Fatty acid composition.
Microalgae is a potential resource of fatty acids, particularly polyunsaturated
fatty acids, PUFAs, which are of major importance determining the nutritional value
of microalgae [5, 11, 13]. Fatty acid composition of C. muelleri was characterized
and shown in Table 2.
The distribution of fatty acids in C. muelleri is similar to most diatoms with
high concentration of 16:1n-7 and 20:5n-3, accounting for 58.08% total fatty acids
[13]. However, the content of 16:0 and 14:0 is exceptionally low compared to C.
calcitrans and C. gracilis and other diatoms in previous reports [13] whereas the
content of 14:1n-5 is high. This possibly involved the occurrence of ∆9 desaturation
of 14:0. Two third of fatty acids detected in C. muelleri are unsaturated fatty acids,
which accounted for approximately 76% total fatty acids. PUFAs, most comprised
of C20 PUFA, had significantly high proportion, 36.64% total fatty acids, higher than
in C. calcitrans and C. gracilis [13]. C. calcitrans was reported to have high content
of EPA, a PUFA required in the diet for many marine animals which may not be
able to synthesize the compound sufficiently [1, 7, 13]. In this study, C. muelleri had
significantly high level of EPA, 2 - 4 times higher than C. calcitrans and C. gracilis
[13] and nearly 1.5-2 times higher than C. muelleri grown in agricultural fertilizer
and f/2 medium [9]. C. muelleri also contained remarkable amount of AA (20:4n-6),
higher than previously reported Chaetoceros strains (≤ 6.2% total fatty acids) [9,
13]. EPA and AA are important nutritional factors, which play a vital role in the
synthesis of eicosanoid compounds such as prostaglandins, which are precursors of
a number of compounds known as tissue hormones [1]. Animals lack the requisite
enzymes to synthesize PUFAs of more than 18 carbons. Species of microalgae rich in
these PUFAs are generally assumed to be of high nutritional value [7, 11, 12]. Based
on the high proportion of PUFAs including EPA and AA, this strain of C. muelleri
can be grouped to the algae with good food quality in marine ecosystem and can be
used widely as C. calcitrans in aquaculture for bivalve molluscs, crustacean larvae
etc. In the research of Taylor et al., C. muelleri supported the greatest increase in
growth of oyster (Pinctada maxima) spat in single species diet, even better than C.
calcitrans [12].
8 trang |
Chia sẻ: hachi492 | Lượt xem: 83 | Lượt tải: 0Free
Bạn đang xem nội dung tài liệu Biological properties and biomass culture of the microalgae chaetoceros muelleri from Giao Thuy mangrove for use in aquaculture, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
JOURNAL OF SCIENCE OF HNUE
Natural Sci., 2010, Vol. 55, No. 6, pp. 141-148
BIOLOGICAL PROPERTIES AND BIOMASS CULTURE OF THE
MICROALGAE Chaetoceros muelleri FROM GIAO THUY
MANGROVE FOR USE IN AQUACULTURE
Le Thi Phuong Hoa(∗)
Hanoi National University of Education
Nguyen Thi Hoai Ha, Pham Thi Bich Dao
Vietnam National University, Hanoi
Nguyen Ngoc Tuyen
Hanoi Open University
(∗)E-mail: lephhoa@yahoo.com
Abstract. A Chaetoceros strain was successfully isolated to a unialgal state
from Giao Thuy mangrove and identified to be of Chaetoceros muelleri
species based on morphological properties and 18S rDNA sequence anal-
ysis. ASW medium together with 250/00 of salinity was found to be best
suitable for the growth of this strain and was applied to its biomass produc-
tion. The fatty acid profile of C. muelleri strain was typical of most diatoms
with the exception of low level of 16:0 and 14:0 acids. This strain possessed
high concentration of polyunsaturated fatty acids (PUFAs), 36.64% total
fatty acids, which is much higher than that of C. calcitrans, C. gracilis and
C. muelleri in previous reports. Among these acids, eicosapentaenoic acid
(EPA) and arachidonic acid (AA) had significant proportion (24.76% and
7.84%, respectively), which are also higher than the above strains. The iso-
lated C. muelleri strain represents a high-quality food resource and has a
high potential for use in aquaculture.
