Inducer-free production of GFP from plasmid
pHT1692 with the Pspac promoter in B. subtilis
The target protein using an inducer-free expression
system is continuously expressed in the B. subtilis host
strain without inducer. Therefore, protein overexpression
under strong promoter systems might cause a change of the
protein’s structure, resulting in inactivation of the protein’s
function [12]. Basic research has shown that it is important
to use an inducer-free vector to allow the target heterologous
protein to be produced continuously at low levels. To
reconfirm the potential application of inducer-free plasmids
based on the Pspac promoter, the expression of another
target protein was also investigated. For this study, the autoinducible plasmid pHT1692 was created by engineering the
origin of the inducer-free plasmid pHT1675 (Pgrac100-
gfp, ∆lacI, lacO1-lacO3 406 bp) [9]. First, the Pspac gene
was received from the basic plasmid pHCMC05 by using
PCR with the primer pair ON1512/ON1249. Next, the PCR
products were treated with KpnI/BamHI enzymes while the
origin plasmid pHT1675 was treated with KpnI/BamHI and
alkaline phosphatase to remove the Pgrac100 promoter.
Then, the enzymatic products were ligated by T4 DNA
ligase, resulting in the pHT1692 vector consisting of a Pspac
promoter. The activity of GFP produced by the B. subtilis
strain with an inducer-free vector based on Pspac promoter
pHT1692 was evaluated by fluorescent spectrometry (plate
reader). B. subtilis with pHCMC05, a similar expression
system without gfp+ gene, was used as a negative control.
The B. subtilis strain containing the inducible expression
plasmid based on the Pspac promoter pHT1535 was also
tested for comparison. The GFP expression of these B.
subtilis strains is shown in Fig. 4.
7 trang |
Chia sẻ: hachi492 | Lượt xem: 52 | Lượt tải: 0Free
Bạn đang xem nội dung tài liệu Development of inducer-Free expression plasmids using IPTG-inducible Pspac promoter for Bacillus subtilis, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Life ScienceS | Biotechnology
Vietnam Journal of Science,
Technology and Engineering64 march 2021 • Volume 63 Number 1
Introduction
B. subtilis is an important host for the production of
heterologous proteins because of its advantages such
as easy handling, safe, non-pathogenic, endotoxin-free,
effective protein secretion mechanisms, and industrial
fermentation. Besides, B. subtilis is a model organism for
studying Gram-positive bacteria and the biological systems
of cellular differentiation, stress responses, and multicellular
organization [1, 2]. Thus, scientists have paid more attention
to its expression systems for industrial applications and
basic research [3].
Fundamental research has shown it is essential to have a
weak promoter that can be controlled to express low levels
of recombinant proteins within the cells. IPTG-inducible
Pspac, a well-characterized hybrid promoter, is composed
of the B. subtilis phage SPO-1 promoter and the E. coli lac
operator, which leads to transcription activation for low
levels of gene expression. The Pspac promoter allows low-
expression levels of reporter expression [4, 5], which is
approximately 50 times weaker than the Pgrac promoter.
Many plasmids containing the IPTG-inducible Pspac
promoter, such as pHCMC05, pAL01, and the improved
plasmid pHT2002 [6], are suitable to express a modest
amount of the heterologous protein in the induction of
IPTG in B. subtilis. One example of requiring low protein
expression level is sortase, which is a membrane-associated
protein needed for anchoring recombinant proteins to the
cell wall. Low levels of sortase are necessary to avoid
membrane clogging [7]. The weak promoter Pspac is also
an appropriate choice when the recombinant protein, or a
protein of interest in any pathway, is harmless to the host
cells after overproduction.
Induction of protein expression is stimulated by the
addition of the inducer IPTG, a non-metabolizable analogue
Development of inducer-free expression plasmids
using IPTG-inducible Pspac promoter
for Bacillus subtilis
Phuong Thi Bich Chu1, 2, 3, 4, Hanh Thi Thu Phan1, 2, Hoang Duc Nguyen1, 2, 4*, Trang Thi Phuong Phan1, 2, 5*
1Center for Bioscience and Biotechnology, University of Science, Vietnam National University, Ho Chi Minh city, Vietnam
2Vietnam National University, Ho Chi Minh city, Vietnam
3Faculty of Pharmacy, Ho Chi Minh city University of Technology (HUTECH), Vietnam
4Department of Microbiology, University of Science, Vietnam National University, Ho Chi Minh city, Vietnam
5Laboratory of Molecular Biotechnology, University of Science, Vietnam National University, Ho Chi Minh city, Vietnam
Received 1 December 2019; accepted 3 March 2020
*Corresponding authors: Email: ptptrang@hcmus.edu.vn; ndhoang@hcmus.edu.vn
Abstract:
An inducer-free expression vector for the low
expression levels in Bacillus subtilis (B. subtilis) is
necessary for fundamental research. In this study, we
constructed inducer-free expression plasmids carrying
Pspac, a well-known IPTG-inducible promoter, by
removing a part of the lacI gene. Then, we analysed
the expression of the target genes bgaB and gfp+ in B.
