/µl (5µl); Enzym 10u/µl (1µl); Dung dịch đệm 10X (1µl); H2O khử ion (3,5µl ). Tổng thể tích là 10µl. 2.3.10. Xác định trình tự và so sánh trình tự gen thu đƣợc với các trình tự tƣơng ứng trên GenBank Tách dòng và xác định trình tự gen: Sản phẩm PCR đƣợc gắn vào trong vector tách dòng pBT [4] và biến nạp vào tế bào khả biến E. coli DH5α. Chọn lọc các khuẩn lạc xanh/trắng trên môi trƣờng thạch LB có bổ sung 50 mg/l Ampicilin, 0,004% X-gal và 0,1 mM IPTG. Tách chiết plasmit theo hƣớng dẫn sử dụng của Plasmit Extraction Kit. Kiểm tra sự có mặt của DNA tái tổ hợp bằng phƣơng pháp colony-PCR với cặp mồi pUC18-xuôi và pUC18-ngƣợc. Chọn các mẫu plasmit tái tổ hợp có kích thƣớc nhƣ mong muốn để tinh sạch và xác định trình tự trên máy tự động ABI PRISM 3100 Avant Genetic Analyzer. Sử dụng các phần mềm DNAstar, BioEdit và MEGA 4 để so sánh các trình tự gen và dựng cây phát sinh chủng loại theo phƣơng pháp tối đa (Maximum Parsimony (MP)) trên cở sở các số liệu thu đƣợc qua so sánh các trình tự gen. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 34 Chƣơng 3. KẾT QUẢ NGHIÊN CỨU VÀ THẢO LUẬN 3.1. THIẾT KẾ MỒI Để thực hiện đƣợc kỹ thuật PCR và RT-PCR, bƣớc đầu tiên là thiết kế các cặp mồi đặc hiệu cho đoạn gen muốn khuếch đại. Dựa trên trình tự các gen quan tâm của chủng RGSV đã công bố trên GenBank, kết hợp sử dụng các phần mềm thiết kế mồi nhƣ Primer3, DNAclub, Oligo... Với mục đích đánh giá đa dạng di truyền vừa để xác định sự có mặt của các chủng virut gây bệnh VL&LXL trong lúa tại các tỉnh Nam Trung Bộ, chúng tôi đã lựa chọn gen CP và các đoạn có trình tự bảo thủ cao khác. Các cặp mồi đƣợc thiết kế thể hiện trong bảng 3.1. Bảng 3.1. Trình tự mồi sử dụng để nhân một số đoạn trong genome RGSV. STT Tên mồi Trình tự mồi Chiều dài gen (bp) 1 RNA1-RGSV- xuôi 5’-CAAACATCCTCCCAAGCATTI-3’ 423 RNA1-RGSV- ngƣợc 5’-ATGATCCAACGAGGAACTGGI-3’ 2 RNA4-RGSV-xuôi 5'-AGCTGCCACTCAAGGTGTTTI-3' 441 RNA4-RGSV- ngƣợc 5'-GAGCTAGTGGGTGGTTCTCGI-3' 3 CP-RGSV- xuôi 5'-CTATACACTACGCTAAAGGCTI-3' 1021 CP-RGSV- ngƣợc 5'-GTGTAAGATGGGTAAAGTGCAI-3' (I: Inosine – là một loại nucleotit đặc biệt có khả năng gắn với nucleotit A, C hoặc U) Cặp mồi RNA1-RGSV-xuôi, RNA1-RGSV-ngƣợc sử dụng để khuếch đại phân đoạn RNA1 của RGSV với kích thƣớc dự kiến là 423bp. Cặp mồi RNA4-RGSV- xuôi, RNA4-RGSV-ngƣợc khuếch đại phân đoạn RNA4 của RGSV với kích thƣớc dự kiến là 441bp. Cặp mồi CP-RGSV-xuôi, CP-RGSV-ngƣợc sử dụng để khuếch đại gen CP của RGSV với kích thƣớc dự kiến là 1021bp. 3.2. TÁCH DÕNG CÁC ĐOẠN TRONG GENOME CỦA RGSV 3.2.1. RT-PCR Sau khi tách đƣợc RNA tổng số của virut từ lúa, RNA tổng số đƣợc sử dụng để thực hiện phản ứng RT-PCR. Trong quá trình tiến hành phản ứng cần điều chỉnh lƣợng mẫu, nồng độ mồi, nồng độ Mg2+, nhiệt độ bắt cặp mồi đƣợc tối ƣu hóa để Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 35 đảm bảo cho hiệu quả của các phản ứng RT-PCR là cao nhất. Sản phẩm RT-PCR đƣợc điện di kiểm tra trên gel agarose 0,9% (Hình 3.1, Hình 3.2, Hình 3.3). Hình 3.1. Điện di sản phẩm RT-PCR phân đoạn 1 và 4 của RGSV từ mẫu BT bằng 2 cặp mồi RNA1-RGSV và RNA4-RGSV. M. Thang chuẩn 1Kb; (-). Đ/c âm; (+). Đ/c dƣơng; 1. Phân đoạn1; 2. Phân đoạn 4. Hình 3.1 cho thấy khi điện di sản phẩm RT-PCR từ các phân đoạn của RGSV, tại giếng đối chứng âm không lên băng chứng tỏ thành phần phản ứng không nhiễm DNA hoặc RNA, giếng đối chứng dƣơng lên 1 băng có kích thƣớc khoảng 500bp (kết quả PCR từ plasmit mang đoạn DNA có kích thƣớc 500bp) chứng tỏ phản ứng diễn ra tối ƣu. Giếng số 1 xuất hiện băng có kích thƣớc khoảng 423bp tƣơng đƣơng với kích thƣớc phân đoạn RNA1-RGSV. Giếng số 2 xuất hiện băng có kích thƣớc khoảng 441bp tƣơng đƣơng với kích thƣớc phân đoạn RNA4- RGSV. Nhƣ vậy, khi thực hiện phản ứng PCR bằng 2 cặp mồi đặc hiệu với phân đoạn 1 và phân đoạn 4 của RGSV là RNA1-RGSV và RNA4-RGSV với mẫu RNA phân lập từ lúa của tỉnh Bình Thuận đều thu đƣợc các băng điện di có kích thƣớc nhƣ mong muốn. Kết quả hình 3.2 cho thấy tại giếng số 1 không lên băng, trong khi tại giếng số 2 xuất hiện băng có kích thƣớc khoảng 1Kb tƣơng đƣơng với băng đối chứng dƣơng. Nhƣ vậy, khi thực hiện phản ứng RT-PCR bằng cặp mồi CP-RGSV-xuôi và CP-RGSV-ngƣợc với các mẫu lúa BĐ và NT, chỉ mẫu NT thu đƣợc băng có kích thƣớc phù hợp với đoạn gen CP của RGSV. 0,5 Kb Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 36 Hình 3.2. Điện di sản phẩm RT-PCR gen CP của RGSV bằng cặp mồi CP-RGSV M: Thang chuẩn: 1kb; (+): Đ/c dƣơng; (-): Đ/c âm; 1: BĐ; 2: NT. Hình 3.3 cho thấy rằng khi thực hiện phản ứng RT-PCR bằng cặp mồi đặc hiệu với gen CP của RGSV (CP-RGSV-xuôi và CP-RGSV-ngƣợc), tại giếng số 1 (BT) xuất hiện 1 băng có kích thƣớc 1Kb trong khi các giếng còn lại (2 (BĐ), 3 (PY), 4 (KH)) không xuất hiện băng sản phẩm. Hình 3.3. Điện di sản phẩm RT-PCR gen CP của RGSV bằng cặp mồi CP-RGSV M: Thang chuẩn: 