Application of anthracnose resistance-associated molecular markers in the detection of resistant chili pepper cultivars in Viet Nam

It is possible that chili pepper employs different molecular mechanisms to fight against different Colletotrichum species. In the case of HpmsE032, although this marker was proven to be a C. acutatum-resistant marker, its efficiency was only 65% suggesting the involvement of other genes yet unidentified in the defence mechanism against C. acutatum and the combination of different marker would be more efficient in the detection of resistant cultivar27. In 2011, Lee et al. identified two markers related to the resistance to C. scovillei/C. acutatum (CaR12.2) and C. truncatum/C. capsici (CcR9). The later marker was developed to SCAR marker (CcR9M1-SCAR) and was protected under the worldwide patent KR101010446B113,28. These markers could be the potential additional tools for the detection of anthracnose-resistant cultivars, although its application in Vietnam could be difficult due to patent protection. In this current study, the strong resistance to both C. scovillei and C. acutatum of the HNCS cultivar without HpmsE126 marker supported the involvement of other gene clusters and other mechanisms in the resistance to C. scovillei and C. acutatum and the possibility to combine with other molecular markers in the determination of anthracnose resistance caused by C. scovillei and C. acutatum in chili pepper. The findings also support that the CN404 cultivar could be a very good commercial chili pepper cultivar for chili production and cultivation, especially in the regions affected by C. scovillei and C. acutatum. Additionally, the wild bird-eye chili pepper cultivar found in Tra Vinh province could be a potential anthracnose resistance source, which can be applied for chili pepper breeding.

pdf9 trang | Chia sẻ: hachi492 | Lượt xem: 83 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Application of anthracnose resistance-associated molecular markers in the detection of resistant chili pepper cultivars in Viet Nam, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Science & Technology Development Journal, 23(3):576-584 Open Access Full Text Article Research Article University of Science, Vietnam National University, Ho Chi Minh City, Vietnam Correspondence Thanh Hao Nguyen, University of Science, Vietnam National University, Ho Chi Minh City, Vietnam Email: nthao@hcmus.edu.vn History  Received: 2020-05-19  Accepted: 2020-07-13  Published: 2020-07-27 DOI : 10.32508/stdj.v23i3.2395 Copyright © VNU-HCM Press. This is an open- access article distributed under the terms of the Creative Commons Attribution 4.0 International license. Application of anthracnose resistance-associatedmolecular markers in the detection of resistant chili pepper cultivars in Vietnam Vi An Ly, Thao Phuong Thi Truong, Thanh Hao Nguyen* Use your smartphone to scan this QR code and download this article ABSTRACT Introduction: Colletotrichum species is responsible for anthracnose, a worldwide serious disease, causing an important loss in chili pepper production. Therefore, screening disease resistant and sensitive chili pepper cultivars in Vietnam is important not only for in-depth studies of disease resistance-associatedmolecular mechanisms but also for chili production improvement via molec- ular marker-assisted breeding in Vietnam. Methods: To this end, in this study, two Colletotrichum isolateswere obtained from the infected fruits collected fromchili pepper (Capsicumannuum) fields in Tra Vinh province. According to the morphology analysis and the sequencing results of the internal transcribed spacer (ITS) regions, these isolates were identified as C. scovillei and C. acuta- tum. In order to identify the anthracnose-resistant chili pepper cultivars, the pathogenicity test was conducted by infecting fully developed green fruits of eleven chili pepper cultivars with the two isolated Colletotrichum strains. Results: CN404 and HNCS were the two strongest anthracnose- resistant cultivars. Two chili pepper cultivars, TV3 and PN400, showed different resistance tenden- cies to each Colletotrichum isolates. Four different SSRmolecular markers were used in this study to identify the potential molecular markers associated with anthracnose resistance traits in chili pep- per cultivars. Among the four examined markers, HpmsE126 was detected in two anthracnose- resistant