It is possible that
chili pepper employs different molecular mechanisms
to fight against different Colletotrichum species. In
the case of HpmsE032, although this marker was
proven to be a C. acutatum-resistant marker, its efficiency was only 65% suggesting the involvement of
other genes yet unidentified in the defence mechanism against C. acutatum and the combination of different marker would be more efficient in the detection of resistant cultivar27. In 2011, Lee et al. identified two markers related to the resistance to C. scovillei/C. acutatum (CaR12.2) and C. truncatum/C. capsici (CcR9). The later marker was developed to SCAR
marker (CcR9M1-SCAR) and was protected under
the worldwide patent KR101010446B113,28. These
markers could be the potential additional tools for
the detection of anthracnose-resistant cultivars, although its application in Vietnam could be difficult
due to patent protection. In this current study, the
strong resistance to both C. scovillei and C. acutatum of the HNCS cultivar without HpmsE126 marker
supported the involvement of other gene clusters and
other mechanisms in the resistance to C. scovillei and
C. acutatum and the possibility to combine with other
molecular markers in the determination of anthracnose resistance caused by C. scovillei and C. acutatum in chili pepper. The findings also support that
the CN404 cultivar could be a very good commercial
chili pepper cultivar for chili production and cultivation, especially in the regions affected by C. scovillei
and C. acutatum. Additionally, the wild bird-eye chili
pepper cultivar found in Tra Vinh province could be
a potential anthracnose resistance source, which can
be applied for chili pepper breeding.
9 trang |
Chia sẻ: hachi492 | Lượt xem: 100 | Lượt tải: 0Free
Bạn đang xem nội dung tài liệu Application of anthracnose resistance-associated molecular markers in the detection of resistant chili pepper cultivars in Viet Nam, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Science & Technology Development Journal, 23(3):576-584
Open Access Full Text Article Research Article
University of Science, Vietnam National
University, Ho Chi Minh City, Vietnam
Correspondence
Thanh Hao Nguyen, University of
Science, Vietnam National University, Ho
Chi Minh City, Vietnam
Email: nthao@hcmus.edu.vn
History
Received: 2020-05-19
Accepted: 2020-07-13
Published: 2020-07-27
DOI : 10.32508/stdj.v23i3.2395
Copyright
© VNU-HCM Press. This is an open-
access article distributed under the
terms of the Creative Commons
Attribution 4.0 International license.
Application of anthracnose resistance-associatedmolecular
markers in the detection of resistant chili pepper cultivars in
Vietnam
Vi An Ly, Thao Phuong Thi Truong, Thanh Hao Nguyen*
Use your smartphone to scan this
QR code and download this article
ABSTRACT
Introduction: Colletotrichum species is responsible for anthracnose, a worldwide serious disease,
causing an important loss in chili pepper production. Therefore, screening disease resistant and
sensitive chili pepper cultivars in Vietnam is important not only for in-depth studies of disease
resistance-associatedmolecular mechanisms but also for chili production improvement via molec-
ular marker-assisted breeding in Vietnam. Methods: To this end, in this study, two Colletotrichum
isolateswere obtained from the infected fruits collected fromchili pepper (Capsicumannuum) fields
in Tra Vinh province. According to the morphology analysis and the sequencing results of the
internal transcribed spacer (ITS) regions, these isolates were identified as C. scovillei and C. acuta-
tum. In order to identify the anthracnose-resistant chili pepper cultivars, the pathogenicity test was
conducted by infecting fully developed green fruits of eleven chili pepper cultivars with the two
isolated Colletotrichum strains. Results: CN404 and HNCS were the two strongest anthracnose-
resistant cultivars. Two chili pepper cultivars, TV3 and PN400, showed different resistance tenden-
cies to each Colletotrichum isolates. Four different SSRmolecular markers were used in this study to
identify the potential molecular markers associated with anthracnose resistance traits in chili pep-
per cultivars. Among the four examined markers, HpmsE126 was detected in two anthracnose-
resistant chili pepper cultivars, suggesting its close relation to the anthracnose resistance trait in
chili pepper. Conclusion: Given that two of the three most anthracnose-resistant cultivars, CN404
and TV3, possess HpmsE126 marker, this marker can be used to detect anthracnose-resistant lines
in chili pepper breeding in Vietnam.
Key words: Chili pepper, anthracnose, molecular marker
INTRODUCTION
In Vietnam, chili pepper is an important crop with
high economic value. However, the annual chili yield
is greatly affected by diseases caused by bacteria and
fungi. One of the most well-known diseases in chili
pepper is the anthracnose disease caused by the Col-
letotrichum fungi species. These fungi were known to
infect not only chili pepper but also other crops and
orchard plants, such as apple, mango, coffee, etc.1–4.