1Kb; (+): Đ/c dƣơng; (-): Đ/c âm; 1: BT; 2: BĐ; 3: PY; 4: KH. Nhƣ vậy, khi thực hiện phản ứng RT-PCR với 3 cặp mồi đặc hiệu (bảng 3.1) và điện di trên gel agarose chỉ thu đƣợc các băng có kích thƣớc phù hợp với gen CP-RGSV tại mẫu lúa của hai tỉnh Ninh Thuận, Bình Thuận và băng có kích thƣớc ~1 Kb 1 Kb Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 37 phù hợp với các phân đoạn 1, 4 RGSV tại mẫu lúa của tỉnh Bình Thuận. Các phân đoạn DNA có kích thƣớc nhƣ mong muốn đƣợc tinh sạch rồi gắn vào vectơ tách dòng pBT. 3.2.2. Biến nạp vectơ tái tổ hợp vào tế bào khả biến E.coli DH5α Quá trình tách dòng đƣợc thực hiện bằng cách gắn sản phẩm PCR vào vectơ tách dòng pBT do phòng Công nghệ Tế bào thực vật cung cấp. Hình 3.4. Khuẩn lạc E.coli DH5α mang vectơ tái tổ hợp của các dòng CP của RGSV tỉnh Bình Thuận trên môi trƣờng LB đặc. Sau khi biến nạp vectơ vào tế bào khả biến E.coli DH5α bằng phƣơng pháp sốc nhiệt, đĩa petri đƣợc ủ ở 370C trong 16 giờ. Kết quả đƣợc thể hiện trong hình 3.4. Kết quả thu đƣợc gồm khuẩn lạc xanh và trắng. Toàn bộ khuẩn lạc phát triển trên môi trƣờng có ampicillin đều là khuẩn lạc mang plasmit biến nạp. Vì sự có mặt của gen kháng ampicillin trong plasmid biến nạp mà những vi khuẩn này có thể phát triển trên môi trƣờng có ampicillin. Để kiểm tra các khuẩn lạc trắng chứa plasmit mang đoạn DNA quan tâm, chúng tôi lựa chọn từ mỗi đĩa khuẩn một số khuẩn lạc trắng để thực hiện phản ứng colony-PCR với cặp mồi pUC18-xuôi và pUC18-ngƣợc. 3.2.3. Chọn lọc plasmit tái tổ hợp bằng colony-PCR Chọn 4 đến 7 khuẩn lạc trắng của mỗi mẫu để chạy phản ứng colony-PCR với cặp mồi pUC18-xuôi và pUC18-ngƣợc để xác định khuẩn lạc có plasmit mang đoạn DNA mong muốn. Vì hai mồi nằm trên vectơ nên kích thƣớc của đoạn DNA Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 38 đƣợc khuếch đại sẽ lớn hơn đoạn DNA mong muốn khoảng 0,2Kb [4]. Sản phẩm colony-PCR đƣợc điện di kiểm tra trên gel agarose 0,9% (Hình 3.5, Hình 3.6). . Hình 3.5. Điện di sản phẩm colony-PCR từ các dòng của phân đoạn 1 và 4 RGSV bằng cặp mồi pUC 18 M: Thang chuẩn 1Kb; (+). Đ/c dƣơng; (-). Đ/c âm; 1,2. phân đoạn 1; 3,4. phân đoạn 4. Kết quả điện di trên hình 3.5 cho thấy tại giếng đối chứng dƣơng xuất hiện băng điện di có kích thƣớc khoảng 0,6Kb đây là kích thƣớc của đoạn DNA đã xác định trong plasmit sử dụng để PCR, giếng đối chứng âm không lên băng chứng tỏ thành phần phản ứng không lây nhiễm DNA, phản ứng diễn ra đạt yêu cầu. Tại các giếng 1, 2, 3, 4 xuất hiện băng có kích thƣớc khoảng 0,6Kb. Đây là kích thƣớc phù hợp với phân đoạn 1 và 4 của RGSV. Nhƣ vậy, có thể plasmit của các khuẩn lạc tƣơng ứng với các giếng số 1, 2, 3, 4 đều mang đoạn DNA có kích thƣớc tƣơng ứng với phân đoạn 1 và 4 của RGSV. Hình 3.6. Điện di sản phẩm colony-PCR các dòng RGSV bằng cặp mồi pUC 18. M: Thang chuẩn 1 Kb; (-): Đ/c âm; (+): Đ/c dƣơng; 1, 2, 3, 4, 5, 6: mẫu NT; 7, 8, 9, 10, 11, 12, 13: mẫu BT. ~1Kb 0,5 Kb Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 39 Dựa vào kết quả điện di trên hình 3.6 thấy rằng, các giếng số 1, 2, 6 và 13 xuất hiện băng tƣơng đƣơng với kích thƣớc của băng đối chứng dƣơng. Nhƣ vậy, có thể plasmit của các khuẩn lạc tƣơng ứng với các giếng số 1, 2, 6 và 13 mang đoạn DNA đã ligation ban đầu. Plasmit của khuẩn lạc tƣơng ứng với các giếng còn lại không mang đoạn DNA mong muốn. Phƣơng pháp colony-PCR có tác dụng loại trừ phần lớn các khuẩn lạc (trắng) mang plasmit không mong muốn. Từ kết quả colony-PCR, chúng tôi lựa chọn các dòng khuẩn lạc 1, 3 (Hình 3.5) và 1, 2, 13 (Hình 3.6) để nuôi trong môi trƣờng LB lỏng có bổ sung ampicillin 100mg/l. Sau đó, chúng tôi tiến hành tách plasmit từ các khuẩn lạc đã nuôi trong môi trƣờng LB lỏng để phục vụ cho việc xác định trình tự. 3.2.4. Tách plasmit và cắt kiểm tra sự có mặt của gen Sau khi chọn khuẩn lạc trắng tƣơng ứng với các giếng sản phẩm colony-PCR có kích thƣớc nhƣ mong muốn và nuôi trong 3ml LB lỏng trong 16 giờ, chúng tôi tiến hành tách plasmit theo bộ kit QIAprep Spin Miniprep nhƣ đã trình bày ở mục 2.3.8. Để kiểm tra sản phẩm tách plasmit và khẳng định một lần nữa sự có mặt của đoạn DNA quan tâm trong plasmit đã đƣợc tinh sạch, plasmit đƣợc cắt bằng enzym cắt BamHI. Kết quả đƣợc thể hiện trong hình 3.7 và 3.8. Hình 3.7: Điện di sản phẩm cắt plasmit mang phân đoạn 1 và 4 của RGSV tại Bình Thuận bằng BamHI M: Thang chuẩn 100 bp; 1. phân đoạn 1; 2. phân đoạn 4. Hình 3.7 cho thấy các giếng số 1, 2 đều xuất hiện 2 băng trong đó 1 băng có kích thƣớc khoảng 2,7 Kb phù hợp với kích thƣớc của vectơ pBT. Băng còn lại lần 0,5 Kb ~ 2,7 Kb Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 40 lƣợt có kích thƣớc khoảng 423bp (giếng số 1) và băng có kích thƣớc khoảng 441bp (giếng số 2) phù hợp với kích thƣớc phân đoạn 1 và 4 của RGSV đã gắn vào vectơ ban đầu. Hình 3.8. Điện di sản phẩm cắt plasmit mang gen CP