chili pepper cultivars, suggesting its close relation to the anthracnose resistance trait in chili pepper. Conclusion: Given that two of the three most anthracnose-resistant cultivars, CN404 and TV3, possess HpmsE126 marker, this marker can be used to detect anthracnose-resistant lines in chili pepper breeding in Vietnam. Key words: Chili pepper, anthracnose, molecular marker INTRODUCTION In Vietnam, chili pepper is an important crop with high economic value. However, the annual chili yield is greatly affected by diseases caused by bacteria and fungi. One of the most well-known diseases in chili pepper is the anthracnose disease caused by the Col- letotrichum fungi species. These fungi were known to infect not only chili pepper but also other crops and orchard plants, such as apple, mango, coffee, etc.1–4. MultipleColletotrichum species have been found to be responsible for the anthracnose disease in chili pepper including C. capsici, C. acutatum, C. gloeosporioides, C. dematium, C. nigrum, C. atramentarium, C. coc- codes and C. scovillei5,6. Apart from C. acutatum, C. capsici, C. gloeosporioides, recent studies in Vietnam have revealed a number of Colletotrichum species in- fecting chili pepper including,C. nigrum,C. siamense, C. fructicola and C. truncatum7,8. Among five domesticated chili pepper species, in- cluding C. annuum, C. baccatum, C. chinense, C. frutescens and C. pubescens, C. annuum is the most commercially important species but is highly sus- ceptible to anthracnose disease. The anthracnose resistance was introduced to C. annuum by cross- ing with other Capsicum species 9,10. The conven- tional breeding and selection processes of disease- resistant cultivars are often time-consuming and re- quire financial resources for pathogenicity testing on large-scale. Different QTL mappings of anthrac- nose resistance were performed in the cross be- tween C. annuum and other Capsicum species dis- covered potential markers linked to anthracnose re- sistance trait11,12. The identification of anthracnose resistance-associated molecular markers allowed the marker-assisted or based breeding, which is less time- consuming and more cost-effective compared to con- ventional breeding13–15. Given that anthracnose is one of the most destructive fungal diseases in chili- growing areas, including tropical Asian countries, e.g. Vietnam16, thus the isolation of new resistant culti- vars via molecular marker-based breeding will help to improve chili production and further bring economic Cite this article : Ly V A, Truong T P T, Nguyen T H. Application of anthracnose resistance-associated molecular markers in the detection of resistant chili pepper cultivars in Vietnam. Sci. Tech. Dev. J.; 23(3):576-584. 576 Science & Technology Development Journal, 23(3):576-584 benefits from chili pepper cultivation. Therefore, the objectives of this study were (i) iden- tifying the Colletotrichum species majorly causing the anthracnose disease in chili pepper in Tra Vinh province (Vietnam), (ii) finding the cultivars show- ing resistance to these pathogens among commer- cial chili pepper cultivars in Vietnam, and most im- portantly, (iii) determining the potential anthracnose resistance-associatedmolecularmarkerswhich can be potentially applied further in chili pepper breeding in Vietnam. MATERIALS ANDMETHODS Plant growth condition One wild bird-eye chili pepper line (TV3) found in Tra Vinh province and ten commercial culti- vars (CN404, HNCS, CP01, HNN1, SGX5, SGX6, HN7777, TN535, HNNS, and PN400) were used in this study. Seeds from eleven cultivars were sown on small soil pots. At the 4-leaf stage, individual seedlings were transferred to pots with 18 cm in di- ameter. Plants were watered every morning with 2 l of water. Nutrients were supplied to each plant ev- ery two weeks with 250 ml of 1/10 MS (Murashige & Skoog) mineral solution. Plants were kept in a net house to avoid insects. Plants that were infected by mealybug were isolated and treated with insecticide (Bihopper 207EC, Binh Dien – Mekong limited com- pany) until recovered. Isolation of pathogenic fungi species Fruits showing anthracnose symptoms (e.g., rounded necrosis spots on the fruit) were collected from chili pepper fields in Tra Vinh province. Infected fruit samples were washed five times by shaking in ster- ile water and dried under a laminar airflow chamber prior to surface sterilization with 