MultipleColletotrichum species have been found to be
responsible for the anthracnose disease in chili pepper
including C. capsici, C. acutatum, C. gloeosporioides,
C. dematium, C. nigrum, C. atramentarium, C. coc-
codes and C. scovillei5,6. Apart from C. acutatum, C.
capsici, C. gloeosporioides, recent studies in Vietnam
have revealed a number of Colletotrichum species in-
fecting chili pepper including,C. nigrum,C. siamense,
C. fructicola and C. truncatum7,8.
Among five domesticated chili pepper species, in-
cluding C. annuum, C. baccatum, C. chinense, C.
frutescens and C. pubescens, C. annuum is the most
commercially important species but is highly sus-
ceptible to anthracnose disease. The anthracnose
resistance was introduced to C. annuum by cross-
ing with other Capsicum species 9,10. The conven-
tional breeding and selection processes of disease-
resistant cultivars are often time-consuming and re-
quire financial resources for pathogenicity testing on
large-scale. Different QTL mappings of anthrac-
nose resistance were performed in the cross be-
tween C. annuum and other Capsicum species dis-
covered potential markers linked to anthracnose re-
sistance trait11,12. The identification of anthracnose
resistance-associated molecular markers allowed the
marker-assisted or based breeding, which is less time-
consuming and more cost-effective compared to con-
ventional breeding13–15. Given that anthracnose is
one of the most destructive fungal diseases in chili-
growing areas, including tropical Asian countries, e.g.
Vietnam16, thus the isolation of new resistant culti-
vars via molecular marker-based breeding will help to
improve chili production and further bring economic
Cite this article : Ly V A, Truong T P T, Nguyen T H. Application of anthracnose resistance-associated
molecular markers in the detection of resistant chili pepper cultivars in Vietnam. Sci. Tech. Dev. J.;
23(3):576-584.
576
Science & Technology Development Journal, 23(3):576-584
benefits from chili pepper cultivation.
Therefore, the objectives of this study were (i) iden-
tifying the Colletotrichum species majorly causing
the anthracnose disease in chili pepper in Tra Vinh
province (Vietnam), (ii) finding the cultivars show-
ing resistance to these pathogens among commer-
cial chili pepper cultivars in Vietnam, and most im-
portantly, (iii) determining the potential anthracnose
resistance-associatedmolecularmarkerswhich can be
potentially applied further in chili pepper breeding in
Vietnam.
MATERIALS ANDMETHODS
Plant growth condition
One wild bird-eye chili pepper line (TV3) found
in Tra Vinh province and ten commercial culti-
vars (CN404, HNCS, CP01, HNN1, SGX5, SGX6,
HN7777, TN535, HNNS, and PN400) were used in
this study. Seeds from eleven cultivars were sown
on small soil pots. At the 4-leaf stage, individual
seedlings were transferred to pots with 18 cm in di-
ameter. Plants were watered every morning with 2 l
of water. Nutrients were supplied to each plant ev-
ery two weeks with 250 ml of 1/10 MS (Murashige
& Skoog) mineral solution. Plants were kept in a net
house to avoid insects. Plants that were infected by
mealybug were isolated and treated with insecticide
(Bihopper 207EC, Binh Dien – Mekong limited com-
pany) until recovered.
Isolation of pathogenic fungi species
Fruits showing anthracnose symptoms (e.g., rounded
necrosis spots on the fruit) were collected from chili
pepper fields in Tra Vinh province. Infected fruit
samples were washed five times by shaking in ster-
ile water and dried under a laminar airflow chamber
prior to surface sterilization with 70% ethanol for 2
min. The 0.5 cm x 0.5 cm fruit tissues containing the
infected region were transferred to potato dextrose
agar (PDA, 4% potato starch, 2% dextrose, 1.5% agar)
plates kept at 25 oC under 16 h light/8 h dark condi-
tion in an incubation room for seven days. Purified
fungal strains were obtained after three consecutive
sub-cultures on PDA plates. The pure fungal cultures
were maintained on PDA plates for Colletotrichum
identification and pathogenicity test.
