The 542 subjects in this study were recruited randomly from the total samples in the previous
cross-sectional study in Ha Nam province. Thus, the distribution of alleles and genotypes of
KCNJ11-rs5219 can be interpreted for the Kinh group in Ha Nam province. Frequencies of rs5219
genotypes were 43.5% (CC genotype), 43.7% (CT genotype) and 12.8% (TT genotype). And Aminor allele frequency was 34.6% in this group of Vietnamese population. The minor allele
frequency was similar to that in Japan (34%) [5], and higher than that in Arabic group of
population from Tunisia (29%) [13] but lower than that in Mexico (36.7%) [14], China (39%) [15],
and Sweden (40%) [16]. This indicates the specific genetic background of the Vietnamese
population.
Table 2 shows characteristics of anthropometric, glucose and lipid profiles in CC, CT and TT
genotypes of KCNJ11-rs5219 polymorphism in middle-aged Ha Nam people. Results showed that
there was a difference of cholesterol among the three genotypeswhich ranged the highest
concentration in TT genotype (4.6 mmol/L), the CT genotype (4.43 mmol/L), and the lowest
concentration in CC genotype (4.3 mmol/L) (P = 0.041). Besides, LDL-C tended to have
differences between the three genotypes (P = 0.059). No differences were found among CC, CT
and TT genotypes in sex, BMI, waist-hip ratio, fat percentage, systolic blood pressure, diastolic
blood pressure, HDL-C, triglyceride, fasting plasma glucose and 2h-glucose. The KCNJ11-rs5219
polymorphism has been reported to be associated with type-2 diabetes, pre-diabetes, and hypertension in many Caucasian and East Asian populations [2-4, 8]. So, it is necessary to conduct the
study to identify an association of CC, CT and TT genotypes with blood pressure, blood lipids and
glucose in Vietnamese population. The present study found the difference in LDL-C among the
three genotypes with limited size of samples. Thus, this study deserves the primary finding.
8 trang |
Chia sẻ: hachi492 | Lượt xem: 57 | Lượt tải: 0Free
Bạn đang xem nội dung tài liệu Determining KCNJ11 E23K polymorphism in a group of vietnamese population by restriction fragment length polymorphism method, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
JOURNAL OF SCIENCE OF HNUE DOI: 10.18173/2354-1059.2016-0071
Natural Sci. 2016, Vol. 61, No. 9, pp. 177-184
This paper is available online at
177
DETERMINING KCNJ11 E23K POLYMORPHISM IN A GROUP
OF VIETNAMESE POPULATION BY RESTRICTION FRAGMENT LENGTH
POLYMORPHISM METHOD
Nguyen Thi Trung Thu
1
and Tran Quang Binh
2
1Faculty of Biology, Hanoi National University of Education, Vietnam
2
National Institute of Hygiene and Epidemiology, Vietnam
Abstract. The potassium inwardly rectifying channel, sub-family J, member 11 (KCNJ11),
which is a pore-forming sub-unit of ATP sensitive potassium channels in pancreatic β-cells,
plays a critical role in the regulation of insulin secretion. A non-synonymous E23K variant
(SNP rs5219) in the KCNJ11 gene, which results from C to T transition and substitutes
glutamate for lysine at position 23, is identified as a SNP associated with prediabetes and
type 2 diabetes. The study aimed to apply the restriction fragment length polymorphism
(RFLP) method to identify the KCNJ11 E23K polymorphism in Vietnamese population. The
forward and reverse primers for PCR were 5’-GACTCTGCAGTGAGGCCCTA-3’ and 5’-
ACGTTGCAGTTGCCTTTCTT-3’, respectively. The BanII restriction enzyme was selected
to incubate PCR products and distinguish the C or T allele after electrophoresis in 3%
agarose gel or 12% polyacrylamide gel. The frequency of T minor allele of 542 random
subjects from the Vietnamese population was 34.6%. The genotype distribution was in
Hardy-Weinberg equilibrium. Among CC, CT and TT genotypes, there were a significant
difference in cholesterol (P = 0.041) and a trend of difference in LDL-C (P = 0.059). The
RFLP-PCR is very useful method to identify the KCNJ11 E23K polymorphism in a
numerous groups of Vietnamese population.