70% ethanol for 2 min. The 0.5 cm x 0.5 cm fruit tissues containing the infected region were transferred to potato dextrose agar (PDA, 4% potato starch, 2% dextrose, 1.5% agar) plates kept at 25 oC under 16 h light/8 h dark condi- tion in an incubation room for seven days. Purified fungal strains were obtained after three consecutive sub-cultures on PDA plates. The pure fungal cultures were maintained on PDA plates for Colletotrichum identification and pathogenicity test. Morphological analysis of isolated pathogenic fungi species Pure cultures isolated from infected fruits were first morphologically analyzed to identify the putativeCol- letotrichum strains. The morphology of the fungi strains was analyzed by observing fungal colonies grown on PDA plates, conidia form, and the appres- soria formation. For appressoria preparation, a small piece of thin PDA medium was prepared on a sterile glass microscopy slide. A small spore fragment taken from the fungal culture was distributed to four cor- ners of the PDA medium prepared on the slide that was then sealed by a glass coverslip and placed on a sterile wet filter paper in a petri dish to maintain the humidity. After 14 days, the appressoria, which devel- oped under the coverslips, were collected and placed on a glass slide for observation under a light micro- scope1. The identification of putative Colletotrichum strains was based on the description of Than et al. (2008)17. Identification of pathogenic fungi species via sequencing Based on the morphological characterization, the pu- tativeColletotrichum samples grown on PDAmedium were sent to the PHUSA Biochem LTD. company for sequencing, using the ITS1 primer (CTTGGT- CATTTAGAGGAAGTAA). The sequenced ITS re- gions were used for the sequence homology analy- sis. To identify Colletotrichum species, the sequenc- ing results of the putativeColletotrichum sampleswere used to BLAST with sequences available from Gen- Bank Nucleotide database of NCBI (National Center for Biotechnology Information). Pathogenicity test The two isolated Colletotrichum strains were used to study the anthracnose resistance of eleven chili pep- per cultivars. Colletotrichum isolates were incubated on PDA medium at 25 oC for 14 days. To collect the fungal conidia, 5ml of sterile water was added directly on the culture surface, followed by gently shaking of the petri dish. The conidia suspensions were collected to 1.5-ml tubes and centrifuged at 10000 rpm. The pellets that contained the concentrated conidia, was adjusted with sterile water to 105 conidia per ml us- ing a hemocytometer. For the pathogenicity test, the experiment was per- formed twice to confirm the phenotype. In each replicate, two to six fully developed green fruits from each cultivar were injected with 10 m l of the coni- dia suspensions (105 conidia per ml). Sterile water- infiltrated fruits were used as control. Three technical replicates were performed by injecting on three differ- ent places of a fruit of the cultivar that hadmedium or large fruits. To develop the disease, inoculated fruits were secured in plastic containers lined with wet pa- per towels and incubated for seven days at 25 C.The 577 Science & Technology Development Journal, 23(3):576-584 development of disease symptoms was observed, and the lesion diameter was measured every 24 h. The le- sion diameterwas determined by averaging the largest and the smallest diameters of each lesion. The mean of lesion diameters at seven days after injection were used to determine the resistance of eleven chili pepper cultivars to the particular fungal isolate. Data of lesion diameter from two replicates were statistically ana- lyzed using analysis of variance (P < 0.05), followed by multiple range tests using Tukey’s HSD test with SPSS 16.0 software (IBM). PlantDNAextractionandPCRamplification The genomic DNA of chili pepper was extracted us- ing the CTABmethod 18. TheDNAquality and purity were determined by nanodrop (ND-2000, Thermo Scientific). To verify the presence of anthracnose resistance-associated markers in different chili pep- per cultivars, polymerase chain reactions (PCRs)were performed using primers listed in Table 1. PCRs us- ing TaqDNApolymerase and other components were prepared according to the manufacturer’s instruction (BIO-21105, Bioline). The thermal cycle was started with a denaturation step at 95 oC for 5 min, followed by 35 cycles of 95 oC 30 