subtilis. Western blot experiments demonstrated that
the reporters from the inducer-free plasmids with
Pspac could be produced at low levels in B. subtilis
strains and were equivalent to their corresponding
inducible constructs with 1 mM IPTG. The reporter
activities showed that inducer-free expression from
the Pspac promoter was dramatically less than that of
the inducer-free plasmids with the strong promoters
Pgrac01 and Pgrac100 reported previously, about 16.2
to 20.3 times for BgaB and 24.7 to 34.3 times for GFP+,
respectively. In conclusion, the inducer-free expression
vectors carrying Pspac promoters allow the constitutive
expression of heterologous recombinant proteins at low
levels in B. subtilis.
Keywords: Bacillus subtilis, inducer-free, pHT vector,
Pspac, weak promoter.
Classification number: 3.5
DOI: 10.31276/VJSTE.63(1).64-70
Life ScienceS | Biotechnology
Vietnam Journal of Science,
Technology and Engineering 65march 2021 • Volume 63 Number 1
of allolactose. After induction, the RNA polymerase
enzyme specially transcribes the coding sequence of the
protein of interest present in the expression plasmid under
the control of the promoter. IPTG is very useful to control
gene expression in many microorganisms. However,
IPTG has several limitations: (i) it requires cell culture
monitoring to ensure that IPTG is added at the appropriate
time. Because the induction point varies significantly from
one recombinant protein to another, the process becomes
challenging to manipulate, particularly when several proteins
are expressed in parallel (e.g., for a screening study) and (ii)
it presents toxicity limitations that affect cell viability [8].
Therefore, inducers are sometimes not necessary for low
and continuous protein expression in the cell.
Some auto-inducible and constitutive expression
vectors were constructed such that heterologous proteins
can be expressed in B. subtilis during continuous culture
without adding the inducer. In the last few years, inducer-
free expression systems were developed by deleting a part
of or the entire lacI gene in the vector carrying the IPTG-
inducible promoters, Pgrac01, Pgrac57, and Pgrac100 [9,
10]. These strong inducer-free expression vectors have
shown a prospective yield of recombinant proteins for
industrial and medical applications. However, an inducer-
free expression vector system based on a weak promoter
controlling the expression of heterologous proteins at low
levels has not yet been studied. In this work, inducer-free
expression plasmids were developed by deleting the lacI
gene on plasmids carrying the Pspac promoter, which
allows the system to express proteins of interest without
using any inducers. Two widespread reporter genes, bgaB
and gfp+, were used to investigate the expression levels of
these vectors.
Materials and methods
Strains, plasmids and growth conditions
Escherichia coli OmniMAXTM was used as the host
for gene cloning and B. subtilis 1012 was used for gene
expression and integration. The final concentrations of
antibiotics were as follows, in mg/l: ampicillin (Amp), 100
for E. coli; and chloramphenicol (Cm), 10 for B. subtilis.
The strains were cultivated in Luria-Bertani (LB) medium
consisting of 1% tryptone, 0.5% yeast extract, and 0.5%
NaCl. Strains were cultivated at 37°C in shaking flasks at
200 rpm. The cell density was determined by measuring the
OD600 with an S-20 spectrophotometer (Boeco, Germany).
Table 1 shows a list of the plasmids and oligonucleotides
used in this study.
Table 1. bacterial strains, plasmids and oligonucleotides used in this study.