Keywords: KCNJ11 E23K, genotyping, restriction fragment length polymorphism, Vietnamese.
1. Introduction
Glucose metabolism stimulates insulin secretion from pancreatic beta cells by closing KATP
channels, thereby inducing beta cell depolarization, calcium influx, and insulin exocytosis [1]
conversely, opening of KATP channels which prevents insulin secretion by causing beta cell
hyper-polarization. The potassium inwardly rectifying channel, sub-family J, member 11
(KCNJ11) is a pore-forming sub-unit of ATP sensitive potassium (KATP) channels in pancreatic
β-cells [2]. The KATP channels which consist of four sub-units of the inwardly-rectifying
potassium channel Kir6.2, and four sub-units of the sulfonylurea receptor 1 (SUR1), play a critical
role in the regulation of insulin secretion. Variations of KCNJ11 can contribute to the decreasing
sensitivity of the ion channel to ATP, leading to more ATP consumption, which further
Received March 19, 2016. Accepted November 25, 2016.
Contact Nguyen Thi Trung Thu, e-mail address: trungthuhnue@gmail.com
Nguyen Thi Trung Thu and Tran Quang Binh
178
contributes to insulin-release impairment and causes hyperinsulinemia. KCNJ11 gene was proven
to have an association with hypertension, obesity, dyslipidemia, and glucose intolerance [3].
A non-synonymous E23K variant (E23K) in the KCNJ11 gene, which results from a C to T
transition and substitutes glutamate for lysine at position 23, is identified as a SNP associated with
pre-diabetes and type-2 diabetes [4]. Frequency of genotypes and allele are different from each
ethnic group. Several methods are used to genotype rs5219 polymorphism in populations: PCR-
SSCP [5]. TaqmanPCR [6], Mass ARRAY [7], PCR-RFLP [8]. The polymerase-chain reaction–
restriction fragment-length polymorphism, a popular technique for genotyping, is based on the
principle that DNA product resulted from polymerase-chain reaction is broken into pieces
digested by restriction enzymes, and the resulting restriction fragments are separated according to
their lengths by gel electrophoresis [9]. Despite the fact that it is less widely-used now, the PCR-
RFLP method has several advantages including low costs and a requirement of basic molecular
equipment. It is a suitable method for genotyping rs5219 polymorphism in Vietnam. Thus, the
study aimed to apply the PCR-RFLP method to determine KCNJ11 rs5219 polymorphism in
Vietnamese population.
2. Content
2.1. Materials and methods
* Samples
From 2710 subjects in the previous cross-sectional study in Ha Nam province (2011) [10],
we selected 542 subjects (20%) recruited randomly from the total samples. This study was
conducted with the approval of the Ethics Committee of the National Institute of Hygiene and
Epidemiology, Vietnam, and a writtenly-informed consent was obtained from all study subjects.
Genomic DNA was extracted from 300µL peripheral blood leukocytes, using Wizard® Genomic
DNA Purification Kit (Promega Corporation, USA). Purity and concentration of DNA were
measured by Nano Drop device.
* Amplification of KCNJ11 rs5219 sequences
The RFLP-PCR is a technique that exploits variations in homologous DNA sequences. This
technique involves fragmenting sample of DNA by a restriction enzyme, which can recognize and
cut DNA at a particular sequence, in a process known as a restriction enzyme digestion. The
rs5219 polymorphism was genotyped by PCR on genomic DNA with the forward and reverse
primers according to Nielsen et al. (2003) [8]. The forward and reverse primers were 5’-
GACTCTGCAGTGAGGCCCTA - 3’ and 5’ - ACGTTGCAGTTGCCTTTCTT - 3’, respectively.
