Biological properties and biomass culture of the microalgae chaetoceros muelleri from Giao Thuy mangrove for use in aquaculture

Fatty acid composition. Microalgae is a potential resource of fatty acids, particularly polyunsaturated fatty acids, PUFAs, which are of major importance determining the nutritional value of microalgae [5, 11, 13]. Fatty acid composition of C. muelleri was characterized and shown in Table 2. The distribution of fatty acids in C. muelleri is similar to most diatoms with high concentration of 16:1n-7 and 20:5n-3, accounting for 58.08% total fatty acids [13]. However, the content of 16:0 and 14:0 is exceptionally low compared to C. calcitrans and C. gracilis and other diatoms in previous reports [13] whereas the content of 14:1n-5 is high. This possibly involved the occurrence of ∆9 desaturation of 14:0. Two third of fatty acids detected in C. muelleri are unsaturated fatty acids, which accounted for approximately 76% total fatty acids. PUFAs, most comprised of C20 PUFA, had significantly high proportion, 36.64% total fatty acids, higher than in C. calcitrans and C. gracilis [13]. C. calcitrans was reported to have high content of EPA, a PUFA required in the diet for many marine animals which may not be able to synthesize the compound sufficiently [1, 7, 13]. In this study, C. muelleri had significantly high level of EPA, 2 - 4 times higher than C. calcitrans and C. gracilis [13] and nearly 1.5-2 times higher than C. muelleri grown in agricultural fertilizer and f/2 medium [9]. C. muelleri also contained remarkable amount of AA (20:4n-6), higher than previously reported Chaetoceros strains (≤ 6.2% total fatty acids) [9, 13]. EPA and AA are important nutritional factors, which play a vital role in the synthesis of eicosanoid compounds such as prostaglandins, which are precursors of a number of compounds known as tissue hormones [1]. Animals lack the requisite enzymes to synthesize PUFAs of more than 18 carbons. Species of microalgae rich in these PUFAs are generally assumed to be of high nutritional value [7, 11, 12]. Based on the high proportion of PUFAs including EPA and AA, this strain of C. muelleri can be grouped to the algae with good food quality in marine ecosystem and can be used widely as C. calcitrans in aquaculture for bivalve molluscs, crustacean larvae etc. In the research of Taylor et al., C. muelleri supported the greatest increase in growth of oyster (Pinctada maxima) spat in single species diet, even better than C. calcitrans [12].

pdf8 trang | Chia sẻ: hachi492 | Lượt xem: 289 | Lượt tải: 0Freedownload
Bạn đang xem nội dung tài liệu Biological properties and biomass culture of the microalgae chaetoceros muelleri from Giao Thuy mangrove for use in aquaculture, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
JOURNAL OF SCIENCE OF HNUE Natural Sci., 2010, Vol. 55, No. 6, pp. 141-148 BIOLOGICAL PROPERTIES AND BIOMASS CULTURE OF THE MICROALGAE Chaetoceros muelleri FROM GIAO THUY MANGROVE FOR USE IN AQUACULTURE Le Thi Phuong Hoa(∗) Hanoi National University of Education Nguyen Thi Hoai Ha, Pham Thi Bich Dao Vietnam National University, Hanoi Nguyen Ngoc Tuyen Hanoi Open University (∗)E-mail: [email protected] Abstract. A Chaetoceros strain was successfully isolated to a unialgal state from Giao Thuy mangrove and identified to be of Chaetoceros muelleri species based on morphological properties and 18S rDNA sequence anal- ysis. ASW medium together with 250/00 of salinity was found to be best suitable for the growth of this strain and was applied to its biomass produc- tion. The fatty acid profile of C. muelleri strain was typical of most diatoms with the exception of low level of 16:0 and 14:0 acids. This strain possessed high concentration of polyunsaturated fatty acids (PUFAs), 36.64% total fatty acids, which is much higher than that of C. calcitrans, C. gracilis and C. muelleri in previous reports. Among these acids, eicosapentaenoic acid (EPA) and arachidonic acid (AA) had significant proportion (24.76% and 7.84%, respectively), which are also higher than the above strains. The iso- lated C. muelleri strain represents a high-quality food resource and has a high potential for use in aquaculture. Keywords: Chaetoceros muelleri, mangrove microalgae, fatty acid, aqua- culture 