Morphological analysis of isolated
pathogenic fungi species
Pure cultures isolated from infected fruits were first
morphologically analyzed to identify the putativeCol-
letotrichum strains. The morphology of the fungi
strains was analyzed by observing fungal colonies
grown on PDA plates, conidia form, and the appres-
soria formation. For appressoria preparation, a small
piece of thin PDA medium was prepared on a sterile
glass microscopy slide. A small spore fragment taken
from the fungal culture was distributed to four cor-
ners of the PDA medium prepared on the slide that
was then sealed by a glass coverslip and placed on a
sterile wet filter paper in a petri dish to maintain the
humidity. After 14 days, the appressoria, which devel-
oped under the coverslips, were collected and placed
on a glass slide for observation under a light micro-
scope1. The identification of putative Colletotrichum
strains was based on the description of Than et al.
(2008)17.
Identification of pathogenic fungi species
via sequencing
Based on the morphological characterization, the pu-
tativeColletotrichum samples grown on PDAmedium
were sent to the PHUSA Biochem LTD. company
for sequencing, using the ITS1 primer (CTTGGT-
CATTTAGAGGAAGTAA). The sequenced ITS re-
gions were used for the sequence homology analy-
sis. To identify Colletotrichum species, the sequenc-
ing results of the putativeColletotrichum sampleswere
used to BLAST with sequences available from Gen-
Bank Nucleotide database of NCBI (National Center
for Biotechnology Information).
Pathogenicity test
The two isolated Colletotrichum strains were used to
study the anthracnose resistance of eleven chili pep-
per cultivars. Colletotrichum isolates were incubated
on PDA medium at 25 oC for 14 days. To collect the
fungal conidia, 5ml of sterile water was added directly
on the culture surface, followed by gently shaking of
the petri dish. The conidia suspensions were collected
to 1.5-ml tubes and centrifuged at 10000 rpm. The
pellets that contained the concentrated conidia, was
adjusted with sterile water to 105 conidia per ml us-
ing a hemocytometer.
For the pathogenicity test, the experiment was per-
formed twice to confirm the phenotype. In each
replicate, two to six fully developed green fruits from
each cultivar were injected with 10 m l of the coni-
dia suspensions (105 conidia per ml). Sterile water-
infiltrated fruits were used as control. Three technical
replicates were performed by injecting on three differ-
ent places of a fruit of the cultivar that hadmedium or
large fruits. To develop the disease, inoculated fruits
were secured in plastic containers lined with wet pa-
per towels and incubated for seven days at 25 C.The
577
Science & Technology Development Journal, 23(3):576-584
development of disease symptoms was observed, and
the lesion diameter was measured every 24 h. The le-
sion diameterwas determined by averaging the largest
and the smallest diameters of each lesion. The mean
of lesion diameters at seven days after injection were
used to determine the resistance of eleven chili pepper
cultivars to the particular fungal isolate. Data of lesion
diameter from two replicates were statistically ana-
lyzed using analysis of variance (P < 0.05), followed
by multiple range tests using Tukey’s HSD test with
SPSS 16.0 software (IBM).
PlantDNAextractionandPCRamplification
The genomic DNA of chili pepper was extracted us-
ing the CTABmethod 18. TheDNAquality and purity
were determined by nanodrop (ND-2000, Thermo
Scientific). To verify the presence of anthracnose
resistance-associated markers in different chili pep-
per cultivars, polymerase chain reactions (PCRs)were
performed using primers listed in Table 1. PCRs us-
ing TaqDNApolymerase and other components were
prepared according to the manufacturer’s instruction
(BIO-21105, Bioline). The thermal cycle was started
with a denaturation step at 95 oC for 5 min, followed
by 35 cycles of 95 oC 30 s, 60 oC 30 s, 72 oC 1min, and
ended by a 2-min extension step at 72 oC. Reactions
were held at 4 oC. Depending on the product size, 2 to
4% agarose gel was used to migrate DNA under 150
V constant voltage for 50 min. DNA was then visu-
alized under UV light, and DNA size was determined
according to the 100-bp ladder (SM0241,Thermo Sci-
entific).
RESULTS
Isolates obtained from infected fruits
From the infected fruits collected from chili pepper
fields in Tra Vinh province, five different fungal iso-
lates were obtained. Among these isolates, two puta-
tive Colletotrichum strains, named 18T and 21T, were
identified. The morphology analysis was performed
according to the morphological descriptions of Col-
letotrichum species outlined byThan et al. (2008)17.
Colonies of the 18T strain grown onPDA showed pale
orange color with fluffy aerial mycelia on the colony
surface (Figure 1 A). Conidia of the 18T isolate were
smooth-walled, transparent, colorless straight, cylin-
drical form with uneven ends. The size of the conidia
was 10 – 14-mm long and 3 – 4-mmwide. The 18T ap-
pressoria were ovoid to ellipsoidal, 6 – 9-mm long, 4
– 6-mm wide, with medium to dark brown color. On
the other hand, the colonies of the 21T strain grown
on PDA were grey to pale orange with thin cottony
mycelia on the surface (Figure 1 B). The 21T isolate
produced fusiform conidia with both acute ends, 7 –
13-mm long and 3 – 4-mm wide. Most of the 21T ap-
pressoria were irregularly shaped, 5 – 8-mm long, 3 –
4-mm wide.