Keywords: Chaetoceros muelleri, mangrove microalgae, fatty acid, aqua-
culture
1. Introduction
Microalgae constitutes major oceanic and freshwater primary producers and
have been utilized by man for hundreds of years from human and animal nutrition,
cosmetics to therapeutic purposes. They possess high-value compounds such as
polyunsaturated fatty acids (PUFAs), carotenoids, proteins, polysaccharides and
vitamins [8, 11]. In aquaculture, microalgae play a crucial role as they are the
natural food source for many marine animals. Their consumers include bivalve
141
Le Thi Phuong Hoa, Nguyen Thi Hoai Ha, Pham Thi Bich Dao and Nguyen Ngoc Tuyen
mollusks (e.g. abalones, oysters, scallops, clams and mussels) at all growth stages,
crustaceans and some fish species at the larval and early juvenile stages as well
as zooplankton which is widely used in aquaculture food chains [2, 8, 11, 13]. To
be applied in aquaculture, microalgae have to meet various criteria. They need
to be of appropriate size and shape for ingestion. They must have rapid growth
rates and be easy to culture and be nontoxic. Finally, they must be nontoxic and
have a good nutrient composition, including high protein content, high level of long
chain polyunsaturated fatty acids (PUFAs) such as eicosapentaenoic acid (EPA),
arachidonic acid (AA) and docosahexaenoic acid (DHA) [2, 8, 11]. Some fatty
acids are indeed essential for many marine animals and required for the growth and
metamorphosis of many larvae [11-13]. Over the last four decades, several hundred
microalgae species have been tested as food, but a limited number have gained
widespread use in aquaculture [2].
Strains of Chaetoceros genus are used to feed different groups of commercially
important aquatic organisms, including penaeid shrimp larvae, bivalve mollusk lar-
vae and postlarvae, prawn larvae and brine shrimp [2]. C. calcitrans and C. gracilis
are of the most frequently used species in commercial mariculture operations. In
this study, a Chaetoceros strain was isolated from a special ecosystem, mangrove
forest, evaluated its nutritional value through fatty acid composition, and suitable
growth conditions were built up aiming for potential application in Mariculture.
2. Content
2.1. Material and Methods
* Selection, isolation and identification of Chaetoceros muelleri.
Samples were collected from different sites of the Giao Thuy Mangrove Forest.
Microalgae were grown in medium f/2 at room temperature and illuminated with
neon lights (Philips daylight tubes) on 10:14 h light: dark cycles. Chaetoceros
strains were isolated to a unialgal state based on their morphological properties [10].
Pictures were taken under 1000-fold OLYMPUS CX41 microscopy. Total DNA was
extracted thereafter and 18S rDNA-coding region were amplified according to Fawley
and Fawley [3]. PCR products were directly sequenced in an ABM Prism 3100-Avant
Sequencer. The obtained sequences were aligned randomly with sequences on NCBI
database by BLAST tool to get the positive identity.
* Culture conditions of Chaetoceros muelleri.
C. muelleri was cultured in different medias f/2, ASW, ESM, Walne and f/2
without silicon [6] in 150 mL unaerated flasks. Cells were harvested every two days
and counted in a Neubauer haemocytometer in three replicates. Medium providing
best growth of algal cells was chosen for biomass culture of C. muelleri. Effect of
142
Biological properties and biomass culture of the microalgae Chaetoceros muelleri...
salinity to the growth of C. muelleri was also examined with different levels from
00/00 to 400/00 NaCl in ASW medium.
* Determination of fatty acid composition.
