Development of inducer-Free expression plasmids using IPTG-inducible Pspac promoter for Bacillus subtilis

Inducer-free production of GFP from plasmid pHT1692 with the Pspac promoter in B. subtilis The target protein using an inducer-free expression system is continuously expressed in the B. subtilis host strain without inducer. Therefore, protein overexpression under strong promoter systems might cause a change of the protein’s structure, resulting in inactivation of the protein’s function [12]. Basic research has shown that it is important to use an inducer-free vector to allow the target heterologous protein to be produced continuously at low levels. To reconfirm the potential application of inducer-free plasmids based on the Pspac promoter, the expression of another target protein was also investigated. For this study, the autoinducible plasmid pHT1692 was created by engineering the origin of the inducer-free plasmid pHT1675 (Pgrac100- gfp, ∆lacI, lacO1-lacO3 406 bp) [9]. First, the Pspac gene was received from the basic plasmid pHCMC05 by using PCR with the primer pair ON1512/ON1249. Next, the PCR products were treated with KpnI/BamHI enzymes while the origin plasmid pHT1675 was treated with KpnI/BamHI and alkaline phosphatase to remove the Pgrac100 promoter. Then, the enzymatic products were ligated by T4 DNA ligase, resulting in the pHT1692 vector consisting of a Pspac promoter. The activity of GFP produced by the B. subtilis strain with an inducer-free vector based on Pspac promoter pHT1692 was evaluated by fluorescent spectrometry (plate reader). B. subtilis with pHCMC05, a similar expression system without gfp+ gene, was used as a negative control. The B. subtilis strain containing the inducible expression plasmid based on the Pspac promoter pHT1535 was also tested for comparison. The GFP expression of these B. subtilis strains is shown in Fig. 4.

pdf7 trang | Chia sẻ: hachi492 | Lượt xem: 145 | Lượt tải: 0Freedownload
Bạn đang xem nội dung tài liệu Development of inducer-Free expression plasmids using IPTG-inducible Pspac promoter for Bacillus subtilis, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Life ScienceS | Biotechnology Vietnam Journal of Science, Technology and Engineering64 march 2021 • Volume 63 Number 1 Introduction B. subtilis is an important host for the production of heterologous proteins because of its advantages such as easy handling, safe, non-pathogenic, endotoxin-free, effective protein secretion mechanisms, and industrial fermentation. Besides, B. subtilis is a model organism for studying Gram-positive bacteria and the biological systems of cellular differentiation, stress responses, and multicellular organization [1, 2]. Thus, scientists have paid more attention to its expression systems for industrial applications and basic research [3]. Fundamental research has shown it is essential to have a weak promoter that can be controlled to express low levels of recombinant proteins within the cells. IPTG-inducible Pspac, a well-characterized hybrid promoter, is composed of the B. subtilis phage SPO-1 promoter and the E. coli lac operator, which leads to transcription activation for low levels of gene expression. The Pspac promoter allows low- expression levels of reporter expression [4, 5], which is approximately 50 times weaker than the Pgrac promoter. Many plasmids containing the IPTG-inducible Pspac promoter, such as pHCMC05, pAL01, and the improved plasmid pHT2002 [6], are suitable to express a modest amount of the heterologous protein in the induction of IPTG in B. subtilis. One example of requiring low protein expression level is sortase, which is a membrane-associated protein needed for anchoring recombinant proteins to the cell wall. Low levels of sortase are necessary to avoid membrane clogging [7]. The weak promoter Pspac is also an appropriate choice when the recombinant protein, or a protein of interest in any pathway, is harmless to the host cells