Figure 1: Morphology analysis of the Col-
letotrichum isolates on PDA medium. Mor-
phology of the 18T isolate (A1 - A4) and the 21T
isolate(B1 - B4). The morphological analysis based
on the upper side (A1, B1) and lower side (A2, B2) of
colonies grown on PDA medium, conidia (A3, B3)
and appressoria (A4, B4).
The species of the two putative Colletotrichum iso-
lates were identified by sequencing the ITS region us-
ing the ITS1 primer. The sequencing result success-
fully confirmed the prediction that was based on the
morphology observation. By comparing with theCol-
letotrichum sequence database from NCBI, the ITS
sequences of the 18T and 21T isolates showed the
highest similarity to Colletotrichum scovillei (Acces-
sion number: MH603141.1) and C. acutatum (Ac-
cession number: MF629920.1), respectively (data not
578
Science & Technology Development Journal, 23(3):576-584
Table 1: List of molecular markers and the respective primers used in this study
Marker name Primer sequence (5’ to 3’) Product
size
Reference
HpmsE032 ATGCGCAAAGGGAGAAAATTCA 282 bp Suwor et al. (2017)
CGAACTAACCGTTCATGGTGGA
HpmsE116 TCTCTCTCTACATCTCTCCGTTGA 245 bp Yi et al. (2006)
ACTCCCATACGGTGTCGTTC Sun et al. (2015)
HpmsE126 TGGGTATTTCCTTGCTGGAG 108 bp
TCCTTCCAGGAAACTGATGG
HpmsE047 AACCCGTGTTCAATCCCCAAAT 252 bp Jayaram et al. (2015)
TGGCCATACCACCAGCAGTAGA
shown). Therefore, together with themorphology ob-
servation, the 18T and 21T isolates were identified as
C. scovillei and C. acutatum, respectively. These two
fungal strains were later used in the experiment to de-
termine the anthracnose resistance of different chili
pepper cultivars.
Pathogenicity testing
Fruits from 11 chili pepper cultivars were infected
with the two isolates of Colletotrichum species, C.
scovillei and C. acutatum. Both isolates were
pathogenic and could successfully infect most of the
cultivars. The infected areas were all rounded-shape
with concentric acervuli (Figure 2 A). The lesion
diameters of the eleven cultivars injected with the
two Colletotrichum isolates were described in table 2.
The water-injected fruits significantly showed no le-
sion in eleven cultivars at seven days after injection
(Figure 2). When injected with the Colletotrichum
conidia, the lesion diameters were all significantly
larger than their corresponding water-injected con-
trols (Figure 2 B). There were also significant differ-
ences in lesion diameter among eleven cultivars. The
two cultivars, including CN404 and HNCS showed
the strongest resistance to bothColletotrichum species
with the smallest infection diameter, smaller than 3
mm. In these cultivars, larger lesion diameters when
infected by C. acutatum compared to that infected by
C. scovillei indicated that they were more resistant to
C. scovillei. Additionally, TN535 and HNNS were the
two most susceptible cultivars to both Colletotrichum
species due to their large lesion diameters when in-
fected by these two pathogens. The resistance level to
C. scovillei was similar to C. acutatum in each cul-
tivar, with the exception of the TV3 and PN400 cul-
tivars (Figure 2 B). TV3 was strongly resistant to C.
scovillei (3 mm in lesion diameter), but moderately
resistance to C. acutatum (6 mm in lesion diameter).
The PN400 cultivar, on the other hand, was suscepti-
ble to the C. scovillei (11.5 mm in lesion diameter) but
showed the moderate resistance to C. acutatum (7.5
mm in lesion diameter).
Potential anthracnose resistance-
associatedmolecular markers
Four different PCR-based molecular markers (SSR
markers), were tested to determine the potential
molecular marker related to the anthracnose resis-
tance in Vietnamese chili pepper cultivars. PCRs
were performed for eleven chili pepper cultivars,
and the summary of results was presented in ta-
ble 2. Among the four tested molecular markers,
HpmsE032, HpmsE047, and HpmsE116 were de-
tected in both resistant and susceptible cultivars in-
dicating these markers are not associated with the an-
thracnose resistance caused by definedColletotrichum
species (Figure 3 B-D). Interestingly, the HpmsE126
marker was observed only in two of three anthrac-
nose resistant cultivars, CN404 and TV3 (Figure 3 A).