Biomass for fatty acid analysis of C. muelleri was obtained from continuously
aerated culture suspensions in 1 litre plastic containers. Cells were harvested at
the early stationery phase by continuous centrifugation at 10,000 rpm, at 40C in
15 min and extracted thereafter with 10 mL of methanol/chloroform (1:1, v/v).
The extracts were concentrated under vacuum to give residues, which were added
4 mL CH3OH-H2SO4 (95:5, v/v) and stirred at 80
0C in 4 hours then water (2.0
mL) was added and extracted with n-hexane [7]. Finally, the n-hexane extracts
were analyzed by gas chromatography (Finnigan Trace GC) using an ultra-column
BPX70. Fatty acids were identified by comparing retention times with those of a
calibration standard solution.
2.2. Results and discussion
* Morphology and taxonomy of the isolated Chaetoceros strain.
A Chaetoceros strain were selected and isolated from the Giao Thuy Mangrove
water based on morphological properties [10] and marked as C2. Cells of this strain
are solitary and hexagonal in girdle view with high mantle. Terminal and intercalary
setae are similar, long, and thick, with short basal part. Setae do not touch each
other, but arise close to the corners and diverge perpendicularly to the colony axis.
Its morphology was shown in Figure 1.
Figure 1. Microscopic morphology
of Chaetoceros muelleri
The sample was subjected to PCR amplification and sequencing analysis of
18S rDNA-coding region, which resulted in a 652bp sequence:
143
Le Thi Phuong Hoa, Nguyen Thi Hoai Ha, Pham Thi Bich Dao and Nguyen Ngoc Tuyen
AAATCCCTTATCGAGGATCAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAAT
TCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAACTCGTAGTTGGATTTG
TGGTGTGACTGATCGGTCCGACCTTTGGTGGGTACTCGATCTTGTCACGCCATCCTT
GAGTGGTTCGCTCTGGCATTAAGTTGTCGGGGCGGCAGCCGCTCATCGTTTACTGTG
AGAAAATGTGTTCAAAGCAGGCTTATGCCGTTGAATATACTAGCATGGAATAATAAGA
TAGGACCTCGGTACTATTTTGTTGGTTTGAGAACCAAGGTAATGATCAATAGGGACA
GTTGGGGGTATTCGTATTCAGTTGTCAGAGGTGAAATTCTTAGATTTACGGAAGACG
AACTACTGCGAAAGCATTTACCAAGGATGTTTTCTAATCAAGAACGAAAGTATGGGG
ATCGATGATTAGATACCATCGTAGTCTATACCATAAACTATGCCGACTCAGGATGGGC
GGGTGCCACTCTGGCCTCGTCTGCACTGTATGAGAAATCAAAGTCTTTGGGTTCCGG
GGGGAGTATGGTCGCAAGGCTGACTTAAAGGAATTGACGGAAGGGCACCACCAGGA
GTGGAACCTGCGGCTTAATTTG
The alignment with sequences on NCBI database suggested this strain be-
longs to the Chaetoceros muelleri species wich is 98% identical to the sequence of
Chaetoceros muelleri strain CCMP1316.
- Phylum: Bacillariophyta
- Class: Coscinodiscophyceae
- Order: Chaetocerotales
- Family: Chaetocerotaceae
- Genus: Chaetoceros
* Selection of culture medium.
The nutritional value of microalgae can vary considerably according to the
cultural conditions [2]. The economic feasibility of algal mass culture for aquaculture
was enhanced by the ability to increase microalgal biomass productivity [8]. In this
study, we tested the microalgae with various media f/2, ASW, ESM, Walne and f/2
without silicon [6]. Cell density was 0.31 cells × 106 mL−1 at the beginning and
determined every two days and the growth rate of C. muelleri was plotted as in
Figure 2.