Bacterial strains Genotype Source/references
E. coli OmniMAX F′ {proAB lacI
q lacZ∆M15 Tn10(TetR) ∆(ccdAB)} mcrA ∆(mrr hsdRMS-mcrBC) Φ 80(lacZ)∆M15
∆(lacZYA-argF)U16 9 endA1 recA1 supE44 thi-1 gyrA96 relA1 tonA panD; used for cloning Invitrogen
B. subtilis 1012 leuA8 metB5 trpC2 hsrM1 Mobitec
Plasmids Description Source/references
pHCMC05 Pspac promoter, no reporter gene, negative control [4]
pHCMC05-bgaB Pspac-bgaB, inducible, used to construct pHT1672 [4]
pHT1675 Pgrac100-gfp, ∆lacI, lacO1-lacO3 406 bp; used to construct pHT1692 This study
pHT2002 Pspac-bgaB, inducible [6]
pHT1535 Pspac-gfp+, inducible plasmid This study
pHT1692 Pspac-gfp+, ∆lacI 406 bp This study
pHT1672 Pspac-bgaB, ∆lacI 787 bp This study
Oligonucleotide Sequence 5’ → 3’ Used for
ON1896 CGGTTCGATCTTGCTCCAACTG pHT 1672, plasmid sequencing
ON925 GAATTAGCTTGGTACCAAAGGAGGTAAGGATCACTAG pHT1672, screening E. coli
coloniesON1278 GGCCATGACGTCTTTGTAAAGCTCATCCATGCCATGTGT
ON780 CCCGCGGTCAGCTAGCCTAAACCTTCCCGGCTTCATCATGCTC pHT1672, screening B.
subtilis coloniesON779 AAAGGAGGAAAGATCTATGAATGTGTTATCCTCAATTTGTTAC
ON1512 ATCTCCATGGACGCGTGACG pHCMC05, receiving Pspac
promoterON1249 CGTTTCCACCGGAATTAGCTTG
ON926B
ON1273
GACGTCGACTCTAGACATGGATCCTTCCTCCTTTATATGG
CCCGGTACCCACTTCCTAGAATATATATTATGTAAACAAAGGAGGTA
AGGATCACTAG
pHT1692, screening E. coli
colonies
ON1280 GGCCATGACGTCTTATTTGTAAAGCTCATCCATGCCATGTGT pHT1692, screening B.
subtilis coloniesON867B GTGAAGGTGATGCTACAAACGGAAAGCTTACCCTTAAA
Life ScienceS | Biotechnology
Vietnam Journal of Science,
Technology and Engineering66 march 2021 • Volume 63 Number 1
Materials
Taq DNA polymerase and enzymes, including SnaBI,
ApaI, T4 DNA ligase, KpnI, BamHI, Alkaline phosphatase,
and Klenow, were supplied by Thermo Scientific. PCR kit,
cloning kit, and basic materials for molecular biology were
supplied by Qiagen, Thermo Scientific, Sigma-Aldrich,
Merck-Millipore, and BioBasic. The plasmid pHCMC05-
bgaB, and the plasmid pHT1675 were used as the origin
plasmids to create the inducer-free plasmids. The plasmid
pHCMC05 without the bgaB or gfp+ gene was used as a
negative control. All primers for PCR were described in
Table 1.
Construction of the inducer-free expression plasmid
based on the Pspac promoter
The plasmid pHCMC05-bgaB [4], a popular IPTG-
inducible plasmid based on the Pspac promoter, was
engineered by removing 787 bp from the lacI gene to
generate the auto-inducible plasmid pHT1672 (Fig. 1A).
First, the plasmid pHCMC05-bgaB was treated by the
restriction enzymes SnaBI and ApaI, in which ApaI created
sticky end products while SnaBI created blunt end products.
Second, the sticky ends were deleted by the Klenow
Fragment to optimize the ligation reaction. Then, the ligation
reaction of these products was carried out by T4 ligase and
subsequently transformed into E. coli. The transformants
were analysed by colony PCR using restriction analysis.
Finally, the gene sequence of pHT1672 was confirmed by
an improved Sanger method using an ON1896 primer on a
Big DyeTM terminator (Macrogen - Korea). The structure of
the pHT1672 plasmid is shown in Fig. 1B.
Transformation of recombinant plasmids into B.
subtilis 1012 competent cells
The procedure for the transformation of recombinant
plasmids into B. subtilis 1012 competent cells was carried
out as described elsewhere [11]. First, the B. subtilis 1012
competent cells were shaken in 50-ml flasks containing 10
ml of LS medium at 50 rpm in a 30oC-shaking incubator
for 2 h. Then, 100 µl of 0.1 M ethylene glycol tetraacetic
acid (EGTA) was added into the prepared 50-ml flask with
B. subtilis competent cells and this flask was kept at room
temperature (25oC) for 10 min. After that, 1 ml of B. subtilis
competent cells was removed and transferred into a 1.5-
ml tube containing the recombinant plasmid. Next, this
tube was shaken at 200 rpm in 37oC for 2 h before being
centrifuged at 7000 rpm for 5 min to receive the recombinant
cells. The cells were resuspended in the left supernatant and
spread on LB agar plates containing 10 µg/ml Cm and 40
µg/ml 5-Bromo-4-chloro-3-indolyl-β-D-galactopyranoside
(X-gal). The plates were incubated at 37oC overnight. Then,
B. subtilis colonies were screened using ON780/ON779
primers by colony PCR. Finally, the LB liquid media was
used for breeding B. subtilis cells from selected colonies.