của RGSV bằng BamHI. M: Thang chuẩn 1Kb; (-): Plasmit không cắt (1): BT; (2): NT; Kết quả điện di sản phẩm cắt plasmit mang gen CP của RGSV bằng BamHI (Hình 3.8) cho thấy, các giếng plasmit không cắt chỉ xuất hiện 1 băng có kích thƣớc khoảng 3,7Kb chứng tỏ plasmit đã tinh sạch và có chất lƣợng tốt. Các giếng số 1, 2 đều xuất hiện 2 băng: một băng có kích thƣớc khoảng 2,7Kb phù hợp với kích thƣớc của vectơ pBT và một băng có kích thƣớc khoảng 1Kb phù hợp với kích thƣớc đoạn DNA mong muốn. Kết quả điện di sản phẩm cắt plasmit trong hình 3.7 và hình 3.8 khẳng định plasmit đã tinh sạch, có mang những đoạn DNA phù hợp với kích thƣớc mong muốn. Sau đó, các mẫu plasmit này đƣợc sử dụng để giải trình tự bằng máy xác định trình tự tự động ABI PRISM 3100 Avant Genetic Analyzer. 3.3. XÁC ĐỊNH TRÌNH TỰ NUCLEOTIT CỦA MỘT SỐ ĐOẠN TRONG GENOME CỦA RGSV Các trình tự của RGSV thu đƣợc trên máy xác định trình tự tự động ABI PRISM ® 3100 Avant Genetic Analyzer đƣợc phân tích, xử lý bằng chƣơng trình DNAstar, BioEdit và MEGA 4. Căn cứ vào kích thƣớc thấy rằng các phân đoạn 1, 4 của RGSV từ mẫu BT thu đƣợc sau khi xác định trình tự phù hợp với kích thƣớc lý thuyết khi thiết kế mồi. Khi so sánh các trình tự này bằng cách Blast trên NCBI thấy rằng, hệ số tƣơng đồng ~1 Kb ~2,7 Kb ~3,7 Kb Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 41 giữa các trình tự đem so sánh với trình tự các phân đoạn 1 và 4 RGSV trong GenBank là rất cao (96- 99%). Kết quả này chứng tỏ hai trình tự trên đúng là các trình tự của phân đoạn 1 và 4 của RGSV. Các trình tự thu đƣợc đƣợc đăng ký vào GenBank với mã số nhƣ trong bảng 3.2. Hai trình tự thu đƣợc có kích thƣớc tƣơng đối ngắn và có độ bảo thủ cao nên khi thực hiện phản ứng PCR ở nhiệt độ thích hợp sẽ có độ nhạy rất cao. Do đó có thể sử dụng 2 cặp mồi này để kiểm tra sự có mặt của RGSV trong mẫu lúa với hiệu quả cao. Bảng 3.2. Mã số đăng ký trên GenBank của các trình tự đã thu đƣợc STT Tên gen (phân đoạn) Tỉnh phân lập Mã số trên GenBank 1 RNA1-RGSV Bình Thuận FM995215 2 RNA4-RGSV Bình Thuận FN179368 3 CP-RGSV Bình Thuận FM882251 4 CP-RGSV Ninh Thuận FM882252 Căn cứ vào kích thƣớc thấy rằng gen CP-RGSV từ các mẫu NT và BT thu đƣợc sau khi xác định trình tự phù hợp với kích thƣớc lý thuyết khi thiết kế mồi. So sánh các trình tự này bằng cách so sánh trên chƣơng trình Blast (NCBI), hệ số tƣơng đồng giữa các trình tự đem so sánh với trình tự gen CP của RGSV trong GenBank là rất cao (96,5- 99%). Kết quả này chứng tỏ đây đúng là các trình tự của gen CP-RGSV. Các trình tự thu đƣợc đƣợc đăng ký vào GenBank với mã số nhƣ trong bảng 3.2. 3.4. SO SÁNH TRÌNH TỰ GEN CP-RGSV CỦA HAI TỈNH NINH THUẬN VÀ BÌNH THUẬN VỚI CÁC TRÌNH TỰ TƢƠNG ỨNG TRÊN GENBANK Kết quả ở bảng 3.3, hệ số tƣơng đồng giữa các trình tự của gen CP- RGSV là rất cao (96,5%- 99,9%) cho thấy gen CP- RGSV có mức độ bảo thủ cao. Đặc biệt, hệ số tƣơng đồng giữa hai trình tự Ninh Thuận và Bình Thuận với các trình tự tƣơng ứng đem so sánh đạt từ 98,0- 99,9%. Trong đó, hai trình tự này giống nhất với trình tự VL2 (EU076544) của tỉnh Vĩnh Long (99,9%) và khác nhất với trình tự CN(AF290947) của Trung Quốc (98,0%). Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 42 Bảng 3.3. Hệ số tƣơng đồng và sai khác giữa trình tự nucleotit của gen CP- RGSV tại Bình Thuận, Ninh Thuận với các trình tự tƣơng ứng của các tỉnh ĐBSCL và thế giới (GenBank). AG(GQ306203): An Giang, BL1(EU076531): Bạc Liêu1, BL2(EU976532): Bạc Liêu2, BT(FM882251): Bình Thuận, CT1(EU076533): Cần Thơ1, CT2(EU076534): Cần Thơ2, CN(AF290947): Trung Quốc, DT1(EU076535): Đồng Tháp1, DT2(EU076536): Đồng Tháp2, HG(GQ329709): Hậu Giang; JP(AB000403): Nhật Bản, JP(AB023779): Nhật Bản, LA(FN433644): Long An; LA(GQ329710): Long An; NT(FM882252): Ninh Thuận, ST1(EU076537): Sóc Trăng1, ST2(EU076538): Sóc Trăng2, TG1(EU076539): Tiền Giang1, TG2(EU076540): Tiền Giang2, TV1(EO076541): Trà Vinh1, TV2(EU076542): Trà Vinh2, VL1(EU076543): Vĩnh Long1, VL2(EU076544): Vĩnh Long2. Hệ số tƣơng đồng H ệ số s ai k h ác Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 43 Cây phát sinh chủng loại đƣợc xây dựng theo phƣơng pháp Bootstrap của phần mềm MEGA4 sử dụng kết quả so sánh ClustalW trình tự các gen CP-RGSV của hai tỉnh Ninh Thuận, Bình Thuận với trình tự của một số trình tự tƣơng ứng đại diện cho các dòng RGSV khác nhau tại Việt Nam và trên thế giới (Hình 3.9). Hình 3.9. Cây phát sinh chủng loại xây dựng trên cơ sở so sánh 02 trình tự nucleotit của gen CP- RGSV Nam Trung Bộ (Ninh Thuận, Bình Thuận) với các trình tự tƣơng ứng của ĐBSCL và thế giới công bố trên GenBank. Cây phát sinh chủng loại đƣợc xây dựng trên cơ sở so sánh 23 trình tự (Nam Trung Bộ (2), ĐBSCL(18) và thế giới (3)) gen CP-RGSV lấy từ GenBank. Thanh bar trình bày số thay thế nucleotide. Các số trên mỗi đốt của cây phát sinh chủng loại là giá trị bootstrap tính theo phần trăm (1000 lần lặp lại). Chỉ những giá trị bootstrap > 50% đƣợc chỉ ra trên hình. AG(GQ306203): An Giang, BL1(EU076531): Bạc Liêu1, BL2(EU976532): Bạc Liêu2, BT(FM882251): Bình Thuận, CT1(EU076533): Cần Thơ1, CT2(EU076534): Cần Thơ2, CN(AF290947): Trung Quốc, DT1(EU076535): Đồng Tháp1, DT2(EU076536): Đồng Tháp2, HG(GQ329709): Hậu Giang; JP(AB000403): Nhật Bản, JP(AB023779): Nhật Bản, LA(FN433644): Long An; LA(GQ329710): Long An; NT(FM882252): Ninh Thuận, ST1(EU076537): Sóc Trăng1, ST2(EU076538): Sóc Trăng2, TG1(EU076539): Tiền Giang1, TG2(EU076540): Tiền Giang2, TV1(EO076541): Trà Vinh1, TV2(EU076542): Trà Vinh2, VL1(EU076543): Vĩnh Long1, VL2(EU076544): Vĩnh Long2. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 44 Qua hình 3.9 thấy rằng cây phát sinh chủng loại đƣợc chia thành hai nhánh chính là: nhánh gồm các trình tự gen CP-RGSV của thế giới và nhánh gồm các trình tự gen CP-RGSV của Việt Nam. Nhánh gồm các trình tự của Việt Nam lại đƣợc chia thành hai nhánh nhỏ, trong đó hai trình tự gen phân lập tại hai tỉnh Nam Trung Bộ thuộc nhánh nhỏ thứ hai gồm các trình tự: VL1, VL2, BL2, TG2, DT1, TV2 (ĐBSCL) và NT, BT (Nam Trung Bộ). Nhƣ vậy, hai dòng RGSV phân lập từ các tỉnh Nam Trung Bộ có quan hệ gần gũi với các dòng RGSV phân lập từ ĐBSCL, đặc biệt là với tỉnh Vĩnh Long và có sự khác biệt nhỏ với nhóm của thế giới. Vì vậy, có thể giả thiết rằng các chủng virut RGSV phân lập đƣợc từ Ninh thuận và Bình Thuận có quan hệ về nguồn gốc với các trình tự của gen CP- RGSV phân lập từ ĐBSCL. Đồng thời, có thể thấy rằng các dòng virut phân lập tại Việt Nam (ĐBSCL và Nam Trung Bộ) đều có nguồn gốc nội địa, nhƣ vậy dịch bệnh VL&LXL tại các khu vực nghiên cứu của Việt Nam do virut nội địa gây ra chứ không phải do virut ngoại lai xâm nhập vào. Căn cứ vào hệ số tƣơng đồng và mối quan hệ giữa các trình tự của gen CP- RGSV (bảng 3.3 và hình 3.9) thấy rằng hai trình tự của Ninh Thuận và Bình Thuận giống nhất với trình tự VL2 của tỉnh Vĩnh Long (99,9%) và khác nhất với trình tự của Trung Quốc (CN- AF290947). Vì vậy chúng tôi lần lƣợt so sánh 2 trình tự trên với trình tự VL2 và trình tự của Trung Quốc nhằm phân tích mức độ đa dạng ở cấp độ nucleotit để đánh giá mức ý nghĩa của những sai khác ở trên. Từ quả kết quả phân tích bằng phần mềm DNAsp thấy hai trình tự của gen CP- RGSV là Bình Thuận và Vĩnh Long2 khác nhau 01 vị trí, tại cặp nucleotit thứ 93. Đồng thời, hai trình tự Ninh Thuận và Vĩnh Long2 cũng chỉ khác nhau tại vị trí cặp nucleotit thứ 585. Sự sai khác tại 01 vị trí giữa trình tự Bình Thuận và Long An2 không ảnh hƣởng tới thành phần và số lƣợng axit amin trong chuỗi polypeptit do 2 trình tự trên mã hóa. Kết quả này cũng tƣơng tự với 2 trình tự Ninh Thuận và Vĩnh Long2. Nhƣ vậy, một lần nữa khẳng định mối quan hệ về nguồn gốc giữa 2 dòng RGSV Bình Thuận và Ninh Thuận với các dòng thuộc khu vực ĐBSCL, đặc biệt là với dòng của tỉnh Vĩnh Long. Mặt khác, khi so sánh trình tự gen CP- RGSV của Bình Thuận và Trung Quốc khác nhau tại 20 vị trí. Các vị trí khác biệt không tập trung tại một vùng gen mà tại nhiều vị trí khác nhau trên cả đoạn gen. Khi so sánh trình tự gen CP- RGSV của Ninh Thuận và Trung Quốc cũng khác nhau tại 20 vị trí. Đồng thời các vị trí khác biệt cũng không tập trung tại 1 khu vực mà trải đều trên gen. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 45 Mặc dù số vị trí sai khác là rất lớn (20/978 = 2,05%), nhƣng cả trình tự của Bình Thuận và Ninh Thuận khi so sánh với trình tự của Trung Quốc trong 20 vị trí bị biến đổi chỉ 2 vị trí làm thay đổi axit amin trong chuỗi polypeptit của gen CP gồm các axit amin số 19 và 221. Nhƣ vậy, mức độ ảnh hƣởng từ sự sai khác trong gen đến sản phẩm protein là không nhiều. Tuy nhiên, vẫn có thể cho rằng sự sai khác giữa các trình tự của gen CP- RGSV là có ý nghĩa. Điều này cũng khẳng định rằng gen CP- RGSV có độ bảo thủ khá cao. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 46 KẾT LUẬN VÀ ĐỀ NGHỊ 1. Kết luận 1> Đã hoàn thiện và tối ƣu phản ứng RT-PCR với các cặp mồi đƣợc thiết kế đặc hiệu để phát hiện virut RGSV với độ đặc hiệu cao. 2> Đã tách dòng, xác định trình tự các phân đoạn 1, 4 RGSV của mẫu lúa Bình Thuận và gen CP- RGSV từ mẫu lúa của hai tỉnh Ninh Thuận, Bình Thuận. Kích thƣớc của gen CP đã đƣợc xác định trình tự đầy đủ là 978 nucleotit, của các phân đoạn 1 và 4 lần lƣợt là 423 và 441 nucleotit. Mã số đăng ký trên GenBank của các trình tự thu đƣợc là: FM995215, FN179368, FM882251, FM882252. 3> Hệ số tƣơng đồng giữa các trình tự của gen CP- RGSV là rất cao (96,5%- 99,9%) cho thấy gen CP- RGSV có mức độ bảo thủ cao. Đặc biệt, hệ số tƣơng đồng giữa hai trình tự Ninh Thuận và Bình Thuận với các trình tự tƣơng ứng đem so sánh đạt từ 98,0- 99,9%. Trong đó, hai trình tự này giống nhất với trình tự VL2 (EU076544) của tỉnh Vĩnh Long (99,9%) và khác nhất với trình tự CN(AF290947) của Trung Quốc (98,0%). 