PCR amplification was carried out in a volume of 12 µL containing 2 µL nuclease-free water, 2 µL
primers (10 pmol each primer), 2 µL genomic DNA and 6 µL GoTaq® Green PCR master mix 2
X (GoTaq® DNA Polymerase is supplied in 2X Green GoTaq® Reaction Buffer (pH 8.5), 400
µM dATP, 400 µM dGTP, 400 µM dCTP, 400 µM dTTP and 3 mM MgCl2 (Promega Corporation,
USA). The thermal cycling was a denaturing step at 94
o
C for 3 min followed by 32 cycles of
94
o
C for 30 s, annealing at 56 or 58 or 60 or 62
o
C for 30 s, and elongation at 72
o
C for 30s, with
a final elongation step at 72
o
C for 10 min, using an Eppendorf’s Master cycler. Five µL PCR
products containing 210 bp bands were stained with RedSafe and electrophoresis on 3% agarose
Determining KCNJ11 E23K polymorphism in a group of vietnamese population by restriction fragment
179
gel for 30 min at 100 v in 0.5 X TBE buffer, with ΦX174 DNA HaeIII Digest ladder. The DNA
bands were detected using Geldoc-It
TM
gel camera.
* Digestion of PCR product by BanII enzyme
The BanII restriction enzyme was selected (New England Bio-labs, Beverly, MA) to digest
PCR product, using restriction mapper database [11]. According to manufacturers’ guidelines, the
components of a total 15 µL volume per restriction enzyme incubated reaction included 8.3 µL
nuclear-free water, 1.5 µL 10 X CutSmart 10 X digest buffer, 0.2 µL fast digest BanII (NEB), and
5.0 µL PCR product. The mixed solution was incubated at 37
o
C for 2 hours. Alleles were
visualized as fragments by electrophoresis through stained with RedSafe on 3% agarose gel for 30
min at 100v in 0.5 X TBE buffer or 12% polyacrylamide gel for 2 hours. Distribution patterns of
the rs5219 polymorphism were AA (2 bands: 178 bp and 32 bp), AG (4 bands: 178 bp, 150 bp, 32
bp and 28 bp), and GG (3 bands: 150 bp, 32 bp and 28 bp).
* Determination of KCNJ11 rs5219 polymorphism
The representative 542 subjects were genotyped to determine rates of genotype and allele of
KCNJ11-rs5219 polymorphism. Genotype frequencies were compared and tested for Hardy-
Weinberg Equilibrium (HWE) by chi-square test. Characteristics of anthropometric, glucose and
lipid profiles among the three rs5219 genotypes were compared in middle-aged Ha Nam people.
2.2. Results and discussion
2.2.1. Selection appropriate protocol for polymerase chain reaction
According to recommendations, the melting temperature of the primer was approximately
60
o
C [12]. Therefore, to select the appropriate annealing temperature (Ta) for PCR, we
conducted a test with 3 samples and a negative control (H2O) at 4 following annealing
temperatures: 56
o
C, 58
o
C,
60
o
C, and 62
o
C. The result is shown in Figure 1.
Figure 1. Electrophoresis result of 210 bp products by PCR at 4 annealing temperatures
Lanes 1 - 3: at 56 °C; lanes 5 - 7: at 58 °C; lanes 9 - 11: at 60 °C; lanes 14 - 16: at 62 °C;
lanes 4, 8, 12, 17: negative control (H2O); lane 13: phiX174 DNA/BsuRI (HaeIII) Marker
Among 4 annealing temperatures, the bands of PCR product visualizeded the thickest at
Ta = 62 °C. So we selected the Ta = 62
o
C for further experiments. The thermal cycling was a
denaturing step at 94
o
C for 3 min followed by 32 cycles of 94
o
C for 30 s, annealing at 62
o
C for
Nguyen Thi Trung Thu and Tran Quang Binh
180
30 s, and elongation at 72
o
C for 30 s, with a final elongation step at 72
o
C for 10 min, stopped by
chilling at 15
o
C.