Evaluation of expression of the reporter protein
The evaluation protocol of BgaB expression has been
described in previous articles [6, 9, 12]. First, three single
colonies of each recombinant B. subtilis 1012 strain were
cultured in LB liquid medium. The shaking culture flask of
each clone was incubated at 37°C at 200 rpm to the mid-log
phase when the OD600 of the culture reached 0.8-1. Then,
IPTG was added at 0 (control), 0.1, and 1.0 mM to each
culture. The cells were collected at 0 h (before induction),
2 h, and 4 h after induction for measurement of the BgaB
activity and Western Blot analysis. In terms of this purpose,
the volume of cell suspension was received at OD of 1.2 and
2.4, respectively.
For the investigation of BgaB activity, B. subtilis cells
were lysed in 500 μl of a LacZ buffer containing 200
μg/ml of lysozyme and incubated at 37°C for 2 h. All
samples were centrifuged at 10000 rpm for 5 min before
the determination of the activities. The BgaB activity was
represented by MUG units, which were calculated by
measuring the fluorescence intensity at Ex/Em=360/460
nm. We used 4-methylumbelliferyl-β-D-Galactopyranoside
(MUG) as a substrate to realize the presence of the target
protein β-galactosidase through the fluorescence. A
microplate fluorometer (Clariostar, BMG Labtech) was
used to measure the amount of fluorescence created by
β-gal-dependent MUG hydrolysis, in which a culture
medium sample without cell was used as a blank reference.
The β-galactosidase activity (MUG units) were calculated
by the following equation: (Vl/Vs)×F360/460/(t×OD600); where
Vl is the volume of cell lysate; Vs is the sample volume used
for the assay; F360/460 is the fluorescence signals measured
with the excitation - emission wavelengths of 360±8 nm and
460±8 nm, respectively; t is the reaction time (30 min); and
OD600 is the OD of the cell samples at 600 nm (OD600=1.2)
[9, 12].
In Western Blot analyses, separation of the cell’s proteins
was conducted by SDS-PAGE and the transferation of these
proteins to the nitrocellulose membrane was performed using
Life ScienceS | Biotechnology
Vietnam Journal of Science,
Technology and Engineering 67march 2021 • Volume 63 Number 1
a transfer apparatus (Bio-Rad). Western Blot was carried
out with primary antibodies that were complementary to
the BgaB that were created in the mice in our lab, while
the secondary antibody Anti-Mouse IgG - Peroxidase
antibody was supplied by Sigma. Five-percent skimmed
milk was used for blocking and antibody incubation, in
which the concentration of primary antibodies was 1:20000
while the concentration of secondary antibodies was
1:10000. The proteins were stained by using a PierceTM
ECL Western Blotting Substrate (Thermo Scientific) and
the chemiluminescent signal was detected by the iBrightTM
CL1500 Imaging System (Invitrogen).
Inducer-free expression of GFP at a low level in B.
subtilis
In this procedure, the plasmid pHT1675, an inducer-free
plasmid based on the Pgrac100 promoter, was engineered to
form pHT1692. Firstly, the Pspac gene was received from
the basic plasmid pHCMC05 by using PCR with the primer
pair ON1512/ON1249. Next, the PCR products were treated
by KpnI/BamHI enzymes while the origin plasmid pHT1675
was treated with KpnI/BamHI and alkaline phosphatase to
remove the Pgrac100 gene. Then, the enzymatic products
were ligated by T4 DNA ligase, resulting in the pHT1692
vector containing the Pspac promoter. Finally, we checked
the GFP expression levels of this self-inducible B. subtilis
expression system to demonstrate its potential application
in basic research.