These two chili pepper cultivars carrying HpmsE126
showed very strong resistance to anthracnose since
their lesion diameter was significantly lower than
the lesion diameter in the cultivars without this
marker. The data analysis also suggested that having
HpmsE126 marker might contribute more to C. scov-
illei resistance thanC. acutatum resistance (Figure 4).
Among themarkers showing differences between cul-
tivars, HpmsE126 was observed in the two cultivars,
CN404 and TV3, which had a very strong resistance
to anthracnose, especially the disease caused by C.
scovillei. As a result, the HpmsE126 might be related
to the resistance to anthracnose and would be a po-
tential molecular marker used in chili pepper breed-
ing. Given that these chili pepper cultivars showed
579
Science & Technology Development Journal, 23(3):576-584
Figure 2: Anthracnose symptoms on chili fruits from different cultivars at 7 days after injection. (A) Disease
symptoms developed on chili fruits from eleven cultivars after injection with either C. scovillei (Cs) or C. acutatum
(Ca) isolates. The water-injected fruits were used as control (H2O). Scale bars represent 1 cm. (B) Comparison of
lesion diameter caused by the two Colletotrichum isolates on eleven chili pepper cultivars. Mean represents data
from two independent replicates. Error bars represent the standard deviation.
580
Science & Technology Development Journal, 23(3):576-584
Table 2: Lesion diameter caused by two Colletotrichum isolates in each cultivar and the detectedmolecular
markers
Cultivar Lesion diameter* HpmsE126 HpmsE032 HpmsE047 HpmsE116
C. scovillei C. acutatum
CN404 2.04 a 4.58 ab X X X X
HNCS 2.67 ab 3.25 a X X X
TV3 3.00 ab 6.33 abc X X X X
CP01 5.86 abc 6.28 abc X X X
HNNo1 7.28 abc 9.13 cd X X X
SGX005 7.66 abc 9.08 cd X X X
SGX006 8.02 bc 8.44 bcd X X X
HN7777 8.47 c 10.75 d X X X
TN535 9.42 c 9.25 cd X X X
HNNS 10.16 c 10.75 d X X X
PN400 11.54 c 7.50 bcd X X X
* Different letters indicate statistically significant difference (ANOVA, Tukey’s HSD test, P < 0.05)
stronger resistance to C. scovillei compared to C. acu-
tatum, the HpmsE126 marker might be more related
to the C. scovillei resistance in chili pepper. Interest-
ingly, it must be noticed that the HNCS cultivar was
among the best anthracnose resistant cultivars in this
study, although the HpmsE126 marker was not found
in this cultivar (Figure 3 A).
DISCUSSION
In addition to C. acutatum isolation, which was pre-
viously identified in studies in Vietnam7,8, different
Colletotrichum species causing anthracnose disease in
chili pepper in Vietnam, C. scovillei, was firstly iden-
tified in this study. This Colletotrichum species was
previously reported to cause chili anthracnose dis-
ease in Japan, Brazil, China, and Korea 6,19–21. Re-
cently, it was shown that in SouthAsia and South-East
Asia, except Sri Lanka, C. scovillei was the prevalent
anthracnose-causing pathogen and showed very high
aggressiveness when infecting non-wounded fruits22.
In the study of Oo et al. (2017), all 36 tested cultivars
belonging to C. annuum, C. chacoense, and C. bac-
catum, were susceptible to the C. scovillei isolates6.
Crossing between C. annuum and C. baccatum con-
ferred to the resistance to C. scovillei in hybrid sweet
pepper was reported in 2012 6. Interestingly, among
the tested cultivars in this study, three cultivars, in-
cluding CN404, HNCS, and TV3, showed strong re-
sistance to the C. scovillei isolate obtained from Tra
Vinh province. These cultivars could be a valuable
C. scovillei resistance source for chili pepper breeding.
According to the findings in this study, it is likely that
the C. scovillei resistance trait has already been intro-
duced into commercial chili pepper cultivars in Viet-
nam.
Most of the present commercial chili pepper cultivars
belong to the C. annuum species. While C. annuum
is commercially important, this species is highly an-
thracnose susceptible23. From the 1990s, the po-
tential anthracnose resistance sources were identi-
fied in other chili pepper species, including C. bac-
catum (PBC80, PBC81) and C. chinense (PBC932) 9.