1. Introduction Microalgae constitutes major oceanic and freshwater primary producers and have been utilized by man for hundreds of years from human and animal nutrition, cosmetics to therapeutic purposes. They possess high-value compounds such as polyunsaturated fatty acids (PUFAs), carotenoids, proteins, polysaccharides and vitamins [8, 11]. In aquaculture, microalgae play a crucial role as they are the natural food source for many marine animals. Their consumers include bivalve 141 Le Thi Phuong Hoa, Nguyen Thi Hoai Ha, Pham Thi Bich Dao and Nguyen Ngoc Tuyen mollusks (e.g. abalones, oysters, scallops, clams and mussels) at all growth stages, crustaceans and some fish species at the larval and early juvenile stages as well as zooplankton which is widely used in aquaculture food chains [2, 8, 11, 13]. To be applied in aquaculture, microalgae have to meet various criteria. They need to be of appropriate size and shape for ingestion. They must have rapid growth rates and be easy to culture and be nontoxic. Finally, they must be nontoxic and have a good nutrient composition, including high protein content, high level of long chain polyunsaturated fatty acids (PUFAs) such as eicosapentaenoic acid (EPA), arachidonic acid (AA) and docosahexaenoic acid (DHA) [2, 8, 11]. Some fatty acids are indeed essential for many marine animals and required for the growth and metamorphosis of many larvae [11-13]. Over the last four decades, several hundred microalgae species have been tested as food, but a limited number have gained widespread use in aquaculture [2]. Strains of Chaetoceros genus are used to feed different groups of commercially important aquatic organisms, including penaeid shrimp larvae, bivalve mollusk lar- vae and postlarvae, prawn larvae and brine shrimp [2]. C. calcitrans and C. gracilis are of the most frequently used species in commercial mariculture operations. In this study, a Chaetoceros strain was isolated from a special ecosystem, mangrove forest, evaluated its nutritional value through fatty acid composition, and suitable growth conditions were built up aiming for potential application in Mariculture. 2. Content 2.1. Material and Methods * Selection, isolation and identification of Chaetoceros muelleri. Samples were collected from different sites of the Giao Thuy Mangrove Forest. Microalgae were grown in medium f/2 at room temperature and illuminated with neon lights (Philips daylight tubes) on 10:14 h light: dark cycles. Chaetoceros strains were isolated to a unialgal state based on their morphological properties [10]. Pictures were taken under 1000-fold OLYMPUS CX41 microscopy. Total DNA was extracted thereafter and 18S rDNA-coding region were amplified according to Fawley and Fawley [3]. PCR products were directly sequenced in an ABM Prism 3100-Avant Sequencer. The obtained sequences were aligned randomly with sequences on NCBI database by BLAST tool to get the positive identity. * Culture conditions of Chaetoceros muelleri. C. muelleri was cultured in different medias f/2, ASW, ESM, Walne and f/2 without silicon [6] in 150 mL unaerated flasks. Cells were harvested every two days and counted in a Neubauer haemocytometer in three replicates. Medium providing best growth of algal cells was chosen for biomass culture of C. muelleri. Effect of 142 Biological properties and biomass culture of the microalgae Chaetoceros muelleri... salinity to the growth of C. muelleri was also examined with different levels from 00/00 to 400/00 NaCl in ASW medium. * Determination of fatty acid composition. Biomass for fatty acid analysis of C. muelleri was obtained from continuously aerated culture suspensions in 1 litre plastic containers. Cells were harvested at the early stationery phase by continuous centrifugation at 10,000 rpm, at 40C in 15 min and extracted thereafter with 10 mL of methanol/chloroform (1:1, v/v). The extracts were concentrated under vacuum to give residues, which were added 4 mL CH3OH-H2SO4 (95:5, v/v) and stirred at 80 0C in 4 hours then water (2.0 mL) was added and extracted with n-hexane [7]. Finally, the n-hexane extracts were analyzed by gas chromatography (Finnigan Trace GC) using an ultra-column BPX70. Fatty acids were identified by comparing retention times with those of a calibration standard solution. 