For the investigation of GFP activity, B. subtilis cells
were lysed in a 500 μl PBS buffer that contained 137 mM
NaCl, 2.7 mM KCl, 8 mM Na2HPO4, 2 mM KH2PO4, and
400 μg/ml lysozyme. Then, these mixtures were incubated
at 37°C for 2 h. Immediately after centrifugation at 10000
rpm for 5 min, all samples were used for determination of
the activities. GFP fluorescence was measured by using a
microplate fluorometer (Clariostar, BMG LabTech) and a
384-well plate (Black) with an excitation wavelength of
470±8 nm and an emission wavelength of 515±8 nm. The
determination of the GFP expression was calculated as the
relative fluorescence unit (RFU) divided by the OD600. All
data were averaged from three independent samples of each
time point [9]. The Western Blot was conducted with the
primary antibodies against the GFP created in the mice in
our lab and the secondary antibody Anti-Mouse IgG (whole
molecule)-Peroxidase antibody was supplied by Sigma. The
Western Blot procedure used is described above.
Results and discussion
Construction of the inducer-free expression plasmid
pHT1672 based on Pspac promoter
The inducer-free plasmid pHT1672 was constructed
successfully by deleting 787 bp between ApaI and SnaBI
from the lacI gene of the plasmid pHCMC05-bgaB
(Fig. 1). The results of DNA sequencing analysed by the
Clone Manager showed 100% sequence homology between
the analysed and designed DNA sequences of pHT1672.
Because the plasmid lacks the regulatory gene, it will
express the target protein in B. subtilis cells at the maximum
level of the promoter without an inducer.
7
subtilis expression system to demonstrate its potential application in basic research.
For the investigation of GFP activity, B. subtilis cells were lysed in a 500 μl
PBS buffer that contained 137 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4, 2 mM
KH2PO4, and 400 μg/ml lysozyme. Then, these mixtures were incubated at 37°C for
2 h. Immediately after centrifugation at 10000 rpm for 5 min, all samples were used
for determination of the activities. GFP fluorescence was measured by using a
microplate fluorometer (Clariostar, BMG LabTech) and a 384-well plate (Black)
with an excitation wavelength of 470±8 nm and an emission wavelength of 515±8
nm. The determination of the GFP expression was calculated as the relative
fluorescence unit (RFU) divided by the OD600. All data were averaged from three
independent samples of each time point [9]. The Western Blot was conducted with
the primary antibodies against the GFP created in the mice in our lab and the
secondary antibody Anti-Mouse IgG (whole molecule)-Peroxidase antibody was
supplied by Sigma. The Western Blot procedure used is described above.
Results and discussion
Construction of the inducer-free expression plasmid pHT1672 based on
Pspac promoter
Fig. 1. The development of an inducer-free expression vector from an IPTG-inducible
expression vector for B. subtilis. (A) A schematic depicting the deletion of a part of the lacI gene
(A) (B)
Fig. 1. The development of an inducer-free expression vector
from an IPTG-inducible expression vector for B. subtilis. (a) a
schematic depicting the deletion of a part of the lacI gene from
the IPTG-inducible vector resulting in an inducer-free expression
vector and (b) a map of the phcMc05-bgaB (inducible vector)
and phT1672 (inducer-free vector).
Non-inducible expression of BgaB from plasmid
pHT1672 with the Pspac promoter in B. subtilis
In this experiment, we investigated the expression
levels of the target protein in B. subtilis, which contains
pHT1672 under the control of the Pspac promoter by using
the inducer IPTG. B. subtilis strains containing the origin
plasmid pHCMC05-bgaB and the inducible expression
plasmid based on the Pspac promoter pHT2002 [9] were
also tested for comparison. B. subtilis with pHCMC05, a
similar expression system without the bgaB gene, was used
as a negative control. The BgaB expression of these four B.
subtilis strains are shown in Fig. 2.
Life ScienceS | Biotechnology
Vietnam Journal of Science,
Technology and Engineering68 march 2021 • Volume 63 Number 1
Fig. 2. The BgaB expression of the inducible and inducer-free
plasmids in B. subtilis 1012. The production of the reporter protein
BgaB over the four different B. subtilis strains haboring surveyed
vectors phcMc05-bgaB (origin plasmid, Pspac, inducible),
phT2002 (Pspac, inducible), phT1672 (Pspac, inducible-free),
and phcMc05 (Pspac, negative control without bgaB gene),
were evaluated in the presence of different IPTG concentrations
(0, 0.1, 1.0 mM IPTG). The activities of β-galactosidase (MuG
units) was measured in all samples. all cultures were grown
three times and each experiment was repeated at least twice
under similar conditions. error bars denote standard deviations.