s, 60 oC 30 s, 72 oC 1min, and ended by a 2-min extension step at 72 oC. Reactions were held at 4 oC. Depending on the product size, 2 to 4% agarose gel was used to migrate DNA under 150 V constant voltage for 50 min. DNA was then visu- alized under UV light, and DNA size was determined according to the 100-bp ladder (SM0241,Thermo Sci- entific). RESULTS Isolates obtained from infected fruits From the infected fruits collected from chili pepper fields in Tra Vinh province, five different fungal iso- lates were obtained. Among these isolates, two puta- tive Colletotrichum strains, named 18T and 21T, were identified. The morphology analysis was performed according to the morphological descriptions of Col- letotrichum species outlined byThan et al. (2008)17. Colonies of the 18T strain grown onPDA showed pale orange color with fluffy aerial mycelia on the colony surface (Figure 1 A). Conidia of the 18T isolate were smooth-walled, transparent, colorless straight, cylin- drical form with uneven ends. The size of the conidia was 10 – 14-mm long and 3 – 4-mmwide. The 18T ap- pressoria were ovoid to ellipsoidal, 6 – 9-mm long, 4 – 6-mm wide, with medium to dark brown color. On the other hand, the colonies of the 21T strain grown on PDA were grey to pale orange with thin cottony mycelia on the surface (Figure 1 B). The 21T isolate produced fusiform conidia with both acute ends, 7 – 13-mm long and 3 – 4-mm wide. Most of the 21T ap- pressoria were irregularly shaped, 5 – 8-mm long, 3 – 4-mm wide. Figure 1: Morphology analysis of the Col- letotrichum isolates on PDA medium. Mor- phology of the 18T isolate (A1 - A4) and the 21T isolate(B1 - B4). The morphological analysis based on the upper side (A1, B1) and lower side (A2, B2) of colonies grown on PDA medium, conidia (A3, B3) and appressoria (A4, B4). The species of the two putative Colletotrichum iso- lates were identified by sequencing the ITS region us- ing the ITS1 primer. The sequencing result success- fully confirmed the prediction that was based on the morphology observation. By comparing with theCol- letotrichum sequence database from NCBI, the ITS sequences of the 18T and 21T isolates showed the highest similarity to Colletotrichum scovillei (Acces- sion number: MH603141.1) and C. acutatum (Ac- cession number: MF629920.1), respectively (data not 578 Science & Technology Development Journal, 23(3):576-584 Table 1: List of molecular markers and the respective primers used in this study Marker name Primer sequence (5’ to 3’) Product size Reference HpmsE032 ATGCGCAAAGGGAGAAAATTCA 282 bp Suwor et al. (2017) CGAACTAACCGTTCATGGTGGA HpmsE116 TCTCTCTCTACATCTCTCCGTTGA 245 bp Yi et al. (2006) ACTCCCATACGGTGTCGTTC Sun et al. (2015) HpmsE126 TGGGTATTTCCTTGCTGGAG 108 bp TCCTTCCAGGAAACTGATGG HpmsE047 AACCCGTGTTCAATCCCCAAAT 252 bp Jayaram et al. (2015) TGGCCATACCACCAGCAGTAGA shown). Therefore, together with themorphology ob- servation, the 18T and 21T isolates were identified as C. scovillei and C. acutatum, respectively. These two fungal strains were later used in the experiment to de- termine the anthracnose resistance of different chili pepper cultivars. Pathogenicity testing Fruits from 11 chili pepper cultivars were infected with the two isolates of Colletotrichum species, C. scovillei and C. acutatum. Both isolates were pathogenic and could successfully infect most of the cultivars. The infected areas were all rounded-shape with concentric acervuli (Figure 2 A). The lesion diameters of the eleven cultivars injected with the two Colletotrichum isolates were described in table 2. The water-injected fruits significantly showed no le- sion in eleven cultivars at seven days after injection (Figure 2). When injected with the Colletotrichum conidia, the lesion diameters were all significantly larger than their corresponding water-injected con- trols (Figure 2 B). There were also significant differ- ences in lesion diameter among eleven cultivars. The two cultivars, including CN404 and HNCS showed the strongest resistance to bothColletotrichum species with the smallest infection diameter, smaller than 3 mm. In these cultivars, larger lesion diameters when infected by C. acutatum compared to that infected by C. scovillei indicated that they were more resistant to C. scovillei. Additionally, TN535 and HNNS were the two most susceptible cultivars to both Colletotrichum species due to their large lesion diameters when in- fected