The forward and reverse primers to determine this polymorphism were used in this research
according Nielsen et al. (2003) [8]. However, in the cycling program, the annealing temperature
was 60 °C for 30s. In Hansen’s research, the reverse primer was the same, yet, the forward one
was different with 5’- CGAGGAATACGTGCTGACAC-3’ and the annealing temperature in PCR
was 62
o
C for 45 sec [13]. Based on the experimental result, we agreed that the appropriate
annealing temperature was 62
o
C for 30 sec.
2.2.2. Selection of appropriate gel to determine distribution patterns
We used BanII to digest the amplified PCR products to determine genotypes of samples
because BanII enzyme cut the sites:
According to the manufacturer’s advice, we conducted an experiment using 0.2 L/reaction
of BanII. While using 3% agarose gel to identify bands’ length, the position of the bands was not
appeared to be in lines of 178-bp band or 150-bp band (Figure 2a). Thus, we checked the digested
products using electrophoresis in 12% polyacrylamide gel. As a result, the PCR products were
digested completely and the position of the digested products was seen in appropriate lines as
compared to the standard ladder (Figure 2b).
A. 3% agarose gel B. 12% polyacrylamide gel
Figure 2. Electrophoresis result PCR products before and after digestion
by 0.2 L/reaction of BanII enzyme
M: phiX174 DNA/BsuRI (HaeIII) Marker, Sample 1 - 3: sample No 1 - 3 incubated with 0.2 µL of
BanII enzyme, PCR product before incubated with 0.2 µL of BanII enzyme.
AG (178 bp and 150 bp), GG (150 bp), AA (178 bp)
All products of both reference studies used BanII (New England Bio-labs, Beverly, MA) at
37
o
C to digest and the resulting DNA digestion fragments were resolved on 3% agarose gel [8, 13].
In our experiment, when using 3% agarose gel according Nielsen et al. (2003) [8] to identify the
length of bands, the position of the bands was not appeared to be in lines of 178bp band or 150bp
band. Instead, we used electrophoresis in 12% polyacrylamide gel, the position of the digested
products was seen in appropriate lines as compared to the standard ladder. It was also confirmed
by the DNA sequencing analysis. This shows that the KCNJ11-rs5219 genotypes obtained by
Determining KCNJ11 E23K polymorphism in a group of vietnamese population by restriction fragment
181
using 3% agarose gel are similar to those by using 12% polyacrylamide gel. Thus, it is
recommended that using 3% agarose gel is believable and convenient to identify the genotypes in
large samples.
2.2.3. Genotype and allele frequencies, and characteristics of prediabetes related traits in
genotypes of rs5219 gen KCNJ11 in middle-aged Ha Nam people
Results of genotype and allele frequencies of rs5219 polymorphism in the representative 275
samples (10%) are shown in table 1. Frequencies of GG, AG, AA genotypes were 52.7, 36.7 and
10.5%, respectively, and frequencies of G and A allele were 71.1 and 28.9%, respectively.
Genotype frequencies in this population were in Hardy–Weinberg equilibrium (P > 0.05).
Table 1. Genotypes and allele frequencies rs5219 polymorphism
Genotype Allele
P value for Hardy-
Weinberg Equilibrium
CC CT TT C T
Number 232 233 68 697 369
0.428 Percentage
(%)
43.5 43.7 12.8
65.4
%
34.6%
The 542 subjects in this study were recruited randomly from the total samples in the previous
cross-sectional study in Ha Nam province. Thus, the distribution of alleles and genotypes of
KCNJ11-rs5219 can be interpreted for the Kinh group in Ha Nam province. Frequencies of rs5219
genotypes were 43.5% (CC genotype), 43.7% (CT genotype) and 12.8% (TT genotype). And A-
minor allele frequency was 34.6% in this group of Vietnamese population. The minor allele
frequency was similar to that in Japan (34%) [5], and higher than that in Arabic group of
population from Tunisia (29%) [13] but lower than that in Mexico (36.7%) [14], China (39%) [15],
and Sweden (40%) [16]. This indicates the specific genetic background of the Vietnamese
population.