At the same time we collected the aliquots, the MUG
units of the B. subtilis strain containing the inducer-free
plasmid pHT1672 were equivalent in spite of different
IPTG concentrations. After 2 and 4 h, the expression level
of BgaB from the inducer-free plasmid pHT1672 in the
absence of IPTG were compared to those of the origin
inducible plasmids, pHCMC05-bgaB and pHT2002, with 1
mM IPTG. As shown in Fig. 2, the MUG units of pHT1672
after 2 h without induction were about 16.5 times higher
than those of pHCMC05-bgaB. These ratios reached about
18.6 for samples received after 4 h of culture. In addition,
the expression levels of B. subtilis containing the inducible-
free construct pHT1672 were at least 13.2 times higher than
that of pHT2002 without induction after 2 and 4 h. After 4 h
induction with 1.0 mM IPTG, the value of β-galactosidase
activity was equivalent when the comparison of different
strains pHT1672 and 2002 was performed. It could be
deduced that the deletion of the lacI gene has no effect on
the strength of the Pspac promoter and the conversion from
inducible to inducer-free plasmids in B. subtilis.
The BgaB expression levels of the inducer-free plasmid
based on the Pspac promoter pHT1672 were about 16.2
to 20.3 times lower than that of the inducer-free plasmids
based on the Pgrac01 and Pgrac100 promoter [9]. A
previous study [6] showed that the heterologous bgaB could
be induced for the expression at modest amounts in the B.
subtilis containing pHT2002 by using IPTG as inducer. As
a result of this study, we concluded that the inducible-free
plasmid pHT1672 could express the recombinant protein
BgaB at a low level without the addition of IPTG. This
auto-inducible system can control the expression of target
proteins continuously in the B. subtilis host strain without
an inducer.
The expression of heterologous proteins controlled by
the Pspac promoter in B. subtilis was so low that they could
not be detected by SDS-PAGE (Fig. 3A). This result was
comparable with a previous study [6]. To confirm whether or
not BgaB was expressed from these four B. subtilis strains,
the Western Blot was conducted with the aliquots of these
cells and the volume of the cell suspension was received at
an OD of 2.4 after 4 h of induction. The presence of BgaB
is shown in Fig. 3.
Fig. 3. The Western blot results showing the BgaB expression of
inducer-free plasmids based on the Pspac promoter in B. subtilis
1012. The aliquots of surveyed B. subtilis strains (phT1672,
phT2002) in the induced conditions (+, 1 mM IPTG) and the
non-induced conditions (-, 0 mM IPTG). The origin plasmid
phcMc05- bgaB (phcMc05b) was used as a positive control.
The three different bacterial strains containing the surveyed
vectors were cultured in an lb liquid medium at 37°c to the
mid-logarithmic growth phase. Then, each culture was divided
into two subcultures, where one was continuously incubated
without an IPTG induce (0 mM) and the other was in inducible
conditions with 1 mM IPTG (the positive controls were induced
at 1 mM IPTG). The samples were collected 4 h after induction.
The size of the BgaB lane was about 78 kDa. (a) The SDS-PaGe
result shows fuzzy BgaB lines that are difficult to identify and (b)
The Western blot result clearly reflects the expression of BgaB in
the B. subtilis strains.
Life ScienceS | Biotechnology
Vietnam Journal of Science,
Technology and Engineering 69march 2021 • Volume 63 Number 1
As shown in Fig. 3, we confirmed that using polyclonal
antibodies developed in our laboratory could detect a 78
kDa protein corresponding to the molecular size of BgaB.
The thickest band of each line was BgaB, while the other
fuzzy bands were non-specific binding proteins of the cells.
The BgaB expression levels of the two surveyed B. subtilis
strains that contained the inducer-free plasmids (pHT1672,
pHT2002) were similar. Besides, there was no significant
difference between the BgaB bands of these strains in the
presence or absence of the inducer IPTG. The expression
level of heterologous protein BgaB in the B. subtilis strain
pHT1672 was equivalent to the level of that in the B. subtilis
strain pHT2002, which is an inducer-free plasmid based on
Pspac promoter recently published in Ref. [6]. These levels
were higher than that of the positive control pHCMC05-
bgaB. Thus, we conclude that the inducer-free vectors
based on the Pspac promoter could express modest amounts
of the heterologous protein. Therefore, these vectors are
suitable for basic research to express proteins for metabolic
engineering or membrane proteins.