In 2014, by studying the backcross BC1 population
derived from the hybrid between C. annuum line
77013 and theC. chinense PBC932 usingQTL analysis
method, different markers, including HpmsE116 and
HpmsE126, were identified to be closely related to the
resistance of chili pepper fruit to C. acutatum24,25. In
this current study, only the HpmsE126 was found to
be related to moderate anthracnose resistance caused
by C. acutatum. Interestingly, plants carrying this
marker also showed additional strong resistance to
C. scovillei, suggesting that a common mechanism
might be shared between C. acutatum resistance and
C. scovillei resistance. Although HpmsE126 was con-
sidered as a minor QTL related to anthracnose resis-
tance, in the current study, this marker was more ef-
ficient in identifying the anthracnose-resistant culti-
vars compared to the other markers. Other markers,
HpmsE032 and HpmsE047, were proven to be closely
related to the anthracnose resistance26,27. However,
581
Science & Technology Development Journal, 23(3):576-584
Figure 3: DNA electrophoresis of molecular markers amplified by PCRs in different chili pepper cultivars.
Marker detection of HpmsE126 (A), HpmsE032 (B), HpmsE047 (C) and HpmsE116 (D) in eleven chili pepper cul-
tivars. Lane M: 100-bp DNA Ladder, lane (-): DEPC-treated H2O. All PCR products were migrated in 2% agarose
gel.
in this study, these markers were not able to deter-
mine the anthracnose resistance variance in the tested
chili pepper cultivars. It must be noted that the an-
thracnose disease in chili pepper is caused by different
Colletotrichum species. HpmsE047 was determined
as a disease resistance marker when tested with C.
gloeosporioides and C. capsici26,28. It is possible that
chili pepper employs different molecular mechanisms
to fight against different Colletotrichum species. In
the case of HpmsE032, although this marker was
proven to be a C. acutatum-resistant marker, its ef-
ficiency was only 65% suggesting the involvement of
other genes yet unidentified in the defence mecha-
nism againstC. acutatum and the combination of dif-
ferent marker would be more efficient in the detec-
tion of resistant cultivar27. In 2011, Lee et al. iden-
tified two markers related to the resistance to C. scov-
illei/C. acutatum (CaR12.2) and C. truncatum/C. cap-
sici (CcR9). The later marker was developed to SCAR
marker (CcR9M1-SCAR) and was protected under
the worldwide patent KR101010446B1 13,28. These
markers could be the potential additional tools for
the detection of anthracnose-resistant cultivars, al-
though its application in Vietnam could be difficult
582
Science & Technology Development Journal, 23(3):576-584
Figure 4: Comparisonof lesiondiameter between cultivars havingHpmsE126marker and cultivarswithout
HpmsE126 marker. Data is presented as mean SD. Means were compared using Student’s t-test. Statistical
difference is presented by either (*) (P < 0.05) or (**) (P < 0.01).
due to patent protection. In this current study, the
strong resistance to both C. scovillei and C. acuta-
tum of the HNCS cultivar without HpmsE126 marker
supported the involvement of other gene clusters and
other mechanisms in the resistance to C. scovillei and
C. acutatum and the possibility to combine with other
molecular markers in the determination of anthrac-
nose resistance caused by C. scovillei and C. acuta-
tum in chili pepper. The findings also support that
the CN404 cultivar could be a very good commercial
chili pepper cultivar for chili production and cultiva-
tion, especially in the regions affected by C. scovillei
and C. acutatum. Additionally, the wild bird-eye chili
pepper cultivar found in Tra Vinh province could be
a potential anthracnose resistance source, which can
be applied for chili pepper breeding.
CONCLUSION
In this study, from the infected fruits collected from
chili pepper fields in Tra Vinh province, two Col-
letotrichum isolates, C. scovillei and C. acutatum, were
successfully isolated and identified using morpholog-
ical and sequencing approaches. Among eleven tested
chili pepper cultivars infected by theseColletotrichum
isolates, two cultivars were identified to have the resis-
tance against both of these pathogens. Moreover, the
marker analysis found the HpmsE126 SSR marker in
the two C. scovillei resistant cultivars. The HpmsE126
might be an efficient molecular tool to identify the
anthracnose-resistant cultivars for chili pepper breed-
ing.
ABBREVIATIONS
ITS Internal transcribed spacer
SSR Simple Sequence Repeats
SCAR Sequence Characterized Amplified Region
NCBINational Center for Biotechnology Information
COMPETING INTERESTS
The authors declare that they have no competing in-
terests.
AUTHOR CONTRIBUTIONS
All the experimental works were performed by VA Ly.