Table 2 shows characteristics of anthropometric, glucose and lipid profiles in CC, CT and TT
genotypes of KCNJ11-rs5219 polymorphism in middle-aged Ha Nam people. Results showed that
there was a difference of cholesterol among the three genotypeswhich ranged the highest
concentration in TT genotype (4.6 mmol/L), the CT genotype (4.43 mmol/L), and the lowest
concentration in CC genotype (4.3 mmol/L) (P = 0.041). Besides, LDL-C tended to have
differences between the three genotypes (P = 0.059). No differences were found among CC, CT
and TT genotypes in sex, BMI, waist-hip ratio, fat percentage, systolic blood pressure, diastolic
blood pressure, HDL-C, triglyceride, fasting plasma glucose and 2h-glucose. The KCNJ11-rs5219
polymorphism has been reported to be associated with type-2 diabetes, pre-diabetes, and hyper-
tension in many Caucasian and East Asian populations [2-4, 8]. So, it is necessary to conduct the
study to identify an association of CC, CT and TT genotypes with blood pressure, blood lipids and
glucose in Vietnamese population. The present study found the difference in LDL-C among the
three genotypes with limited size of samples. Thus, this study deserves the primary finding.
Nguyen Thi Trung Thu and Tran Quang Binh
182
Besides, it is important to carry out further analyses on the association between the KCNJ11-
rs5219 polymorphism and chronic diseases in Vietnamese population.
Table 2. Characteristics of several traits in genotypes of rs5219 gen KCNJ11
in middle-aged Ha Nam people
Characteristic CC CT TT P
Female n (%) 155 (66.8%) 155 (66.5%) 49 (72.1%) 0.674
BMI (type of gene/m
2
)
Waist hip ratio (cm)
21.3 ± 2.5
0.84 ± 0.05
21.5 ± 2.7
0.84 ± 0.7
21.8 ± 3.0
0.85 ± 0.06
0.49
a
0.61
a
Fat percentage (%) 26.9 ± 6.5 27.2 ± 6.4 28.0 ± 7.0 0.48
a
Maximum blood
pressure (mmHg)
110.5 (100 - 130) 115 (100 - 130) 120 (110 - 130) 0.436
b
Minimum blood
pressure (mmHg)
70 (60 - 80) 70 (60 - 80) 70 (60 - 800 0.874
b
HDL-C (mmol/L) 1.19 (0.97 - 1.60) 1.2 (0.97 - 1.61) 1.12 (0.96 - 1.40) 0.222
b
LDL-C (mmol/ L) 2.80 ± 0.79 2.96 ± 0.9 3.05 ± 0.91 0.059
a
Triglyceride (mmol/ L) 1.25 (1.0 - 1.91) 1.42 (1.0 - 1.91) 1.70 (1.02 - 2.28) 0.201
b
Cholesterol (mmol/ L) 4.30 ± 0.79 4.43 ± 0.85 4.60 ± 0.95 0.041
a
Fasting plasma glucose
(mmol/ L)
4.5 (4.1 - 5.2) 4.6 (4.2 - 5.0) 4.35 (4.0 - 5.0) 0.072
b
2h-Glucose (mmol/ L) 5.3 (4.63 - 6.18) 5.2 (4.75 - 6.30) 5.5 (4.6 - 6.0) 0.787
b
Note. 2h-Glucose: glucose concentration after 2 hours using oral glucose tolerance test
a
Variables are expressed by mean ± standard deviation, P are received from ANOVA test
b
Variables are expressed by median (25
th - 7th percentile);
P are received from Kruskal-Wallis H test
3. Conclusion
The study has reported the designed protocol for genotyping KCNJ11-rs5219 polymorphism
using the PCR-RFLP method in Vietnamese samples. The forward and reverse primers were
5’-GACTCTGCAGTGAGGCCCTA-3’ and 5’-ACGTTGCAGTTGCCTTTCTT- 3’, respectively.