2.2. Results and discussion * Morphology and taxonomy of the isolated Chaetoceros strain. A Chaetoceros strain were selected and isolated from the Giao Thuy Mangrove water based on morphological properties [10] and marked as C2. Cells of this strain are solitary and hexagonal in girdle view with high mantle. Terminal and intercalary setae are similar, long, and thick, with short basal part. Setae do not touch each other, but arise close to the corners and diverge perpendicularly to the colony axis. Its morphology was shown in Figure 1. Figure 1. Microscopic morphology of Chaetoceros muelleri The sample was subjected to PCR amplification and sequencing analysis of 18S rDNA-coding region, which resulted in a 652bp sequence: 143 Le Thi Phuong Hoa, Nguyen Thi Hoai Ha, Pham Thi Bich Dao and Nguyen Ngoc Tuyen AAATCCCTTATCGAGGATCAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAAT TCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAACTCGTAGTTGGATTTG TGGTGTGACTGATCGGTCCGACCTTTGGTGGGTACTCGATCTTGTCACGCCATCCTT GAGTGGTTCGCTCTGGCATTAAGTTGTCGGGGCGGCAGCCGCTCATCGTTTACTGTG AGAAAATGTGTTCAAAGCAGGCTTATGCCGTTGAATATACTAGCATGGAATAATAAGA TAGGACCTCGGTACTATTTTGTTGGTTTGAGAACCAAGGTAATGATCAATAGGGACA GTTGGGGGTATTCGTATTCAGTTGTCAGAGGTGAAATTCTTAGATTTACGGAAGACG AACTACTGCGAAAGCATTTACCAAGGATGTTTTCTAATCAAGAACGAAAGTATGGGG ATCGATGATTAGATACCATCGTAGTCTATACCATAAACTATGCCGACTCAGGATGGGC GGGTGCCACTCTGGCCTCGTCTGCACTGTATGAGAAATCAAAGTCTTTGGGTTCCGG GGGGAGTATGGTCGCAAGGCTGACTTAAAGGAATTGACGGAAGGGCACCACCAGGA GTGGAACCTGCGGCTTAATTTG The alignment with sequences on NCBI database suggested this strain be- longs to the Chaetoceros muelleri species wich is 98% identical to the sequence of Chaetoceros muelleri strain CCMP1316. - Phylum: Bacillariophyta - Class: Coscinodiscophyceae - Order: Chaetocerotales - Family: Chaetocerotaceae - Genus: Chaetoceros * Selection of culture medium. The nutritional value of microalgae can vary considerably according to the cultural conditions [2]. The economic feasibility of algal mass culture for aquaculture was enhanced by the ability to increase microalgal biomass productivity [8]. In this study, we tested the microalgae with various media f/2, ASW, ESM, Walne and f/2 without silicon [6]. Cell density was 0.31 cells × 106 mL−1 at the beginning and determined every two days and the growth rate of C. muelleri was plotted as in Figure 2. Figure 2. The growth of Chaetoceros muelleri in different culture media The growth rate of C. muelleri started increasing on the fifth day of culture 144 Biological properties and biomass culture of the microalgae Chaetoceros muelleri... and reached the highest on the 9 - 11th day and decreased remarkably on the 13th day. C. muelleri grew better in ASW and Walne medium better than in the other media. Cell density of C. muelleri in ASW medium is highest, 67.22 cells × 06 mL−1 at the 11th day of culture, nearly 2-3 times higher than in ESM, f/2 and f/2 without Si. The growth rate is an important way to express the relative ecological success of a strain in adapting to its natural or experimental environment [4]. It is suggested that the ASW medium is the most suitable for the growth of C. muelleri. This medium can be made without natural sea water, suggesting the potential of large scale culture of C. muelleri strains. * Effect of salinities on the growth rate of Chaetoceros muelleri. Salinity is an environmental factor having significant effects on the growth and biochemical composition of marine algae as with all other plants [4, 5]. Each species has its own salinity tolerance. In order to figure out the suitable concentration of salinity for the growth condition of C. muelleri, seven concentrations of salinity were applied and the result was shown in Table 1. Table 1. The growth rate of Chaetoceros muelleri at different concentrations of salinity Cell density (cells ×106 mL−1) Culture day 0/00 100/00 200/00 250/00 300/00 350/00 400/00 1 1 1 1 1 1 1 1 3 1 3.03 3.16 4.77 3.78 3.17 2.11 5 0.70 7.06 8.24 15.45 10.42 9.72 3.01 7 0.30 18.03 21.30 35.30 28.93 24.50 8.00 9 0 14.10 16.98 27.06 23.71 19.88 4.99 The growth of C. muelleri was completely inhibited at 00/00 of salinity. How- ever, they were able to grow at 10 - 40 0/00, indicating their tolerance to a wide range of salinity. The growth