4> So sánh trình tự gen CP- RGSV Bình Thuận và Ninh Thuận với trình tự tƣơng ứng của Trung Quốc thấy 20 điểm sai khác phân bố khá đều trên gen và dẫn đến 2 sự sai khác có ý nghĩa trong hai chuỗi polypeptit do gen này mã hóa. 2. Đề nghị 1> Tiếp tục phân lập các phân đoạn khác trong genome của RGSV và của các chủng virut khác gây bệnh VL&LXL (RRSV, RTSV, RTBV). 2> Nghiên cứu sự có mặt của các chủng virut trên trong rầy nâu nhằm tăng khả năng cảnh báo sự xuất hiện bệnh tại các tỉnh trên. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 47 CÔNG TRÌNH NGHIÊN CỨU ĐÃ CÔNG BỐ 1. Nguyễn Ngọc Sơn, Hoàng Thị Thu Hằng, Đặng Thị Lan Anh, Nguyễn Nhƣ Cƣờng, Nguyễn Hữu Cƣờng, Chu Hoàng Hà, Lê Trần Bình, Nguyễn Trung Nam (2008), Quan hệ di truyền giữa các chủng virut gây bệnh vàng lùn ở lúa tại các tỉnh Nam Trung bộ, Tạp chí Công nghệ sinh học, 6(3): 301-309. 2. Nguyễn Ngọc Sơn, Hoàng Thị Thu Hằng, Nguyễn Hữu Cƣờng, Hoàng Thị Nga, Chu Hoàng Hà, Lê Trần Bình, Đặng Thị Lan Anh, Nguyễn Trung Nam, Nguyễn Nhƣ Cƣờng (2009), Kiểm tra sự có mặt của virut gây bệnh vàng lùn lúa (RGSV) trong rầy nâu tại các tỉnh Nam Trung Bộ bằng RT-PCR. Tạp chí Bảo vệ thực vật, 1: 23- 27. 3. Nguyen Trung Nam, Hoang Thi Thu Hang, Chu Hoang Ha, Nguyen Huu Cuong, Dang Thi Lan Anh, Nguyen Nhu Cuong, Nguyen Ngoc Son, Hoang Thi Nga, Hoang The Hung, Le Tran Binh (2009), Detection of rice ragged stunt virus (RRSV) in Vietnamese rice using RT-PCR and DNA sequencing. Proceeding of the Analytical Vietnam Conference 2009: 233- 240. 4. Nguyen, S.N. et al. (2008, 2009), Các trình tự DNA của virus RGSV đã đăng ký trên GenBank với mã số FM882251, FM882252, FM956076, FM958187, FM995215, FM994933, FM995502, FM995503, FM995504, FM995505, FN179368. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 48 TÀI LIỆU THAM KHẢO Tài liệu tiếng Việt 1. Bùi Bá Bổng (2006), Tổng kết hội nghị phòng chống rầy nâu, bệnh vàng lùn và lùn xoắn lá năm 2006. 2. Phạm Văn Dƣ (2007), Các giải pháp quản lý bệnh vàng lùn, lùn xoắn lá ở Đồng bằng Sông Cửu Long. Các giải pháp kỹ thuật thích hợp cho vụ lúa Hè thu năm 2007 ở Nam bộ. Diễn đàn khuyến nông @ Công nghệ. 3. Hồ Huỳnh Thùy Dƣơng (2002), Sinh học phân tử, NXB Giáo Dục. 4. Phan Trọng Hoàng, Nông Văn Hải, Lê Trần Bình, Chu Hoàng Hà (2005), “Sử dụng enzym XcmI để thiết kế vector pBT phục vụ tách dòng và đọc trình tự gen”, Tạp chí Công nghệ sinh học, 3: 459-463. 5. Vũ Triệu Mân (2007), Một số ý kiến về việc phòng chống bệnh lùn cỏ, vàng lùn và lùn xoắn lá ở miền Nam Việt Nam. Các giải pháp kỹ thuật thích hợp cho vụ Hè Thu năm 2007 ở Nam Bộ. Diễn đàn khuyến nông @ Công nghệ. 6. Nguyễn Thơ (2007), Một số suy nghĩ về phòng trừ bệnh vàng lùn, lùn xoắn lá trên lúa. Các giải pháp kỹ thuật thích hợp cho vụ Hè Thu năm 2007 ở Nam Bộ. Diễn đàn khuyến nông @ Công nghệ. 7. Nguyễn Trung Nam, Nguyễn Minh Hùng, Chu Hoàng Hà, Hoàng Thị Thu Hằng , Lê Trần Bình (2007), “Đánh giá đa dạng di truyền các dòng virus gây bệnh lùn lúa cỏ tại các tỉnh Đồng bằng sông Cửu Long”, Tạp chí Công nghệ Sinh học, 5: 479-484. 8. Hà Minh Trung, Phạm Văn Doãn, Đặng Vũ Thị Thanh, Trần Thị Thuần, Ngô Vĩnh Viễn (1980), Kết quả nghiên cứu bệnh lúa lùn xoắn lá ở các tỉnh phía Nam 1978 – 1979/ Kết quả nghiên cứu khoa học kỹ thuật (1969 - 1979), Nhà xuất bản Nông nghiệp. 9. Ngô Vĩnh Viễn (1994), Bệnh vàng lá lúa do virut và Mycoplasma gây ra và biện pháp phòng trừ ở Việt Nam, Luận án Phó tiến sĩ khoa học nông nghiệp, Viện Khoa học Kỹ thuật Nông nghiệp Việt Nam, Hà Nội. 10. Ngô Vĩnh Viễn (2007), Kết quả nghiên cứu và xây dựng mô hình phòng chống rầy nâu, bệnh vàng lùn, lùn xoắn lá tại Long An và Bến Tre, vụ Đông Xuân 2006- 2007. Hội nghị toàn quốc tổng kết công tác Bảo vệ thực vật năm 2006, kế hoạch công tác năm 2007. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 49 11. Ban chỉ đạo phòng chống rầy nâu, bệnh VL&LXL các tỉnh phía Nam (2008), Báo cáo tình hình dịch rầy nâu, bệnh VL&LXL ở các tỉnh phía Nam. 12. Ban chỉ đạo phòng chống rầy nâu, bệnh VL&LXL các tỉnh phía Nam (2009), Báo cáo tình hình dịch rầy nâu, bệnh VL&LXL ở các tỉnh phía Nam. Tài liệu tiếng nƣớc ngoài 13. Azzam O., Arboleda M., Umadhay K.M.L., Cruz F.S., Mackenzie A., McNally K.L. (2000), “Genetic composition and complexity of virus populations at tungro-endemic and outbreak rice sites”, Arch Virol, 145: 2643-2657. 14. Azzam O., Imbe T., Ikeda R., Nath P.D., Coloquio E. (2001), “Inheritance of resistance to rice tungro spherical virus in a near-isogenic line derived from Utri Merah and in rice cultivar TKM6”, Euphytica, 122: 91-97. (RTSV) 15. Bao Y., and Hull R. (1992), “Characterization of the discontinuities in rice tungro bacilliform virus DNA”. J Gen Virol, 73:1297-1301. 