The standard protocol included four steps: 1) using PCR with annealing at 62
o
C to amplify the
KCNJ11 gene region containing SNP rs5219; 2) incubating PCR products with BanII restriction
enzyme; 3) using 3% polyacrylamide gel to determine digested products; and 4) identifying
genotypes of KCNJ11 rs5219 based on electrophoresis fragments. Frequencies of T minor allele
of 542 random subjects from the Vietnamese population were 34.6%. There was a difference in
cholesterol among three genotypes (P = 0.041), and LDL-C tended to have differences between
three genotypes (P = 0.059). To conclude, the PCR-RFLP method is very useful for laboratories
to identify the KCNJ11-rs5219 polymorphism in large groups of population in Vietnam.
Determining KCNJ11 E23K polymorphism in a group of vietnamese population by restriction fragment
183
Acknowledgements. The authors would like to thank Ms.Pham Thi Tuoi, Ms.Phan Phuong
Nga, Ms.Ngo Thi Oanh, Ms.Pham Thu Trang, Ms.Dinh Thi Xuan at Hanoi National University of
Education and colleagues at the National Institute of Nutrition for their kind help and support.
Moreover, This study was also supported by Vietnam's National Foundation for Science and
Technology Development (NAFOSTED) undergrant No. 106-YS.01-2015.10 of the Ministry of
Science and Technology of Vietnam.
REFERENCES
[1] F. M. Ashcroft, 2012. ATP-sensitive K+ channels and disease: from molecule to malady.
Am J Physiol Endocrinol Metab, 293, pp. E880-E889.
[2] Q. Li, M. Chen, R. Zhang, F. Jiang, J. Wang, J. Zhou, Y. Bao, C. Hu, W. Jia, 2014.
KCNJ11 E23K variant is associated with therapeutic effect of sulfonylureas in Chinese type
2 diabetic patients. Clin Exp Pharmacol Physiol, 41, No. 10, pp. 748-754.
[3] N. J. Liu, H. H. Wu, Y. L. Li, Z. Yang, Z. Tao, Y. Du, X Wang, B. Lu, Z. Zhang, R. Hu, J.
Wen, 2015. An analysis of the association between a polymorphism of KCNJ11 and
diabetic retinopathy in a Chinese Han population. European Journal of Medical Research,
20, No. 1, pp. 3-9.
[4] A. L. Gloyn, M.N. Weedon, K. R. Owen, M. Turner, B. A. Knight, G. Hitman, M. Walker,
J.C. Levy, M. Sampson, S. Halford, M.I. McCarthy, A.T. Hattersley, T.M. Frayling, 2003.
Large-scale association studies of variants in genes encoding the pancreatic beta-cell
KATP channel subunits Kir6.2 (KCNJ11) and SUR1 (ABCC8) confirm that the KCNJ11
E23K variant is associated with type 2 diabetes. Diabetes, 52, No 2, pp. 568–572.
[5] Y. Yamada, A. Kuroe, Q. Li, Y. Someya, A. Kubota, Y. Ihara, Y. Tssuura, Y. Seino, 2001.
Genomic variation in pancreatic ion channel genes in Japanese type 2 diabetic patients.
Diabetes Metab Res Rev, 17, No. 3, pp. 213-216.
[6] M. N. Weedon, M. I. McCarthy, G. Hitman, M. Walker, C.J. Groves, E. Zeggini, N. W.