by these two pathogens. The resistance level to C. scovillei was similar to C. acutatum in each cul- tivar, with the exception of the TV3 and PN400 cul- tivars (Figure 2 B). TV3 was strongly resistant to C. scovillei (3 mm in lesion diameter), but moderately resistance to C. acutatum (6 mm in lesion diameter). The PN400 cultivar, on the other hand, was suscepti- ble to the C. scovillei (11.5 mm in lesion diameter) but showed the moderate resistance to C. acutatum (7.5 mm in lesion diameter). Potential anthracnose resistance- associatedmolecular markers Four different PCR-based molecular markers (SSR markers), were tested to determine the potential molecular marker related to the anthracnose resis- tance in Vietnamese chili pepper cultivars. PCRs were performed for eleven chili pepper cultivars, and the summary of results was presented in ta- ble 2. Among the four tested molecular markers, HpmsE032, HpmsE047, and HpmsE116 were de- tected in both resistant and susceptible cultivars in- dicating these markers are not associated with the an- thracnose resistance caused by definedColletotrichum species (Figure 3 B-D). Interestingly, the HpmsE126 marker was observed only in two of three anthrac- nose resistant cultivars, CN404 and TV3 (Figure 3 A). These two chili pepper cultivars carrying HpmsE126 showed very strong resistance to anthracnose since their lesion diameter was significantly lower than the lesion diameter in the cultivars without this marker. The data analysis also suggested that having HpmsE126 marker might contribute more to C. scov- illei resistance thanC. acutatum resistance (Figure 4). Among themarkers showing differences between cul- tivars, HpmsE126 was observed in the two cultivars, CN404 and TV3, which had a very strong resistance to anthracnose, especially the disease caused by C. scovillei. As a result, the HpmsE126 might be related to the resistance to anthracnose and would be a po- tential molecular marker used in chili pepper breed- ing. Given that these chili pepper cultivars showed 579 Science & Technology Development Journal, 23(3):576-584 Figure 2: Anthracnose symptoms on chili fruits from different cultivars at 7 days after injection. (A) Disease symptoms developed on chili fruits from eleven cultivars after injection with either C. scovillei (Cs) or C. acutatum (Ca) isolates. The water-injected fruits were used as control (H2O). Scale bars represent 1 cm. (B) Comparison of lesion diameter caused by the two Colletotrichum isolates on eleven chili pepper cultivars. Mean represents data from two independent replicates. Error bars represent the standard deviation. 580 Science & Technology Development Journal, 23(3):576-584 Table 2: Lesion diameter caused by two Colletotrichum isolates in each cultivar and the detectedmolecular markers Cultivar Lesion diameter* HpmsE126 HpmsE032 HpmsE047 HpmsE116 C. scovillei C. acutatum CN404 2.04 a 4.58 ab X X X X HNCS 2.67 ab 3.25 a X X X TV3 3.00 ab 6.33 abc X X X X CP01 5.86 abc 6.28 abc X X X HNNo1 7.28 abc 9.13 cd X X X SGX005 7.66 abc 9.08 cd X X X SGX006 8.02 bc 8.44 bcd X X X HN7777 8.47 c 10.75 d X X X TN535 9.42 c 9.25 cd X X X HNNS 10.16 c 10.75 d X X X PN400 11.54 c 7.50 bcd X X X * Different letters indicate statistically significant difference (ANOVA, Tukey’s HSD test, P < 0.05) stronger resistance to C. scovillei compared to C. acu- tatum, the HpmsE126 marker might be more related to the C. scovillei resistance in chili pepper. Interest- ingly, it must be noticed that the HNCS cultivar was among the best anthracnose resistant cultivars in this study, although the HpmsE126 marker was not found in this cultivar (Figure 3 A). DISCUSSION In addition to C. acutatum isolation, which was pre- viously identified in studies in Vietnam7,8, different Colletotrichum species causing anthracnose disease in chili pepper in Vietnam, C. scovillei, was firstly iden- tified in this study. This Colletotrichum species was previously reported to cause chili anthracnose dis- ease in Japan, Brazil, China, and Korea 6,19–21. Re- cently, it was shown that in SouthAsia and South-East Asia, except Sri Lanka, C. scovillei was the prevalent anthracnose-causing pathogen and showed very high aggressiveness when infecting non-wounded fruits22. In the study of Oo et al. (2017), all 36 tested cultivars belonging to C. annuum, C. chacoense, and C. bac- catum, were susceptible to the C. scovillei isolates6. Crossing