16. Cabauatan P.Q, Hibino H., Lapis D.B. , Omura T., and Tsuchizaki T. (1985), “Transmission of rice tungro bacilliform and spherical viruses by Nephotettix virescens Distant. Philippine”, Phytopathology, 21:103-109. 17. Cabauatan P.Q., Cabunagan R.C., and Koganezawa H. (1995), “Biological variants of rice tungro viruses in the Philippines”, Phytopathology, 85:77-81. 18. Chaogang S., Jianhua W., Guoying Z., Gang S., Baozhen P., Juanli L., Dendi J., Shenxiang C., Upadhyaya N.M., Waterhouse P., and Zuxun G. (2003), “Ectopic expression of the spike protein of Rice Ragged Stunt Oryzavirus in transgenic rice plants inhibits transmission of the virus to insects”, Mol Breeding, 7:295- 301. 19. Chen C., and Chiu R. (1982), “Three symptomatological types of rice virus diseases related to grassy stunt in Taiwan”, Plant Dis, 66 : 5-18. 20. Chen C., Chiu R., Wang E. (1979) “Rice ragged stunt: a virus disease new to Taiwan”, Plant Prot Bull, (Taiwan) 21:447 (Abstr.). 21. Chomchan P., Li S.F., Shirako Y. (2003), “Rice Grassy Stunt Tenuivirus Nonstructural Protein p5 Interacts with Itself To Form Oligomeric Complexes In Vitro and In Vivo”, J Virol, 77: 769–775. 22. Dyck V.A., Thomas B. (1979), The brown planthopper problem. In: Brown Planthopper: Threat to Rice Production in Asia. IRRI, Philippines. pp. 3-17. 23. Druka A., Burns T., Zhang S., Hull R. (1996), “Immunological characterization of rice tungro spherical virus coat proteins and differentiation of isolates from the Philippines and India”, J Gen Virol, 77:1975-1983. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 50 24. Herdt R.W. (1991), Rice Biotechnology, Eds Khush & Toenniessen, pp. 19-54, CABI, Wallingford, UK. 25. Hibino H., Cabauatan P., Omura T., and Tsuchizaki T. (1985b), “Rice grassy stunt virus strain causing tungro like symptoms in the Philippines”, Plant Dis, 69:538-541. 26. Hibino H. (1996), “Biology and epidemiology of rice viruses”, Ann Rev Phytopathol, 34:249-274. 27. Hull R. (1996), “Molecular biology of rice tungro viruses”, Ann Rev Phytopathol, 34:275-297. 28. Iwasaki M., Nakano M., and Shinkai A. (1982), “Variation in the transmission rates of rice grassy stunt virus in various colonies of brown planthopper”, Proc Assoc Plant Prot Kyushu, 28:1-3. 29. Iwasaki M., Nakano M., and Shinkai A. (1985b), “Detection of rice grassy stunt virus in planthopper vectors and rice plants by ELISA”, Ann Phytopathol Soc Jpn. 51:450-458. 30. Lin P.K.T., Brown D.M. (1992), “Synthesis of oligodeoxyribonucleotides containing degenerate bases and their use as primers in the polymerase chain reaction”, Nucleic Acids Res, 19:5149-5152. 31. Ling K.C., Aguiero V.M., and Lee S.H. (1970), “A mass screening method for testing resistance to grassy stunt disease of rice”. Plant Dis Rep, 56:565–569. 32. Ling K.C. (1972), Rice Virus Diseases. International Rice Research Institute, Los Baños Philippines. 33. Mariappan V., Hibino H., and Shanmugam N. (1984), “A new rice virus disease in India”. Int Rice Res Newsl, 9:9-10. 34. Marmey P., Bothner B., Jacquot E., Kochko A.d., Ong C.A., Yot P., Siuzdak G., Beachy R.N., and Fauquet C.M. (1999), “Rice Tungro Bacilliform Virus Open Reading Frame 3 Encodes a Single 37-kDa Coat Protein”, Virolog, 253:319-326. 35. Mayo M.A., Miranda J.R.D., Falk B.W., Goldbach R., Haenni A.L., Toriyama S. (2000), Genus Tenuivirus. In: van Regenmortel M.H.V., Fauquet C.M., Bishop D.H.L., Carstens E.B., Estes M.K., Lemon S.M., Maniloff J., Mayo M.A., McGeoch D.J., Pringle C.R., Wickner R.B. (eds) Virus Taxonomy. Seventh Report of the International Committee on Taxonomy of Viruses, Academic Press, San Diego, pp 622–627 36. Milne R., Ling K. (1982), “Rice ragged stunt virus”. CMI/AAB Desc Pl Viruses, 248:5p. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 51 37. Miranda J.G., Aliyari R., Shirako Y. (2001), “Nucleotide sequence of a Dianthovirus RNA1-like RNA found in grassy stunt- diseased rice plants”, Arch Virol, 146: 225–238. 38. Miranda J.R.D., Wu R., Espinoza A.M. (2001), “Phylogenetic Placement of a Novel Tenuivirus from the Grass Urochloa plantaginea”, Virus Genes, 22: 329– 333. 39. Montpetit M.L., Cassol S., Salas T., and O'Shaughnessy M.V. (1992), “OLIGOSCAN: A computer program to assist in the design of PCR primers homologous to multiple DNA sequences”, J Virol Methods, 36: 119-128. 40. Palmer L.T., Soepriaman Y., Sunendar K., Kartaatmadja S. (1978), “Rice yield losses due to brown planthopper and rice grassy stunt disease in Java and Bali”, Plant Dis Rep, 62: 962-965. 41. Pham V.D., Cabunagan R.C., Choi I.R. (2005), “Rice Yellowing Syndrone in Mekong River Delta”, Omonrice, 13: 135-138. 42. Rivera C.T., Ou S.H.(1965), “Leafhopper transmission of tungro disease of rice”. Plant Dis Rep, 49:127- 131. 43. Rivera C.T., Ou S.H., and Ida T. (1966), “Grassy stunt disease of rice and its transmission by the planthopper Nilaparvata lugens Stal”, Plant Dis Rep, 50:453- 456. 