Inducer-free production of GFP from plasmid
pHT1692 with the Pspac promoter in B. subtilis
The target protein using an inducer-free expression
system is continuously expressed in the B. subtilis host
strain without inducer. Therefore, protein overexpression
under strong promoter systems might cause a change of the
protein’s structure, resulting in inactivation of the protein’s
function [12]. Basic research has shown that it is important
to use an inducer-free vector to allow the target heterologous
protein to be produced continuously at low levels. To
reconfirm the potential application of inducer-free plasmids
based on the Pspac promoter, the expression of another
target protein was also investigated. For this study, the auto-
inducible plasmid pHT1692 was created by engineering the
origin of the inducer-free plasmid pHT1675 (Pgrac100-
gfp, ∆lacI, lacO1-lacO3 406 bp) [9]. First, the Pspac gene
was received from the basic plasmid pHCMC05 by using
PCR with the primer pair ON1512/ON1249. Next, the PCR
products were treated with KpnI/BamHI enzymes while the
origin plasmid pHT1675 was treated with KpnI/BamHI and
alkaline phosphatase to remove the Pgrac100 promoter.
Then, the enzymatic products were ligated by T4 DNA
ligase, resulting in the pHT1692 vector consisting of a Pspac
promoter. The activity of GFP produced by the B. subtilis
strain with an inducer-free vector based on Pspac promoter
pHT1692 was evaluated by fluorescent spectrometry (plate
reader). B. subtilis with pHCMC05, a similar expression
system without gfp+ gene, was used as a negative control.
The B. subtilis strain containing the inducible expression
plasmid based on the Pspac promoter pHT1535 was also
tested for comparison. The GFP expression of these B.
subtilis strains is shown in Fig. 4.
Fig. 4. The GFP expression of the inducible and inducer-free
plasmids in B. subtilis 1012. The production of the reporter
protein GFP in the different B. subtilis strains contained surveyed
vectors phT1535 (Pspac, inducible), phT1692 (Pspac, inducible-
free), and phcMc05 (Pspac, negative control without gfp+ gene)
was evaluated in the presence of different IPTG concentrations
(0, 0.1, 1.0 mM IPTG). The activities of GFP (rFu units) was
measured in all samples. all cultures were grown three times
and each experiment was repeated at least twice with similar
conditions. error bars denote standard deviations.
GFP activities of the B. subtilis strain pHT1692 changed
from 6416 to 12640 RFU and were significantly different
between the surveyed samples in non-induced conditions
by time. The activity of GFP measured from the strain
pHT1692 achieved the highest activity of 12640 RFU,
which was 2-fold higher than that of the inducible plasmid
pHT1535. The expression levels of the strain pHT1692
were about 24.7 to 34.3 less than that of some inducer-
free plasmids based on Pgrac01 and Pgrac100 previously
reported in Ref. [9].
Life ScienceS | Biotechnology
Vietnam Journal of Science,
Technology and Engineering70 march 2021 • Volume 63 Number 1
Fig. 5. The Western blot results showing the GFP expression
of inducer-free plasmids based on the Pspac promoter in B.
subtilis 1012. The suspension of the surveyed B. subtilis strains
(phT1692, phT1535) under induced conditions (+, 1 mM
IPTG) and non-induced conditions (-, 0 mM IPTG). The plasmid
phcMc05 without the gfp+ gene was used as a negative control.
The three different bacterial strains containing the surveyed
vectors were cultured in an lb liquid medium at 37°c to the
mid-logarithmic growth phase. Then, each culture was divided
into two subcultures where one was continuously incubated
without IPTG inducer (0 mM) and the other was under inducible
conditions with 1 mM IPTG (the positive controls were induced
at 1 mM IPTG). The samples were collected 4 h after induction.
The size of the GFP lane was about 27 kDa. (a) The SDS-PaGe
result shows fuzzy GFP lines that are difficult to identify and (b)
The Western blot result clearly reflects the expression of GFP in
the B. subtilis strains.
The Western Blot results (Fig. 5B) also corresponded
with previous publications and the sample of surveyed
strains (pHT1672, pHT1535) indicated that the GFP
protein was present in small quantities. These results
certainly demonstrate that the newly constructed inducer-
free expression plasmid based on the Pspac promoter could
allow low-level GFP expression without controlling.