after overproduction. Induction of protein expression is stimulated by the addition of the inducer IPTG, a non-metabolizable analogue Development of inducer-free expression plasmids using IPTG-inducible Pspac promoter for Bacillus subtilis Phuong Thi Bich Chu1, 2, 3, 4, Hanh Thi Thu Phan1, 2, Hoang Duc Nguyen1, 2, 4*, Trang Thi Phuong Phan1, 2, 5* 1Center for Bioscience and Biotechnology, University of Science, Vietnam National University, Ho Chi Minh city, Vietnam 2Vietnam National University, Ho Chi Minh city, Vietnam 3Faculty of Pharmacy, Ho Chi Minh city University of Technology (HUTECH), Vietnam 4Department of Microbiology, University of Science, Vietnam National University, Ho Chi Minh city, Vietnam 5Laboratory of Molecular Biotechnology, University of Science, Vietnam National University, Ho Chi Minh city, Vietnam Received 1 December 2019; accepted 3 March 2020 *Corresponding authors: Email: [email protected]; [email protected] Abstract: An inducer-free expression vector for the low expression levels in Bacillus subtilis (B. subtilis) is necessary for fundamental research. In this study, we constructed inducer-free expression plasmids carrying Pspac, a well-known IPTG-inducible promoter, by removing a part of the lacI gene. Then, we analysed the expression of the target genes bgaB and gfp+ in B. subtilis. Western blot experiments demonstrated that the reporters from the inducer-free plasmids with Pspac could be produced at low levels in B. subtilis strains and were equivalent to their corresponding inducible constructs with 1 mM IPTG. The reporter activities showed that inducer-free expression from the Pspac promoter was dramatically less than that of the inducer-free plasmids with the strong promoters Pgrac01 and Pgrac100 reported previously, about 16.2 to 20.3 times for BgaB and 24.7 to 34.3 times for GFP+, respectively. In conclusion, the inducer-free expression vectors carrying Pspac promoters allow the constitutive expression of heterologous recombinant proteins at low levels in B. subtilis. Keywords: Bacillus subtilis, inducer-free, pHT vector, Pspac, weak promoter. Classification number: 3.5 DOI: 10.31276/VJSTE.63(1).64-70 Life ScienceS | Biotechnology Vietnam Journal of Science, Technology and Engineering 65march 2021 • Volume 63 Number 1 of allolactose. After induction, the RNA polymerase enzyme specially transcribes the coding sequence of the protein of interest present in the expression plasmid under the control of the promoter. IPTG is very useful to control gene expression in many microorganisms. However, IPTG has several limitations: (i) it requires cell culture monitoring to ensure that IPTG is added at the appropriate time. Because the induction point varies significantly from one recombinant protein to another, the process becomes challenging to manipulate, particularly when several proteins are expressed in parallel (e.g., for a screening study) and (ii) it presents toxicity limitations that affect cell viability [8]. Therefore, inducers are sometimes not necessary for low and continuous protein expression in the cell. Some auto-inducible and constitutive expression vectors were constructed such that heterologous proteins can be expressed in B. subtilis during continuous culture without adding the inducer. In the last few years, inducer- free expression systems were developed by deleting a part of or the entire lacI gene in the vector carrying the IPTG- inducible promoters, Pgrac01, Pgrac57, and Pgrac100 [9, 10]. These strong inducer-free expression vectors have shown a prospective yield of recombinant proteins for industrial and medical applications. However, an inducer- free expression vector system based on a weak promoter controlling the expression of heterologous proteins at low levels has not yet been studied. In this work, inducer-free expression plasmids were developed by deleting the lacI gene on plasmids carrying the Pspac promoter, which allows the system to