between C. annuum and C. baccatum con- ferred to the resistance to C. scovillei in hybrid sweet pepper was reported in 2012 6. Interestingly, among the tested cultivars in this study, three cultivars, in- cluding CN404, HNCS, and TV3, showed strong re- sistance to the C. scovillei isolate obtained from Tra Vinh province. These cultivars could be a valuable C. scovillei resistance source for chili pepper breeding. According to the findings in this study, it is likely that the C. scovillei resistance trait has already been intro- duced into commercial chili pepper cultivars in Viet- nam. Most of the present commercial chili pepper cultivars belong to the C. annuum species. While C. annuum is commercially important, this species is highly an- thracnose susceptible23. From the 1990s, the po- tential anthracnose resistance sources were identi- fied in other chili pepper species, including C. bac- catum (PBC80, PBC81) and C. chinense (PBC932) 9. In 2014, by studying the backcross BC1 population derived from the hybrid between C. annuum line 77013 and theC. chinense PBC932 usingQTL analysis method, different markers, including HpmsE116 and HpmsE126, were identified to be closely related to the resistance of chili pepper fruit to C. acutatum24,25. In this current study, only the HpmsE126 was found to be related to moderate anthracnose resistance caused by C. acutatum. Interestingly, plants carrying this marker also showed additional strong resistance to C. scovillei, suggesting that a common mechanism might be shared between C. acutatum resistance and C. scovillei resistance. Although HpmsE126 was con- sidered as a minor QTL related to anthracnose resis- tance, in the current study, this marker was more ef- ficient in identifying the anthracnose-resistant culti- vars compared to the other markers. Other markers, HpmsE032 and HpmsE047, were proven to be closely related to the anthracnose resistance26,27. However, 581 Science & Technology Development Journal, 23(3):576-584 Figure 3: DNA electrophoresis of molecular markers amplified by PCRs in different chili pepper cultivars. Marker detection of HpmsE126 (A), HpmsE032 (B), HpmsE047 (C) and HpmsE116 (D) in eleven chili pepper cul- tivars. Lane M: 100-bp DNA Ladder, lane (-): DEPC-treated H2O. All PCR products were migrated in 2% agarose gel. in this study, these markers were not able to deter- mine the anthracnose resistance variance in the tested chili pepper cultivars. It must be noted that the an- thracnose disease in chili pepper is caused by different Colletotrichum species. HpmsE047 was determined as a disease resistance marker when tested with C. gloeosporioides and C. capsici26,28. It is possible that chili pepper employs different molecular mechanisms to fight against different Colletotrichum species. In the case of HpmsE032, although this marker was proven to be a C. acutatum-resistant marker, its ef- ficiency was only 65% suggesting the involvement of other genes yet unidentified in the defence mecha- nism againstC. acutatum and the combination of dif- ferent marker would be more efficient in the detec- tion of resistant cultivar27. In 2011, Lee et al. iden- tified two markers related to the resistance to C. scov- illei/C. acutatum (CaR12.2) and C. truncatum/C. cap- sici (CcR9). The later marker was developed to SCAR marker (CcR9M1-SCAR) and was protected under the worldwide patent KR101010446B1 13,28. These markers could be the potential additional tools for the detection of anthracnose-resistant cultivars, al- though its application in Vietnam could be difficult 582 Science & Technology Development Journal, 23(3):576-584 Figure 4: Comparisonof lesiondiameter between cultivars havingHpmsE126marker and cultivarswithout HpmsE126 marker. Data is presented as mean  SD. Means were compared using Student’s t-test. Statistical difference is presented by either (*) (P < 0.05) or (**) (P < 0.01). due to patent protection. In this current study, the strong resistance to both C. scovillei and C. acuta- tum of the HNCS cultivar without HpmsE126 marker supported the involvement of other gene clusters and other mechanisms in the resistance to C. scovillei and C. acutatum and the possibility to combine with other molecular markers in the determination of anthrac- nose resistance caused by C. scovillei and C. acuta- tum in chili pepper. The findings also support that the CN404 cultivar could be a very good