TPT Truong was involved in the pathogen isolation
and molecular biology works. The project design and
manuscript writing were performed by TH Nguyen.
ACKNOWLEDGEMENT
This research is funded by University of Science,
VNU-HCM, under grant number T2018-17
583
Science & Technology Development Journal, 23(3):576-584
REFERENCES
1. Oo MM, Yoon HY, Jang HA, Oh SK. Identification and charac-
terization of Colletotrichum species associated with bitter rot
disease of apple in South Korea. The plant pathology journal.
2018;34(6):480.
2. Nelson SC. Mango anthracnose (Colletotrichum gloeospori-
odes). Plant Dis 48 College of Tropical Agriculture and Hu-
man Resources (CTAHR), University of Hawai at Mänoa, Hon-
olulu, Hawai. 2008;Available from: www.ctahr.hawaii.edu/oc/
freepubs/pdf/pd-48.pdf.
3. Nguyen PTH, Pettersson OV, Olsson P, Liljeroth E. Identi-
fication of Colletotrichum species associated with anthrac-
nose disease of coffee in Vietnam. European Journal of Plant
Pathology. 2010;127(1):73–87. Available from: https://doi.org/
10.1007/s10658-009-9573-5.
4. Kim HJ, Lee EJ, Park SH, Lee HS, Chung N. Biological con-
trol of anthracnose (Colletotrichum gloeosporioides) in pep-
per and cherry tomato by Streptomyces sp. A1022. Journal
of Agricultural Science. 2014;6(2):54. Available from: https:
//doi.org/10.5539/jas.v6n2p54.
5. Than PP, Prihastuti H, Phoulivong S, Taylor PW, Hyde KD.
Chilli anthracnose disease caused by Colletotrichum species.
Journal of Zhejiang University Science B. 2008;9(10):764.
PMID: 18837103. Available from: https://doi.org/10.1631/jzus.
B0860007.
6. Oo MM, Lim G, Jang HA, Oh SK. Characterization and
pathogenicity of new record of anthracnose on various chili
varieties caused by Colletotrichum scovillei in Korea. Mycobi-
ology. 2017;45(3):184–191. PMID: 29138623. Available from:
https://doi.org/10.5941/MYCO.2017.45.3.184.
7. Don L, Van T, Phuong VT, Kieu P. Colletotrichum spp. Attack-
ing on Chilli Pepper Growing in Vietnam. Country Report Ab-
stracts of the First International Symposium on Chilli Anthrac-
nose National Horticultural Research Institute, Rural Develop-
ment of Administration, Republic of Korea. 2007;.
8. Hung ND, Cuong HV, Lam HC. Detection of Colletotrichum
Species Causing Anthracnose of Chili by Polymerase Chain re-
action. Vietnam J Agri Sc. 2018;16(12):1025–1038.
9. Gniffke P, Shieh S, et al. Pepper research and breeding at
AVRDC-The World Vegetable Center. XV EUCARPIA Meeting
on Genetics and Breeding of Capsicum and Eggplant (2-4
September)’. Turin, Italy: Citeseer. 2013;.
10. Kim SH, Yoon JB, Do JW, Park HG. Resistance to anthracnose
causedbyColletotrichumacutatum in chili pepper (Capsicum
annuum L.). J Crop Sci Biotech. 2007;10(4):277–280.
11. Voorrips RE, Finkers R, Sanjaya L, Groenwold R. QTL mapping
of anthracnose (Colletotrichum spp.) resistance in a cross be-
tween Capsicum annuum and C. chinense. Theoretical and
Applied Genetics. 2004;109(6):1275–1282. PMID: 15309301.
Available from: https://doi.org/10.1007/s00122-004-1738-1.
12. Lee J, Hong JH, Do JW, Yoon JB. Identification of QTLs
for resistance to anthracnose to two Colletotrichum species
in pepper. Journal of Crop Science and Biotechnology.
2010;13(4):227–233. Available from: https://doi.org/10.1007/
s12892-010-0081-0.
13. Lee J, Do JW, Yoon JB. Development of STS markers linked
to the major QTLs for resistance to the pepper anthracnose
caused by Colletotrichum acutatum and C. capsici. Horticul-
ture, Environment, and Biotechnology. 2011;52(6):596–601.
Available from: https://doi.org/10.1007/s13580-011-0178-5.
14. Suwor P, Thummabenjapone P, Sanitchon J, Kumar S, Techa-
wongstien S. Phenotypic and genotypic responses of chili
(Capsicum annuum L.) progressive lines with different resis-
tant genes against anthracnose pathogen (Colletotrichum
spp.). European journal of plant pathology. 2015;143(4):725–
736. Available from: https://doi.org/10.1007/s10658-015-
0723-7.