express proteins of interest without using any inducers. Two widespread reporter genes, bgaB and gfp+, were used to investigate the expression levels of these vectors. Materials and methods Strains, plasmids and growth conditions Escherichia coli OmniMAXTM was used as the host for gene cloning and B. subtilis 1012 was used for gene expression and integration. The final concentrations of antibiotics were as follows, in mg/l: ampicillin (Amp), 100 for E. coli; and chloramphenicol (Cm), 10 for B. subtilis. The strains were cultivated in Luria-Bertani (LB) medium consisting of 1% tryptone, 0.5% yeast extract, and 0.5% NaCl. Strains were cultivated at 37°C in shaking flasks at 200 rpm. The cell density was determined by measuring the OD600 with an S-20 spectrophotometer (Boeco, Germany). Table 1 shows a list of the plasmids and oligonucleotides used in this study. Table 1. bacterial strains, plasmids and oligonucleotides used in this study. Bacterial strains Genotype Source/references E. coli OmniMAX F′ {proAB lacI q lacZ∆M15 Tn10(TetR) ∆(ccdAB)} mcrA ∆(mrr hsdRMS-mcrBC) Φ 80(lacZ)∆M15 ∆(lacZYA-argF)U16 9 endA1 recA1 supE44 thi-1 gyrA96 relA1 tonA panD; used for cloning Invitrogen B. subtilis 1012 leuA8 metB5 trpC2 hsrM1 Mobitec Plasmids Description Source/references pHCMC05 Pspac promoter, no reporter gene, negative control [4] pHCMC05-bgaB Pspac-bgaB, inducible, used to construct pHT1672 [4] pHT1675 Pgrac100-gfp, ∆lacI, lacO1-lacO3 406 bp; used to construct pHT1692 This study pHT2002 Pspac-bgaB, inducible [6] pHT1535 Pspac-gfp+, inducible plasmid This study pHT1692 Pspac-gfp+, ∆lacI 406 bp This study pHT1672 Pspac-bgaB, ∆lacI 787 bp This study Oligonucleotide Sequence 5’ → 3’ Used for ON1896 CGGTTCGATCTTGCTCCAACTG pHT 1672, plasmid sequencing ON925 GAATTAGCTTGGTACCAAAGGAGGTAAGGATCACTAG pHT1672, screening E. coli coloniesON1278 GGCCATGACGTCTTTGTAAAGCTCATCCATGCCATGTGT ON780 CCCGCGGTCAGCTAGCCTAAACCTTCCCGGCTTCATCATGCTC pHT1672, screening B. subtilis coloniesON779 AAAGGAGGAAAGATCTATGAATGTGTTATCCTCAATTTGTTAC ON1512 ATCTCCATGGACGCGTGACG pHCMC05, receiving Pspac promoterON1249 CGTTTCCACCGGAATTAGCTTG ON926B ON1273 GACGTCGACTCTAGACATGGATCCTTCCTCCTTTATATGG CCCGGTACCCACTTCCTAGAATATATATTATGTAAACAAAGGAGGTA AGGATCACTAG pHT1692, screening E. coli colonies ON1280 GGCCATGACGTCTTATTTGTAAAGCTCATCCATGCCATGTGT pHT1692, screening B. subtilis coloniesON867B GTGAAGGTGATGCTACAAACGGAAAGCTTACCCTTAAA Life ScienceS | Biotechnology Vietnam Journal of Science, Technology and Engineering66 march 2021 • Volume 63 Number 1 Materials Taq DNA polymerase and enzymes, including SnaBI, ApaI, T4 DNA ligase, KpnI, BamHI, Alkaline phosphatase, and Klenow, were supplied by Thermo Scientific. PCR kit, cloning kit, and basic materials for molecular biology were supplied by Qiagen, Thermo Scientific, Sigma-Aldrich, Merck-Millipore, and BioBasic. The plasmid pHCMC05- bgaB, and the plasmid pHT1675 were used as the origin plasmids to create the inducer-free plasmids. The plasmid pHCMC05 without the bgaB or gfp+ gene was used as a negative control. All primers for PCR were described in Table 1. Construction of the inducer-free expression plasmid based on the Pspac promoter The plasmid pHCMC05-bgaB [4], a popular IPTG- inducible plasmid based on the Pspac promoter, was engineered by removing 787 bp from the lacI gene to generate the auto-inducible plasmid pHT1672 (Fig. 1A). First, the plasmid pHCMC05-bgaB was treated by the restriction enzymes SnaBI and ApaI, in which ApaI created sticky end products while SnaBI created blunt end products. Second, the sticky ends were deleted by the Klenow Fragment to optimize the ligation reaction. Then, the ligation reaction of these products was carried out by T4 ligase and subsequently transformed into E. coli. The transformants were analysed by colony PCR using restriction analysis. Finally, the gene sequence of pHT1672 was confirmed by an improved Sanger method using an ON1896 primer on a Big DyeTM terminator (Macrogen - Korea). The structure of the pHT1672 plasmid is shown in Fig. 1B. Transformation of recombinant plasmids into B. subtilis 1012 competent cells The procedure for the transformation of recombinant plasmids into B. subtilis 1012 competent cells was carried out as described elsewhere [11]. First, the B. subtilis 1012 competent cells were shaken in 50-ml flasks containing 10 ml of LS medium at 50 rpm in a 30oC-shaking incubator for 2 h. Then, 100 µl of 0.1 M ethylene glycol tetraacetic acid (EGTA) was added into the prepared 50-ml flask with B. subtilis competent cells and this flask was kept at room temperature (25oC) for 10 min. After that, 1 ml of B. subtilis competent cells was removed and transferred into a 1.5- ml tube containing the recombinant plasmid. Next, this tube was shaken at 200 rpm in 37oC for 2 h before being centrifuged at 7000 rpm for 5 min to receive the recombinant cells. The cells were resuspended in the left supernatant and spread on LB agar plates containing 10 µg/ml Cm and 40 µg/ml 5-Bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal). The plates were incubated at 37oC overnight. Then, B. subtilis colonies were screened using ON780/ON779 primers by colony PCR. Finally, the LB liquid media was used for breeding B. subtilis cells from selected colonies. Evaluation of expression of the reporter protein The evaluation protocol of BgaB expression has been described in previous articles [6, 9, 12]. First, three single colonies of each recombinant B. subtilis 1012 strain were cultured in LB liquid medium. The shaking culture flask of each clone was incubated at 37°C at 200 rpm to the mid-log phase when the OD600 of the culture reached 0.8-1. Then, IPTG was added at 0 (control), 0.1, and 1.0 mM to each culture. The cells were collected at 0 h (before induction), 2 h, and 4 h after induction for measurement of the BgaB activity and Western Blot analysis. In terms of this purpose, the volume of cell suspension was received at OD of 1.2 and 2.4, respectively. For the investigation of BgaB activity, B. subtilis cells were lysed in 500 μl of a LacZ buffer containing 200 μg/ml of lysozyme and incubated at 37°C for 2 h. All samples were centrifuged at 10000 rpm for 5 min before the determination of the activities. The BgaB activity was represented by MUG units, which were calculated by measuring the fluorescence intensity at Ex/Em=360/460 nm. We used 4-methylumbelliferyl-β-D-Galactopyranoside (MUG) as a substrate to realize the presence of the target protein β-galactosidase through the fluorescence. A microplate fluorometer (Clariostar, BMG Labtech) was used to measure the amount of fluorescence created by β-gal-dependent MUG hydrolysis, in which a culture medium sample without cell was used as a blank reference. The β-galactosidase activity (MUG units) were calculated by the following equation: (Vl/Vs)×F360/460/(t×OD600); where Vl is the volume of cell lysate; Vs is the sample volume used for the assay; F360/460 is the fluorescence signals measured with the excitation - emission wavelengths of 360±8 nm and 460±8 nm, respectively; t is the reaction time (30 min); and OD600 is the OD of the cell samples at 600 nm (OD600=1.2) [9, 12]. In Western Blot analyses, separation of the cell’s proteins was conducted by SDS-PAGE and the transferation of these proteins to the nitrocellulose membrane was performed using Life ScienceS | Biotechnology Vietnam Journal of Science, Technology and Engineering 67march 2021 • Volume 63 Number 1 a transfer apparatus (Bio-Rad). Western Blot was carried out with primary antibodies that were complementary to the BgaB that were created in the mice in our lab, while the secondary antibody Anti-Mouse IgG - Peroxidase antibody was supplied by Sigma. Five-percent skimmed milk was used for blocking and antibody incubation, in which the concentration of primary antibodies was 1:20000 while the concentration of secondary antibodies was 1:10000. The proteins