commercial chili pepper cultivar for chili production and cultiva- tion, especially in the regions affected by C. scovillei and C. acutatum. Additionally, the wild bird-eye chili pepper cultivar found in Tra Vinh province could be a potential anthracnose resistance source, which can be applied for chili pepper breeding. CONCLUSION In this study, from the infected fruits collected from chili pepper fields in Tra Vinh province, two Col- letotrichum isolates, C. scovillei and C. acutatum, were successfully isolated and identified using morpholog- ical and sequencing approaches. Among eleven tested chili pepper cultivars infected by theseColletotrichum isolates, two cultivars were identified to have the resis- tance against both of these pathogens. Moreover, the marker analysis found the HpmsE126 SSR marker in the two C. scovillei resistant cultivars. The HpmsE126 might be an efficient molecular tool to identify the anthracnose-resistant cultivars for chili pepper breed- ing. ABBREVIATIONS ITS Internal transcribed spacer SSR Simple Sequence Repeats SCAR Sequence Characterized Amplified Region NCBINational Center for Biotechnology Information COMPETING INTERESTS The authors declare that they have no competing in- terests. AUTHOR CONTRIBUTIONS All the experimental works were performed by VA Ly. TPT Truong was involved in the pathogen isolation and molecular biology works. The project design and manuscript writing were performed by TH Nguyen. ACKNOWLEDGEMENT This research is funded by University of Science, VNU-HCM, under grant number T2018-17 583 Science & Technology Development Journal, 23(3):576-584 REFERENCES 1. Oo MM, Yoon HY, Jang HA, Oh SK. Identification and charac- terization of Colletotrichum species associated with bitter rot disease of apple in South Korea. The plant pathology journal. 2018;34(6):480. 2. Nelson SC. Mango anthracnose (Colletotrichum gloeospori- odes). Plant Dis 48 College of Tropical Agriculture and Hu- man Resources (CTAHR), University of Hawai at Mänoa, Hon- olulu, Hawai. 2008;Available from: www.ctahr.hawaii.edu/oc/ freepubs/pdf/pd-48.pdf. 3. Nguyen PTH, Pettersson OV, Olsson P, Liljeroth E. Identi- fication of Colletotrichum species associated with anthrac- nose disease of coffee in Vietnam. European Journal of Plant Pathology. 2010;127(1):73–87. Available from: https://doi.org/ 10.1007/s10658-009-9573-5. 4. Kim HJ, Lee EJ, Park SH, Lee HS, Chung N. Biological con- trol of anthracnose (Colletotrichum gloeosporioides) in pep- per and cherry tomato by Streptomyces sp. A1022. Journal of Agricultural Science. 2014;6(2):54. Available from: https: //doi.org/10.5539/jas.v6n2p54. 5. Than PP, Prihastuti H, Phoulivong S, Taylor PW, Hyde KD. Chilli anthracnose disease caused by Colletotrichum species. Journal of Zhejiang University Science B. 2008;9(10):764. PMID: 18837103. Available from: https://doi.org/10.1631/jzus. B0860007. 6. Oo MM, Lim G, Jang HA, Oh SK. Characterization and pathogenicity of new record of anthracnose on various chili varieties caused by Colletotrichum scovillei in Korea. Mycobi- ology. 2017;45(3):184–191. PMID: 29138623. Available from: https://doi.org/10.5941/MYCO.2017.45.3.184. 7. Don L, Van T, Phuong VT, Kieu P. Colletotrichum spp. Attack- ing on Chilli Pepper Growing in Vietnam. Country Report Ab- stracts of the First International Symposium on Chilli Anthrac- nose National Horticultural Research Institute, Rural Develop- ment of Administration, Republic of Korea. 2007;. 8. Hung ND, Cuong HV, Lam HC. Detection of Colletotrichum Species Causing Anthracnose of Chili by Polymerase Chain re- action. Vietnam J Agri Sc. 2018;16(12):1025–1038. 9. Gniffke P, Shieh S, et al. Pepper research and breeding at AVRDC-The World Vegetable Center. XV EUCARPIA Meeting on Genetics and Breeding of Capsicum and Eggplant (2-4 September)’. Turin, Italy: Citeseer. 2013;. 10. Kim SH, Yoon JB, Do JW, Park HG. Resistance to anthracnose causedbyColletotrichumacutatum in chili pepper (Capsicum annuum L.). J Crop Sci Biotech. 2007;10(4):277–280. 11. Voorrips RE, Finkers R, Sanjaya L, Groenwold R. QTL mapping of anthracnose (Colletotrichum spp.) resistance in a cross be- tween Capsicum annuum and C. chinense. Theoretical and Applied Genetics. 2004;109(6):1275–1282. PMID: 15309301. Available from: https://doi.org/10.1007/s00122-004-1738-1. 12. Lee J, Hong JH, Do JW, Yoon JB. Identification of QTLs for resistance to anthracnose to two Colletotrichum species in pepper. Journal of Crop Science and Biotechnology. 