Figure 2. The growth of Chaetoceros muelleri
in different culture media
The growth rate of C. muelleri started increasing on the fifth day of culture
144
Biological properties and biomass culture of the microalgae Chaetoceros muelleri...
and reached the highest on the 9 - 11th day and decreased remarkably on the 13th
day. C. muelleri grew better in ASW and Walne medium better than in the other
media. Cell density of C. muelleri in ASW medium is highest, 67.22 cells × 06
mL−1 at the 11th day of culture, nearly 2-3 times higher than in ESM, f/2 and f/2
without Si. The growth rate is an important way to express the relative ecological
success of a strain in adapting to its natural or experimental environment [4]. It is
suggested that the ASW medium is the most suitable for the growth of C. muelleri.
This medium can be made without natural sea water, suggesting the potential of
large scale culture of C. muelleri strains.
* Effect of salinities on the growth rate of Chaetoceros muelleri.
Salinity is an environmental factor having significant effects on the growth and
biochemical composition of marine algae as with all other plants [4, 5]. Each species
has its own salinity tolerance. In order to figure out the suitable concentration of
salinity for the growth condition of C. muelleri, seven concentrations of salinity were
applied and the result was shown in Table 1.
Table 1. The growth rate of Chaetoceros muelleri
at different concentrations of salinity
Cell density (cells ×106 mL−1)
Culture
day
0/00 100/00 200/00 250/00 300/00 350/00 400/00
1 1 1 1 1 1 1 1
3 1 3.03 3.16 4.77 3.78 3.17 2.11
5 0.70 7.06 8.24 15.45 10.42 9.72 3.01
7 0.30 18.03 21.30 35.30 28.93 24.50 8.00
9 0 14.10 16.98 27.06 23.71 19.88 4.99
The growth of C. muelleri was completely inhibited at 00/00 of salinity. How-
ever, they were able to grow at 10 - 40 0/00, indicating their tolerance to a wide
range of salinity. The growth rate was highest at 25 0/00 and decreased with the
increasing concentration of salinity. It decreased remarkably at 40 0/00, which was
just 4 - 5 times less than 25 0/00. This was probably due to non adaptability of this
strain to higher salinity, which relates to the decrease in photosynthetic rate involv-
ing the salt stress-induced inactivation of the photosynthetic machinery, especially
the photosystem II [4]. The most suitable concentration of salinity for C. muelleri
is 25 0/00.
* Biomass production of Chaetoceros muelleri.
Microalgae are the basis of the food chain in many aquaculture operations.
Management of microalgal populations is thus considered to be an integral part of
aquaculture [2]. In this study, a scheme for biomass production of the isolated C.
muelleri strain was established and successfully developed. C. muelleri strain was
cultured in ASW medium at room temperature and illuminated under neon light
145
Le Thi Phuong Hoa, Nguyen Thi Hoai Ha, Pham Thi Bich Dao and Nguyen Ngoc Tuyen
(Philips daylight tubes) at 4000 - 5000 Lux on 10:14 h light: dark cycles as the
above scheme.
Stock culture
↓
250 ml conical flask, unaerated
↓
500 ml conical flask, unaerated
↓
2-litre plastic container, aerated continuously
↓ Addition of culture medium
5-litre plastic container, aerated continuously
↓ Addition of culture medium
20-litre plastic container, aerated continuously
↓
Biomass collection
Figure 3. Schematic outline for biomass production of Chaetoceros muelleri
* Fatty acid composition.
Microalgae is a potential resource of fatty acids, particularly polyunsaturated
fatty acids, PUFAs, which are of major importance determining the nutritional value
of microalgae [5, 11, 13]. Fatty acid composition of C. muelleri was characterized
and shown in Table 2.