rate was highest at 25 0/00 and decreased with the increasing concentration of salinity. It decreased remarkably at 40 0/00, which was just 4 - 5 times less than 25 0/00. This was probably due to non adaptability of this strain to higher salinity, which relates to the decrease in photosynthetic rate involv- ing the salt stress-induced inactivation of the photosynthetic machinery, especially the photosystem II [4]. The most suitable concentration of salinity for C. muelleri is 25 0/00. * Biomass production of Chaetoceros muelleri. Microalgae are the basis of the food chain in many aquaculture operations. Management of microalgal populations is thus considered to be an integral part of aquaculture [2]. In this study, a scheme for biomass production of the isolated C. muelleri strain was established and successfully developed. C. muelleri strain was cultured in ASW medium at room temperature and illuminated under neon light 145 Le Thi Phuong Hoa, Nguyen Thi Hoai Ha, Pham Thi Bich Dao and Nguyen Ngoc Tuyen (Philips daylight tubes) at 4000 - 5000 Lux on 10:14 h light: dark cycles as the above scheme. Stock culture ↓ 250 ml conical flask, unaerated ↓ 500 ml conical flask, unaerated ↓ 2-litre plastic container, aerated continuously ↓ Addition of culture medium 5-litre plastic container, aerated continuously ↓ Addition of culture medium 20-litre plastic container, aerated continuously ↓ Biomass collection Figure 3. Schematic outline for biomass production of Chaetoceros muelleri * Fatty acid composition. Microalgae is a potential resource of fatty acids, particularly polyunsaturated fatty acids, PUFAs, which are of major importance determining the nutritional value of microalgae [5, 11, 13]. Fatty acid composition of C. muelleri was characterized and shown in Table 2. The distribution of fatty acids in C. muelleri is similar to most diatoms with high concentration of 16:1n-7 and 20:5n-3, accounting for 58.08% total fatty acids [13]. However, the content of 16:0 and 14:0 is exceptionally low compared to C. calcitrans and C. gracilis and other diatoms in previous reports [13] whereas the content of 14:1n-5 is high. This possibly involved the occurrence of ∆9 desaturation of 14:0. Two third of fatty acids detected in C. muelleri are unsaturated fatty acids, which accounted for approximately 76% total fatty acids. PUFAs, most comprised of C20 PUFA, had significantly high proportion, 36.64% total fatty acids, higher than in C. calcitrans and C. gracilis [13]. C. calcitrans was reported to have high content of EPA, a PUFA required in the diet for many marine animals which may not be able to synthesize the compound sufficiently [1, 7, 13]. In this study, C. muelleri had significantly high level of EPA, 2 - 4 times higher than C. calcitrans and C. gracilis [13] and nearly 1.5-2 times higher than C. muelleri grown in agricultural fertilizer and f/2 medium [9]. C. muelleri also contained remarkable amount of AA (20:4n-6), higher than previously reported Chaetoceros strains (≤ 6.2% total fatty acids) [9, 13]. EPA and AA are important nutritional factors, which play a vital role in the synthesis of eicosanoid compounds such as prostaglandins, which are precursors of 146 Biological properties and biomass culture of the microalgae Chaetoceros muelleri... a number of compounds known as tissue hormones [1]. Animals lack the requisite enzymes to synthesize PUFAs of more than 18 carbons. Species of microalgae rich in these PUFAs are generally assumed to be of high nutritional value [7, 11, 12]. Based on the high proportion of PUFAs including EPA and AA, this strain of C. muelleri can be grouped to the algae with good food quality in marine ecosystem and can be used widely as C. calcitrans in aquaculture for bivalve molluscs, crustacean larvae etc. In the research of Taylor et al., C. muelleri supported the greatest increase in growth of oyster (Pinctada maxima) spat in single species diet, even better than C. calcitrans [12]. Table 2. Percentage composition of fatty acids in Chaetoceros muelleri No Fatty acid Chemical name Common name Percentage (% total fatty acids) 1 C 14:0 Tetradecanoic acid Myristic 1.91 2 C 14:1n-5 Tetradecenoic acid Myristoleic 18.09 3 C 15:0 Pentadecanoic acid Convolvulinolic 0.74 4 C 15:1n-5 Pentadecenoic acid Hormelic 