15. Wang Y. Development of Sequence characterized amplified
region (SCAR) markers associated with pepper anthracnose
(Colletotrichum acutatum) resistance. National Chiayi Univer-
sity. 2011;.
16. Ridzuan R, Rafii MY, Ismail SI, Mohammad YM, Miah G, Us-
man M. Breeding for anthracnose disease resistance in chili:
progress and prospects. International journal of molecular
sciences. 2018;19(10):3122. PMID: 30314374. Available from:
https://doi.org/10.3390/ijms19103122.
17. Than P, Jeewon R, Hyde K, Pongsupasamit S, Mongkolporn
O, Taylor P. Characterization and pathogenicity of Col-
letotrichum species associated with anthracnose on chilli
(Capsicum spp.) in Thailand. Plant Pathology. 2008;57(3):562–
572. Available from: https://doi.org/10.1111/j.1365-3059.2007.
01782.x.
18. Doyle JJ. Isolation of plant DNA from fresh tissue. Focus.
1990;12:13–15.
19. Kanto T, Uematsu S, Tsukamoto T, Moriwaki J, Yamagishi N,
Usami T, et al. Anthracnose of sweet pepper caused by
Colletotrichum scovillei in Japan. Journal of general plant
pathology. 2014;80(1):73–78. Available from: https://doi.org/
10.1007/s10327-013-0496-9.
20. Caires N, Pinho D, Souza J, Silva M, Lisboa D, Pereira O, et al.
First report of anthracnose on pepper fruit caused by Col-
letotrichum scovillei in Brazil. Plant disease. 2014;98(10):1437.
PMID: 30703977. Available from: https://doi.org/10.1094/
PDIS-04-14-0426-PDN.
21. Zhao W, Wang T, Chen Q, Chi Y, Swe T, Qi R. First re-
port of Colletotrichum scovillei causing anthracnose fruit
rot on pepper in Anhui Province, China. Plant Disease.
2016;100(10):2168. Available from: https://doi.org/10.1094/
PDIS-04-16-0443-PDN.
22. Silva DD, Groenewald JZ, Crous PW, Ades PK, Nasruddin
A, Mongkolporn O, et al. Identification, prevalence and
pathogenicity of Colletotrichum species causing anthracnose
of Capsicumannuum inAsia. IMA Fungus. 2019;10(1):1. PMID:
32355609. Available from: https://doi.org/10.1186/s43008-
019-0001-y.
23. Ramchiary N, Kole C. The Capsicum Genome. Springer.
2019;Available from: https://doi.org/10.1007/978-3-319-
97217-6.
24. Sun C, Mao SL, Zhang ZH, Palloix A, Wang LH, Zhang BX. Re-
sistances to anthracnose (Colletotrichum acutatum) of Cap-
sicum mature green and ripe fruit are controlled by a major
dominant cluster of QTLs on chromosome P5. Scientia Hor-
ticulturae. 2015;181:81–88. Available from: https://doi.org/10.
1016/j.scienta.2014.10.033.
25. Yi G, Lee JM, Lee S, Choi D, KimBD. Exploitation of pepper EST-
SSRs and an SSR-based linkage map. Theoretical and Applied
Genetics. 2006;114(1):113–130. PMID: 17047912. Available
from: https://doi.org/10.1007/s00122-006-0415-y.
26. Jayaram N, Rao AM, Ramesh S, Manjunath B, Mangalagowri
N, Ashwini M. Tagging SSR Markers to Genotic Regions Asso-
ciated with Anthracnose Disease Resistance and Productivity
per seTraits in Hot Pepper (Capsicum annuum L.). Environ-
ment & Ecology. 2016;34(4A):1440–1446.
27. Suwor P, Sanitchon J, Thummabenjapone P, Techawongstien
S, Kumar S. Inheritance analysis of anthracnose resistance and
marker-assisted selection in introgression populations of chili
(Capsicum annuum L.). Scientia Horticulturae. 2017;220:20–
26. Available from: https://doi.org/10.1016/j.scienta.2017.03.
032.
28. Barka GD, Lee J. Molecular Marker Development and Gene
Cloning for Diverse Disease Resistance in Pepper (Capsicum
annuumL.): Current Status and Prospects. Plant Breeding and
Biotechnology. 2020;8(2):89–113. Available from: https://doi.
org/10.9787/PBB.2020.8.2.89.
584
Các file đính kèm theo tài liệu này:
application_of_anthracnose_resistance_associated_molecular_m.pdf