The distribution of fatty acids in C. muelleri is similar to most diatoms with
high concentration of 16:1n-7 and 20:5n-3, accounting for 58.08% total fatty acids
[13]. However, the content of 16:0 and 14:0 is exceptionally low compared to C.
calcitrans and C. gracilis and other diatoms in previous reports [13] whereas the
content of 14:1n-5 is high. This possibly involved the occurrence of ∆9 desaturation
of 14:0. Two third of fatty acids detected in C. muelleri are unsaturated fatty acids,
which accounted for approximately 76% total fatty acids. PUFAs, most comprised
of C20 PUFA, had significantly high proportion, 36.64% total fatty acids, higher than
in C. calcitrans and C. gracilis [13]. C. calcitrans was reported to have high content
of EPA, a PUFA required in the diet for many marine animals which may not be
able to synthesize the compound sufficiently [1, 7, 13]. In this study, C. muelleri had
significantly high level of EPA, 2 - 4 times higher than C. calcitrans and C. gracilis
[13] and nearly 1.5-2 times higher than C. muelleri grown in agricultural fertilizer
and f/2 medium [9]. C. muelleri also contained remarkable amount of AA (20:4n-6),
higher than previously reported Chaetoceros strains (≤ 6.2% total fatty acids) [9,
13]. EPA and AA are important nutritional factors, which play a vital role in the
synthesis of eicosanoid compounds such as prostaglandins, which are precursors of
146
Biological properties and biomass culture of the microalgae Chaetoceros muelleri...
a number of compounds known as tissue hormones [1]. Animals lack the requisite
enzymes to synthesize PUFAs of more than 18 carbons. Species of microalgae rich in
these PUFAs are generally assumed to be of high nutritional value [7, 11, 12]. Based
on the high proportion of PUFAs including EPA and AA, this strain of C. muelleri
can be grouped to the algae with good food quality in marine ecosystem and can be
used widely as C. calcitrans in aquaculture for bivalve molluscs, crustacean larvae
etc. In the research of Taylor et al., C. muelleri supported the greatest increase in
growth of oyster (Pinctada maxima) spat in single species diet, even better than C.
calcitrans [12].
Table 2. Percentage composition of fatty acids in Chaetoceros muelleri
No Fatty acid Chemical name Common name
Percentage
(% total fatty acids)
1 C 14:0 Tetradecanoic acid Myristic 1.91
2 C 14:1n-5 Tetradecenoic acid Myristoleic 18.09
3 C 15:0 Pentadecanoic acid Convolvulinolic 0.74
4 C 15:1n-5 Pentadecenoic acid Hormelic 0.096
5 C 16:0 Hexadecanoic acid Palmitic 5.53
6 C 16:1n-7 9-Hexadecenoic acid Palmitoleic 15.23
7 C 16:1n-9 7-Hexadecenoic acid Ambrettolic 2.20
8 C 17:0 Heptadecanoic acid Margric 9.52
9 C 18:0 Octadecanoic acid Stearic 1.46
10 C 18:1n-7 11-Octadecenoic acid Asclepic 3.74
11 C 18:2n-6-c 9,12-Octadecadienoic acid Linoleic 2.70
12 C 18: 3n-6
6,9,12-Octadecatrienoic
acid
γ - Linolenic acid
(GLA)
1.12
13 C 18: 4n-3 Octadecatetraenoic acid 0.22
14 C 20:0 Eicosanoic acid Arachidic 1.05
15 C 20:1n-7 13-Eicosaenoic acid Paullinic 0.26
16 C 20:1n-9 11-Eicosaenoic acid Gondoic 0.099
17 C 20:4n-6
5,8,11,14-Eicosatetraenoic
acid
Arachidonic acid
(AA)
7.84
18 C 20:5n-3
5,8,11,14,17-
Eicosapentaenoic acid
Eicosapentaenoic
acid (EPA)
24.76
19 C 24:0 Tetracosanoic acid Lignoceric 0.12
3. Conclusion
Cultured microalgae remain a critical resource for commercial rearing of ma-
rine animals. They provide high-value compounds including long-chain PUFAs,
which animals cannot sufficiently synthesize themselves. Our results confirmed the
potential of a strain of C. muelleri isolated from mangrove to produce a high amount
of valuable long chain PUFAs under specific growth conditions. This makes the
strain interesting for mariculture as a single diet or in a mixed diet. The success
of in-door biomasss production of this strain provides the potential of large-scale
production of this strain for open hatcheries.