44. Saha P., Dasgupta I., Das S. (2006), “A novel approach for developing resistance in rice against phloem limited viruses by antagonizing the phloem feeding hemipteran vectors”, Plant Mol Biol, 62:735–752. 45. Sambrook J., Russell D. (2001), Molecular Cloning: a Laboratory Manual, 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 46. Shen P., Kaniewska M., Smith C., Beachy R.N. (1993) “Nucleotide sequence and genomic organization of rice tungro spherical virus”, Virology, 193: 621- 630. 47. Shikata E., Senboku T., and Ishimizu T. (1980), “The Causal Agent of Rice Grassy Stunt Disease”, Proc Japan Acad, Ser B 56. 48. Shikata E., Senboku T., Tiongco E.R., and Ling K.C. (1979), ”Rice ragged stunt virus, a new member plant reovirus group”, Ann Phytopath soc Jpn, 45: 436-443. 49. Thole V., Hull R. (1996), “Rice tungro spherical virus: nucleotide sequence of the 3' genomic half and studies on the two small 3' open reading frames”, Virus Genes, 13:239-246. 50. Tinjuangjun P., Loc N.T., Gatehouse A.M.R., Gatehous J.A., Christou P. (2000), “Enhanced insect resistance in Thai rice varieties generated by particlebombardment”, Mol Breeding, 6: 391-399. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 52 51. Toriyama S., Kimishima T., Takahashi M., Shimizu T., Minaka N., Akutsu K. (1998), “The complete nucleotide sequence of the rice grassy stunt virus genome and genomic comparisons with viruses of the genus Tenuivirus”, J Gen Virol, 79: 2051–2058. 52. Zhang S., Davies J.W., Hull R. (1997), “Sequences of the Three Coat Protein Genes of a Malaysian Isolate of Rice Tungro Spherical Virus Reveal a Close Relationship to the Philippine Isolate”, Virus Genes, 15, 61-64. 53. Zhang S., Jones M.C., Barker P., Davies J.W., Hull R. (1993), “Molecular cloning and sequencing of coat protein encoding cDNA of rice tungro spherical virus - a plant picornavirus”, Virus Genes, 7: 121-132. Các trang web: 54. Nguyễn Văn Đức Tiến (2007), Chi cục bảo bệ thực vật thành phố Hồ Chí Minh. Những bệnh nguy hiểm có liên quan đến rầy gây hại trên lúa 55. Trung tâm khuyến nông quốc gia (2006) Sổ tay hướng dẫn phòng trừ rầy nâu truyền bệnh VL&LXL hại lúa. 08&id=1080&langid=0. 56. Cabunagan R.C. (2006), “Yellowing Syndrome” in Mekong Delta, Vietnam: A trip report by Rogelio Cabunagan, PBGB, IRRI August 27- September 2, 2006, Omon, Cantho, www.clrri.org/benhvanglun/tech/benhvanglun.pdf. 57. RGSV description: 58. RRSV description: 59. 60. 61. 62. 63. 64. 65. 66. 67. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 53 PHỤ LỤC Phụ lục 1: Kết quả so sánh bằng chƣơng trình Blast (NCBI) của phân đoạn 1 và 4 của RGSV 1. Phân đoạn 1 (RG1) > emb|FM995215.1| Rice grassy stunt virus partial RNA polymerase, segment RNA1, isolate Binhthuan1 from brown planthopper, genomic RNA Length=423 Score = 760 bits (411), Expect = 0.0 Identities = 419/423 (99%), Gaps = 0/423 (0%) Strand=Plus/Plus RG1 1 CAAACATCCTCCCAAGCATTTCACAGTCTCTGTTACCATATGCCATAGTGTAGTGAGAAT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GB 1 CAAACATCCTCCCAAGCATTTCACAGTCTCTGTTACCATATGCCATAGTGTAGTGAGAAT 60 RG1 61 TTCCCACTCGGTGTTCTCTTGACCATTCCTTCAATGATTGTATAGTATCTGATAGGTGCA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GB 61 TTCCCACTCGGTGTTCTCTTGACCATTCCTTCAATGATTGTATAGTATCTGATAGGTGCA 120 RG1 121 TTGCACTAGATAGACTAACACTTTTGATGTAAGACTCCATATTTTGATCAGAGTTTACTT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GB 121 TTGCACTAGATAGACTAACACTTTTGATGTAAGACTCCATATTTTGATCAGAGTTTACTT 180 RG1 181 CAATCTGAACTGCTACATCATGTAGATAACCTCTCCATACACCTGGTCCGAAGTACTTCT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GB 181 CAATCTGAACTGCTACATCATGTAGATAACCTCTCCATACACCTGGTCCGAAGTACTTCT 240 RG1 241 TTTCCTCCCTGTTATATGATTGCTTTTGGACGTAGCCACCCAGTAGACCTAGATTACCAA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GB 241 TTTCCTCCCTGTTATATGATTGCTTTTGGACGTAGCCACCCAGTAGACCTAGATTACCAA 300 RG1 301 TTCTTATCTTCTCCATAATGTCTCTCCTACAGTATTTAGCTTCATCCCTCAGTTTCATTA 360 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || GB 301 TTCTTATCTTCTCCATAATGTCTCTCCTACAGTATTTAGCTTCATCCCTCAGTTTCAATA 360 RG1 361 GGTCATAACTACTCTTAACAATCCTGTGACCAATCATTGTTAACCAGTTCCTCGTTGGAT 420 ||||||||||||||||||||||| | |||||||||||||| ||||||||||||||||||| GB 361 GGTCATAACTACTCTTAACAATCTTATGACCAATCATTGTCAACCAGTTCCTCGTTGGAT 420 RG1 421 CAT 423 ||| GB 421 CAT 423 Hình 1: Kết quả so sánh trình tự nucleotit giữa trình tự RG1- Bình Thuận với trình tự tƣơng ứng trên GenBank. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 54 2. Phân đoạn 4 (RG4) > emb|FM995504.1| Rice grassy stunt virus segment S4, partial putative p4V protein, isolate Khanhhoa from brown planthopper, genomic RNA Length=441 Score = 804 bits (435), Expect = 0.0 Identities = 439/441 (99%), Gaps = 0/441 (0%) Strand=Plus/Plus RG4 1 AGCTGCCACTCAAGGTGTTTGCCAGTATGGCAAACTTATTCTTCAGTACTCCACAGGAGC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GB 1 AGCTGCCACTCAAGGTGTTTGCCAGTATGGCAAACTTATTCTTCAGTACTCCACAGGAGC 60 RG4 61 TGAGGATTTTAAATTATATAATAACTAGGAATACTGTACAATTTCACTGGACGATTCCTA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GB 61 TGAGGATTTTAAATTATATAATAACTAGGAATACTGTACAATTTCACTGGACGATTCCTA 120 RG4 121 AAAATTCTGATAACCCTATTATTTACACAACACTCTTGCAGAACACTAAAGATTTCTACT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | GB 121 AAAATTCTGATAACCCTATTATTTACACAACACTCTTGCAGAACACTAAAGATTTCTATT 180 RG4 181 TCACAGAGTTGAGAAGTAAAGATTTAAACACTGAAATGCTGGGCTTATGCATCAAGTTAA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GB 181 TCACAGAGTTGAGAAGTAAAGATTTAAACACTGAAATGCTGGGCTTATGCATCAAGTTAA 240 RG4 241 TAATTAAAGTAGTGATCAAAATAAACCAAGGAATCAATATACCATTAGAAGATGTGTTCA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GB 241 TAATTAAAGTAGTGATCAAAATAAACCAAGGAATCAATATACCATTAGAAGATGTGTTCA 300 RG4 301 AGAAAATTTATGATGATAGAGGTAGAAACATTTATTTATATACAAATTTTAGTGATAAAG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GB 301 AGAAAATTTATGATGATAGAGGTAGAAACATTTATTTATATACAAATTTTAGTGATAAAG 360 RG4 361 ACTTAGAAAGAAAGGTTAACCAATATGTACATTGCGCATCTCTTAAATTACCTATCGATT 420 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| GB 361 ACTTAGAAAGAAAGGTTAACCAATATGTACATTGCGCATCTCTTAAACTACCTATCGATT 420 RG4 421 TCGAGAACCACCCACTAGCTC 441 ||||||||||||||||||||| GB 421 TCGAGAACCACCCACTAGCTC 441 Hình 2: Kết quả so sánh trình tự nucleotit giữa trình tự RG4- Bình Thuận với trình tự tƣơng ứng trên GenBank. Phụ Lục 2 : Trình tự nucleotide gen CP và phân đoạn 1, 4 của chủng RGSV phân lập từ lúa các tỉnh Nam Trung Bộ 1. Phân đoạn 1 – RGSV Bình Thuận (FM994933) CAAACATCCTCCCAAGCATTTCACAGTCTCTGTTACCATATGCCATAGTGTAGTGAGAATTTCCCACTCGGTG TTCTCTTGACCATTCCTTCAATGATTGTATAGTATCTGATAGGTGCATTGCACTAGATAGACTAACACTTTTG ATGTAAGACTCCATATTTTGATCAGAGTTTACTTCAATCTGAACTGCTACATCATGTAGATAACCTCTCCATA CACCTGGTCCGAAGTACTTCTTTTCCTCCCTGTTATATGATTGCTTTTGGACGTAGCCACCCAGTAGACCTAG ATTACCAATTCTTATCTTCTCCATAATGTCTCTCCTACAGTATTTAGCTTCATCCCTCAGTTTCATTAGGTCA TAACTACTCTTAACAATCCTGTGACCAATCATTGTTAACCAGTTCCTCGTTGGATCAT Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 55 2. Phân đoạn 4 – RGSV Bình Thuận (FN179368) AGCTGCCACTCAAGGTGTTTGCCAGTATGGCAAACTTATTCTTCAGTACTCCACAGGAGCTGAGGATTTTAAA TTATATAATAACTAGGAATACTGTACAATTTCACTGGACGATTCCTAAAAATTCTGATAACCCTATTATTTAC ACAACACTCTTGCAGAACACTAAAGATTTCTACTTCACAGAGTTGAGAAGTAAAGATTTAAACACTGAAATGC TGGGCTTATGCATCAAGTTAATAATTAAAGTAGTGATCAAAATAAACCAAGGAATCAATATACCATTAGAAGA TGTGTTCAAGAAAATTTATGATGATAGAGGTAGAAACATTTATTTATATACAAATTTTAGTGATAAAGACTTA GAAAGAAAGGTTAACCAATATGTACATTGCGCATCTCTTAAATTACCTATCGATTTCGAGAACCACCCACTAG CTC 3. Gen CP – RGSV Bình Thuận (FM882251) ATGGGTAAAGTGCAGTTTGGAGATGGTCACTGGGCAAATAACAAGGAATGGTCTGAGTTGTTATCAGAAATAT TTTCAAAAATCAGAGCATCCATAGATGGATTTGCCAATGCTACAGCTGATTTGGCTGCAGGATTGGAGTATCA GGCTTTCAATCCTGAAAAGATTTTGAGGAAGTTGATTGCATCCTCAACTTCATTGGATGACTTTGTTAAGGAT ATGCGTGACCTCTTGGTGGCCAGGTACACCAGAGGAACTAGCTTCTTGTTCAATGCTAAAAACTCAATTGAGA AAGCAAAGGATAAGAAGAAGGCTGAAGCTATTCAGGTACTGATAAATAGGTACGGAGTAAAAAAGAATGCTGG TGACAATGCTGTTGATCAAGCCACTTTGGGAAGGATAAGTCAAGTGTTGGCATATATGGCCTTGAGAGTTGCT TTACAAATCACAGACTATCATAAGCCAATCATACCATTGAGACCCATTAGTACCGTTGATATAAAGAATGCTA TCATTGATGTTGTTCCACAATTCTTATATCTTAAAGCAGATCAACTTGATTCAAAGACCAACTCAGAGGCAGC TCTGTATGTAATCCATTTGTGTTACCAAGTCTGTGTGTCTGAAAGAATCATGACTAAAGCTCAGAAAGATAAG CACGGTGTTCACACTAAGTCAGCAATGATAACACACTGCATGGGTTTTGTCAATCTGGCTATGGATAATTCTT CAGTAGTGTCTGATGATAAGATAGCTGGTAGAAGGATGATCTCAGGTCCATGGGGACTACAGGAAACTGCTCT AGATGCCACAGGCTGCGCATGTATCATTGATGTTGTTGATTTCTGCTGCAGGGGACACAAAGTAACAGATGCT GTGGCGCCAGTTCGGCTGTTCAGATTAGCTATTGAGTGCATAAAAGACACAGCTGATCTGAAGGATGCTGGAG TCAAATTGAAGACTCTGGTTGATAAGTGA 4. Gen CP – RGSV Ninh Thuận (FM882252) ATGGGTAAAGTGCAGTTTGGAGATGGTCACTGGGCAAATAACAAGGAATGGTCTGAGTTGTTATCAGAAATAT TTTCAAAAATCAGAGCATCTATAGATGGATTTGCCAATGCTACAGCTGATTTGGCTGCAGGATTGGAGTATCA GGCTTTCAATCCTGAAAAGATTTTGAGGAAGTTGATTGCATCCTCAACTTCATTGGATGACTTTGTTAAGGAT ATGCGTGACCTCTTGGTGGCCAGGTACACCAGAGGAACTAGCTTCTTGTTCAATGCTAAAAACTCAATTGAGA AAGCAAAGGATAAGAAGAAGGCTGAAGCTATTCAGGTACTGATAAATAGGTACGGAGTAAAAAAGAATGCTGG TGACAATGCTGTTGATCAAGCCACTTTGGGAAGGATAAGTCAAGTGTTGGCATATATGGCCTTGAGAGTTGCT TTACAAATCACAGACTATCATAAGCCAATCATACCATTGAGACCCATTAGTACCGTTGATATAAAGAATGCTA TCATTGATGTTGTTCCACAATTCTTATATCTTAAAGCAGATCAACTTGATTCAAAGACCAACTCAGAGGCAGC CCTGTATGTAATCCATTTGTGTTACCAAGTCTGTGTGTCTGAAAGAATCATGACTAAAGCTCAGAAAGATAAG CACGGTGTTCACACTAAGTCAGCAATGATAACACACTGCATGGGTTTTGTCAATCTGGCTATGGATAATTCTT CAGTAGTGTCTGATGATAAGATAGCTGGTAGAAGGATGATCTCAGGTCCATGGGGACTACAGGAAACTGCTCT AGATGCCACAGGCTGCGCATGTATCATTGATGTTGTTGATTTCTGCTGCAGGGGACACAAAGTAACAGATGCT GTGGCGCCAGTTCGGCTGTTCAGATTAGCTATTGAGTGCATAAAAGACACAGCTGATCTGAAGGATGCTGGAG TCAAATTGAAGACTCTGGTTGATAAGTGA

Các file đính kèm theo tài liệu này:

  • pdf13LV09_SP_DitruyenhocNguyenNgocSon.pdf
Tài liệu liên quan