2010;13(4):227–233. Available from: https://doi.org/10.1007/ s12892-010-0081-0. 13. Lee J, Do JW, Yoon JB. Development of STS markers linked to the major QTLs for resistance to the pepper anthracnose caused by Colletotrichum acutatum and C. capsici. Horticul- ture, Environment, and Biotechnology. 2011;52(6):596–601. Available from: https://doi.org/10.1007/s13580-011-0178-5. 14. Suwor P, Thummabenjapone P, Sanitchon J, Kumar S, Techa- wongstien S. Phenotypic and genotypic responses of chili (Capsicum annuum L.) progressive lines with different resis- tant genes against anthracnose pathogen (Colletotrichum spp.). European journal of plant pathology. 2015;143(4):725– 736. Available from: https://doi.org/10.1007/s10658-015- 0723-7. 15. Wang Y. Development of Sequence characterized amplified region (SCAR) markers associated with pepper anthracnose (Colletotrichum acutatum) resistance. National Chiayi Univer- sity. 2011;. 16. Ridzuan R, Rafii MY, Ismail SI, Mohammad YM, Miah G, Us- man M. Breeding for anthracnose disease resistance in chili: progress and prospects. International journal of molecular sciences. 2018;19(10):3122. PMID: 30314374. Available from: https://doi.org/10.3390/ijms19103122. 17. Than P, Jeewon R, Hyde K, Pongsupasamit S, Mongkolporn O, Taylor P. Characterization and pathogenicity of Col- letotrichum species associated with anthracnose on chilli (Capsicum spp.) in Thailand. Plant Pathology. 2008;57(3):562– 572. Available from: https://doi.org/10.1111/j.1365-3059.2007. 01782.x. 18. Doyle JJ. Isolation of plant DNA from fresh tissue. Focus. 1990;12:13–15. 19. Kanto T, Uematsu S, Tsukamoto T, Moriwaki J, Yamagishi N, Usami T, et al. Anthracnose of sweet pepper caused by Colletotrichum scovillei in Japan. Journal of general plant pathology. 2014;80(1):73–78. Available from: https://doi.org/ 10.1007/s10327-013-0496-9. 20. Caires N, Pinho D, Souza J, Silva M, Lisboa D, Pereira O, et al. First report of anthracnose on pepper fruit caused by Col- letotrichum scovillei in Brazil. Plant disease. 2014;98(10):1437. PMID: 30703977. Available from: https://doi.org/10.1094/ PDIS-04-14-0426-PDN. 21. Zhao W, Wang T, Chen Q, Chi Y, Swe T, Qi R. First re- port of Colletotrichum scovillei causing anthracnose fruit rot on pepper in Anhui Province, China. Plant Disease. 2016;100(10):2168. Available from: https://doi.org/10.1094/ PDIS-04-16-0443-PDN. 22. Silva DD, Groenewald JZ, Crous PW, Ades PK, Nasruddin A, Mongkolporn O, et al. Identification, prevalence and pathogenicity of Colletotrichum species causing anthracnose of Capsicumannuum inAsia. IMA Fungus. 2019;10(1):1. PMID: 32355609. Available from: https://doi.org/10.1186/s43008- 019-0001-y. 23. Ramchiary N, Kole C. The Capsicum Genome. Springer. 2019;Available from: https://doi.org/10.1007/978-3-319- 97217-6. 24. Sun C, Mao SL, Zhang ZH, Palloix A, Wang LH, Zhang BX. Re- sistances to anthracnose (Colletotrichum acutatum) of Cap- sicum mature green and ripe fruit are controlled by a major dominant cluster of QTLs on chromosome P5. Scientia Hor- ticulturae. 2015;181:81–88. Available from: https://doi.org/10. 1016/j.scienta.2014.10.033. 25. Yi G, Lee JM, Lee S, Choi D, KimBD. Exploitation of pepper EST- SSRs and an SSR-based linkage map. Theoretical and Applied Genetics. 2006;114(1):113–130. PMID: 17047912. Available from: https://doi.org/10.1007/s00122-006-0415-y. 26. Jayaram N, Rao AM, Ramesh S, Manjunath B, Mangalagowri N, Ashwini M. Tagging SSR Markers to Genotic Regions Asso- ciated with Anthracnose Disease Resistance and Productivity per seTraits in Hot Pepper (Capsicum annuum L.). Environ- ment & Ecology. 2016;34(4A):1440–1446. 27. Suwor P, Sanitchon J, Thummabenjapone P, Techawongstien S, Kumar S. Inheritance analysis of anthracnose resistance and marker-assisted selection in introgression populations of chili (Capsicum annuum L.). Scientia Horticulturae. 2017;220:20– 26. Available from: https://doi.org/10.1016/j.scienta.2017.03. 032. 28. Barka GD, Lee J. Molecular Marker Development and Gene Cloning for Diverse Disease Resistance in Pepper (Capsicum annuumL.): Current Status and Prospects. Plant Breeding and Biotechnology. 2020;8(2):89–113. Available from: https://doi. org/10.9787/PBB.2020.8.2.89. 584

Các file đính kèm theo tài liệu này:

  • pdfapplication_of_anthracnose_resistance_associated_molecular_m.pdf
Tài liệu liên quan