0.096 5 C 16:0 Hexadecanoic acid Palmitic 5.53 6 C 16:1n-7 9-Hexadecenoic acid Palmitoleic 15.23 7 C 16:1n-9 7-Hexadecenoic acid Ambrettolic 2.20 8 C 17:0 Heptadecanoic acid Margric 9.52 9 C 18:0 Octadecanoic acid Stearic 1.46 10 C 18:1n-7 11-Octadecenoic acid Asclepic 3.74 11 C 18:2n-6-c 9,12-Octadecadienoic acid Linoleic 2.70 12 C 18: 3n-6 6,9,12-Octadecatrienoic acid γ - Linolenic acid (GLA) 1.12 13 C 18: 4n-3 Octadecatetraenoic acid 0.22 14 C 20:0 Eicosanoic acid Arachidic 1.05 15 C 20:1n-7 13-Eicosaenoic acid Paullinic 0.26 16 C 20:1n-9 11-Eicosaenoic acid Gondoic 0.099 17 C 20:4n-6 5,8,11,14-Eicosatetraenoic acid Arachidonic acid (AA) 7.84 18 C 20:5n-3 5,8,11,14,17- Eicosapentaenoic acid Eicosapentaenoic acid (EPA) 24.76 19 C 24:0 Tetracosanoic acid Lignoceric 0.12 3. Conclusion Cultured microalgae remain a critical resource for commercial rearing of ma- rine animals. They provide high-value compounds including long-chain PUFAs, which animals cannot sufficiently synthesize themselves. Our results confirmed the potential of a strain of C. muelleri isolated from mangrove to produce a high amount of valuable long chain PUFAs under specific growth conditions. This makes the strain interesting for mariculture as a single diet or in a mixed diet. The success of in-door biomasss production of this strain provides the potential of large-scale production of this strain for open hatcheries. 147 Le Thi Phuong Hoa, Nguyen Thi Hoai Ha, Pham Thi Bich Dao and Nguyen Ngoc Tuyen Acknowledgements This work was supported by Ministry of Education and Training, Vietnam through Hanoi National University of Education (Project number B2009-17-198). REFERENCES [1] P. Bajpai and P. K. Bajpai, 1993. Ecosapentaenoic acid (EPA) production from microorganisms: a review. Journal of Biotechnology, Vol. 30, pp. 161-183. [2] P. Coutteau, 1996. Micro-algae, in ”Manual on the production and use of live food for aquaculture”. Eds. by P. Lavens and P. Sorgeloos, FAO, pp. 7-48. [3] M. W. Fawley and K. P. Fawley, 2004. A simple and rapid technique for the isolation of DNA from microalgae. Journal of Phycology, Vol. 40, pp. 223-225. [4] F. Ghezelbash, T. Farboodma, R. Heidari and N. Agh, 2008. Effects of different salinities and luminance on growth rate of the green microalgae Tetraselmis chuii. Research Journal of Biological Sciences, Vol. 3, No. 3, pp. 311-314. [5] I. A. Guschina, J. L. Harwood, 2006. Lipids and lipid metabolism in eukaryotic algae. Progress in Lipid Research, Vol. 45, pp. 160-186. [6] F. Kasai, M. Kawachi, M. Erata, F. Mori, K. Yumoto, M. Sato, and M. Ishi- moto, 2009. NIES-Collection List of Strains, 8th Edition. National Institute for Environmental Studies, Japan, pp. 214-229. [7] L. Krienitz, M. Wirth, 2006. The high content of polyunsaturated fatty acids in Nannochloropsis limnetica (Eustigmatophyceae) and its implication for food web interactions, freshwater aquaculture and biotechnology. Limnologica, Vol. 36, pp. 204-210. [8] A. Muller-Feuga, 2000. The role of microalgae in aquaculture: situation and trends. Journal of Applied Phycology, Vol. 12(3-5), pp. 527-534. [9] J. M. Pacheco-Vega and M. D. P. Snchez-Saavedra, 2009. The biochemical compo- sition of Chaetoceros muelleri (Lemmermann) grown with an agricultural fertilizer. Journal of the World Aquaculture Society, Vol. 40, No. 4, pp. 556-560. [10] Akihiko Shirora, 1966. The plankton of south, Vietnam - Fresh Water and Marine Plankton. Overseas Technical Cooperation Agency Japan. [11] P. Spolaore, C. Joannis-Cassan, E. Duran and A. Isambert, 2005. Commercial application of microalgae. Journal of Bioscience and Bioengineering, Vol. 101, pp. 87-96. [12] J. J. Taylor, P. C. Southgate, M. S. Wing and R. A. Rose, 1997. The nutritional value of five species of microalgae for spat of the silver - lip pearl oyster, Pinctada maxima (Jameson)(Mollusca: Pteriidae). Asian Fisheries Science, Vol. 10, pp. 1-8. [13] J. K. Volkman, S. W. Jeffrey, P. D. Nichols, G. I. Rogers and C. D. Garland, 1989. Fatty acid and lipid composition of 10 species of microalgae used in maricul- ture. Journal of Experimental Marine Biology and Ecology, Vol. 128, pp. 219-240. 148

Các file đính kèm theo tài liệu này:

  • pdfbiological_properties_and_biomass_culture_of_the_microalgae.pdf
Tài liệu liên quan