Conclusions
Pspac, a well-known IPTG-inducible promoter for B.
subtilis, is suitable for studying the role of proteins that
are produced at modest concentrations in the cell. We
successfully engineered a Pspac cassette by deleting a part of
the lacI gene to create the inducer-free expression plasmids,
pHT1692 and pHT1672, that express recombinant reporter
proteins at low levels in B. subtilis without the addition of
IPTG. The inducer-free expression plasmids for low protein
expression in B. subtilis could be useful for investigating
heterologous proteins at low levels.
ACKNOWLEDGEMENTS
This research is funded by Vietnam National Foundation
for Science and Technology Development (NAFOSTED)
under Grant Number 106-NN.02-2015.24.
COMPETING INTERESTS
The authors declare that there is no conflict of interest
regarding the publication of this article.
REFERENCES
[1] L. Westers, H. Westers, W.J. Quax (2004), “Bacillus subtilis as
cell factory for pharmaceutical proteins: a biotechnological approach
to optimize the host organism”, Biochim. Biophys. Acta., 1694,
pp.299-310.
[2] J.M. Van Dijl, M. Hecker (2013), “Bacillus subtilis: from soil
bacterium to super-secreting cell factory”, Microb. Cell Factories,
12(3), DOI: 10.1186/1475-2859-12-3.
[3] C. Zhou, B. Ye, S. Cheng, L. Zhao, Y. Liu, J. Jiang, X. Yan
(2019), “Promoter engineering enables overproduction of foreign
proteins from a single copy expression cassette in Bacillus subtilis”,
Microb. Cell Factories, 18(1), DOI: 10.1186/s12934-019-1159-0.
[4] H.D. Nguyen, Q.A. Nguyen, R.C. Ferreira, L.C. Ferreira,
L.T. Tran, W. Schumann (2005), “Construction of plasmid-based
expression vectors for Bacillus subtilis exhibiting full structural
stability”, Plasmid, 54, pp.241-248.
[5] D.G. Yansura, D.J. Henner (1984), “Use of the Escherichia
coli lac repressor and operator to control gene expression in Bacillus
subtilis”, Proc. Natl. Acad. Sci. USA, 81, pp.439-443.
[6] H.T.-T. Phan, N.N.Y. Nhi, L.T. Tien, C.T.B. Phuong, L.T.P
Ngan, P.T.P. Trang, H.D Nguyen (2019), “Construction of expression
plasmid for Bacillus subtilis using Pspac promoter and BgaB as a
reporter”, Sci. Technol. Dev. J., 22, pp.239-246.
[7] H.D. Nguyen, W. Schumann (2006), “Establishment of an
experimental system allowing immobilization of proteins on the
surface of Bacillus subtilis cells”, J. Biotechnol., 122(4), pp.473-482.
[8] L. Briand, G. Marcion, A. Kriznik, J.M. Heydel, Y. Artur,
C. Garrido, R. Seigneuric, F. Neiers (2016), “A self-inducible
heterologous protein expression system in Escherichia coli”, Sci.
Rep., 6, pp.33-37.
[9] D.T.M. Tran, T.T.P. Phan, T.K. Huynh, N.T.K. Dang, P.T.K.
Huynh, T.M. Nguyen, T.T.T. Truong, T.L. Tran, W. Schumann, H.D.
Nguyen (2017), “Development of inducer-free expression plasmids
based on IPTG-inducible promoters for Bacillus subtilis”, Microb.
Cell. Factories., 16(1), DOI: 10.1186/s12934-017-0747-0.
[10] P.T.P. Trang, T.T.A. Dao, T.T. Lan, N.T.M. Linh, A.T. Hanh,
D.T. Dung, N.D. Hoang (2018), “Developing auto-inducible Pgrac57
promoter in Bacillus subtilis”, Natural Sciences and Technology,
15(3), pp.100-108.
[11] T. Phan, P. Huynh, T. Truong, H. Nguyen (2017), “A generic
protocol for intracellular expression of recombinant proteins in
Bacillus subtilis”, Methods Mol. Biol., pp.325-334, DOI: 10.1007/978-
1-4939-6887-9_21.
[12] F. Vidal-Aroca, M. Giannattasio, E. Brunelli, A. Vezzoli,
P. Plevani, M. Muzi-Falconi, G. Bertoni (2006), “One-step high-
throughput assay for quantitative detection of beta-galactosidase
activity in intact gram-negative bacteria, yeast, and mammalian
cells”, BioTechniques, 40, pp.433-434.
Các file đính kèm theo tài liệu này:
development_of_inducer_free_expression_plasmids_using_iptg_i.pdf