147
Le Thi Phuong Hoa, Nguyen Thi Hoai Ha, Pham Thi Bich Dao and Nguyen Ngoc Tuyen
Acknowledgements
This work was supported by Ministry of Education and Training, Vietnam through
Hanoi National University of Education (Project number B2009-17-198).
REFERENCES
[1] P. Bajpai and P. K. Bajpai, 1993. Ecosapentaenoic acid (EPA) production from
microorganisms: a review. Journal of Biotechnology, Vol. 30, pp. 161-183.
[2] P. Coutteau, 1996. Micro-algae, in ”Manual on the production and use of live
food for aquaculture”. Eds. by P. Lavens and P. Sorgeloos, FAO, pp. 7-48.
[3] M. W. Fawley and K. P. Fawley, 2004. A simple and rapid technique for the
isolation of DNA from microalgae. Journal of Phycology, Vol. 40, pp. 223-225.
[4] F. Ghezelbash, T. Farboodma, R. Heidari and N. Agh, 2008. Effects of different
salinities and luminance on growth rate of the green microalgae Tetraselmis chuii.
Research Journal of Biological Sciences, Vol. 3, No. 3, pp. 311-314.
[5] I. A. Guschina, J. L. Harwood, 2006. Lipids and lipid metabolism in eukaryotic
algae. Progress in Lipid Research, Vol. 45, pp. 160-186.
[6] F. Kasai, M. Kawachi, M. Erata, F. Mori, K. Yumoto, M. Sato, and M. Ishi-
moto, 2009. NIES-Collection List of Strains, 8th Edition. National Institute for
Environmental Studies, Japan, pp. 214-229.
[7] L. Krienitz, M. Wirth, 2006. The high content of polyunsaturated fatty acids
in Nannochloropsis limnetica (Eustigmatophyceae) and its implication for food web
interactions, freshwater aquaculture and biotechnology. Limnologica, Vol. 36, pp.
204-210.
[8] A. Muller-Feuga, 2000. The role of microalgae in aquaculture: situation and
trends. Journal of Applied Phycology, Vol. 12(3-5), pp. 527-534.
[9] J. M. Pacheco-Vega and M. D. P. Snchez-Saavedra, 2009. The biochemical compo-
sition of Chaetoceros muelleri (Lemmermann) grown with an agricultural fertilizer.
Journal of the World Aquaculture Society, Vol. 40, No. 4, pp. 556-560.
[10] Akihiko Shirora, 1966. The plankton of south, Vietnam - Fresh Water and
Marine Plankton. Overseas Technical Cooperation Agency Japan.
[11] P. Spolaore, C. Joannis-Cassan, E. Duran and A. Isambert, 2005. Commercial
application of microalgae. Journal of Bioscience and Bioengineering, Vol. 101, pp.
87-96.
[12] J. J. Taylor, P. C. Southgate, M. S. Wing and R. A. Rose, 1997. The nutritional
value of five species of microalgae for spat of the silver - lip pearl oyster, Pinctada
maxima (Jameson)(Mollusca: Pteriidae). Asian Fisheries Science, Vol. 10, pp. 1-8.
[13] J. K. Volkman, S. W. Jeffrey, P. D. Nichols, G. I. Rogers and C. D. Garland,
1989. Fatty acid and lipid composition of 10 species of microalgae used in maricul-
ture. Journal of Experimental Marine Biology and Ecology, Vol. 128, pp. 219-240.
148
Các file đính kèm theo tài liệu này:
biological_properties_and_biomass_culture_of_the_microalgae.pdf