Rayner, B. Shields, K.R. Owen, A.T. Hattersley, T.M. Frayling, 2006. Combining
information from common type 2 diabetes risk polymorphisms improves disease prediction.
PLoS Medicine, 3, pp. e374-379.
[7] C. Hu, R. Zhang, C. Wang, J. Wang, X. Ma, J. Lu, W Qin, X. Hou, C. Wang, Y. Bao, K.
Xiang, W. Jia, 2009. PPARG, KCNJ11, CDKAL1, CDKN2A-CDKN2B, IDE-KIF11-HHEX,
IGF2BP2 and SLC30A8 are associated with type 2 diabetes in a Chinese population. PLoS
One, 4, pp. e7643.
[8] E. M. Nielsen, L. Hansen, B. Carstensen, S. M. Echwald, T. Drivsholm, C. Glumer, B.
Thorsteinsson, K. Borch-Johnsen, T. Hansen, O. Pedersen, 2003. The E23K Variant of
Kir6.2 Associates With Impaired Post–OGTT Serum Insulin Response and Increased Risk
of Type 2 Diabetes. Diabetes, 52, No. 2, pp. 573-577.
[9] Search 2015/10/10.
Nguyen Thi Trung Thu and Tran Quang Binh
184
[10] Tran Quang Binh, Pham Tran Phuong, Bui Thi Nhung, Duong Dinh Thoang, Pham Van
Thang, Duong Van Thanh, 2012. Prevalence and correlates of hyperglycemia in a rural
population, Vietnam: implications from a cross-sectional study. BMC Public Health, 12, pp.
939-948.
[11] Search 2015/10/10.
[12] Search 2015/10/10.
[13] S. K. Hansen, E. D. Nielsen, J Ek, G. Andersen, C, Glumer, B. Catstensen, P. Mouritzen, T.
Drivsholm, K Borch-Johnsen, T. Jorgensen, T. Hansen, O. Pedersen, 2005. Analysis of
separate and combined effects of common variation in KCNJ11 and PPARG on risk of type
2 diabetes. The Journal of clinical endocrinology and Metabolism, 90, No. 6, pp. 3629-3637.
[14] I. Ezzidi, N. Mtiraoui, S. Cauchi, E. Vaillant, A. Dechaume, M. Chaieb, M. Kacem, W. Y.
Almawi, P Froguel, T. Mahjoub, M. Vaxillaire, 2009. Contribution of type 2 diabetes
associated loci in the Arabic population from Tunisia: a case-control study. BMC Med
Genet, 10, pp. 33-39.
[15] V. M. Hernandez-Escalante, E. J. Nava-Gonzalez, V. S. Voruganti, J. W. Kent, K, Haack,
H.A. Laviada-Molina, F. Molina-Segui, E.C. Gallegos-Cabriales, J.C. Lopez-Alvarenga,
S.A. Cole, M.J. Mezzles, A.G. Comuzzie, R.A. Bastarrachea, 2014. Replication of obesity
and diabetes-related SNP associations in individuals from Yucatán, México. Frontiers in
Genetics, 5, pp. 380-385.
[16] D. Zhou, D. Zhang, Y. Liu, T. Zhao, Z. Chen, Z. Liu, L. Yu, Z. Zhang, H. Xu, L. He, 2009.
The E23K variation in the KCNJ11 gene is associated with type 2 diabetes in Chinese and
East Asian population. J. Hum. Genet., 54, No. 7, pp. 433-435.
[17] V. Lyssenko, A. Jonsson, P. Almgren, N. Pulizzi, B. Isomaa, T. Tuomi, G. Berglund, D.
Altshuler, P. Nilsson, L. Groop, 2008. Clinical risk factors, DNA variants, and the
development of type 2 diabetes. The New England of Journal Medicine, 359, No. 21, pp.
2220-2232.
Các file đính kèm theo tài liệu này:
determining_kcnj11_e23k_polymorphism_in_a_group_of_vietnames.pdf