were stained by using a PierceTM ECL Western Blotting Substrate (Thermo Scientific) and the chemiluminescent signal was detected by the iBrightTM CL1500 Imaging System (Invitrogen). Inducer-free expression of GFP at a low level in B. subtilis In this procedure, the plasmid pHT1675, an inducer-free plasmid based on the Pgrac100 promoter, was engineered to form pHT1692. Firstly, the Pspac gene was received from the basic plasmid pHCMC05 by using PCR with the primer pair ON1512/ON1249. Next, the PCR products were treated by KpnI/BamHI enzymes while the origin plasmid pHT1675 was treated with KpnI/BamHI and alkaline phosphatase to remove the Pgrac100 gene. Then, the enzymatic products were ligated by T4 DNA ligase, resulting in the pHT1692 vector containing the Pspac promoter. Finally, we checked the GFP expression levels of this self-inducible B. subtilis expression system to demonstrate its potential application in basic research. For the investigation of GFP activity, B. subtilis cells were lysed in a 500 μl PBS buffer that contained 137 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4, 2 mM KH2PO4, and 400 μg/ml lysozyme. Then, these mixtures were incubated at 37°C for 2 h. Immediately after centrifugation at 10000 rpm for 5 min, all samples were used for determination of the activities. GFP fluorescence was measured by using a microplate fluorometer (Clariostar, BMG LabTech) and a 384-well plate (Black) with an excitation wavelength of 470±8 nm and an emission wavelength of 515±8 nm. The determination of the GFP expression was calculated as the relative fluorescence unit (RFU) divided by the OD600. All data were averaged from three independent samples of each time point [9]. The Western Blot was conducted with the primary antibodies against the GFP created in the mice in our lab and the secondary antibody Anti-Mouse IgG (whole molecule)-Peroxidase antibody was supplied by Sigma. The Western Blot procedure used is described above. Results and discussion Construction of the inducer-free expression plasmid pHT1672 based on Pspac promoter The inducer-free plasmid pHT1672 was constructed successfully by deleting 787 bp between ApaI and SnaBI from the lacI gene of the plasmid pHCMC05-bgaB (Fig. 1). The results of DNA sequencing analysed by the Clone Manager showed 100% sequence homology between the analysed and designed DNA sequences of pHT1672. Because the plasmid lacks the regulatory gene, it will express the target protein in B. subtilis cells at the maximum level of the promoter without an inducer. 7 subtilis expression system to demonstrate its potential application in basic research. For the investigation of GFP activity, B. subtilis cells were lysed in a 500 μl PBS buffer that contained 137 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4, 2 mM KH2PO4, and 400 μg/ml lysozyme. Then, these mixtures were incubated at 37°C for 2 h. Immediately after centrifugation at 10000 rpm for 5 min, all samples were used for determination of the activities. GFP fluorescence was measured by using a microplate fluorometer (Clariostar, BMG LabTech) and a 384-well plate (Black) with an excitation wavelength of 470±8 nm and an emission wavelength of 515±8 nm. The determination of the GFP expression was calculated as the relative fluorescence unit (RFU) divided by the OD600. All data were averaged from three independent samples of each time point [9]. The Western Blot was conducted with the primary antibodies against the GFP created in the mice in our lab and the secondary antibody Anti-Mouse IgG (whole molecule)-Peroxidase antibody was supplied by Sigma. The Western Blot procedure used is described above. Results and discussion Construction of the inducer-free expression plasmid pHT1672 based on Pspac promoter Fig. 1. The development of an inducer-free expression vector from an IPTG-inducible expression vector for B. subtilis. (A) A schematic depicting the deletion of a part of the lacI gene (A) (B) Fig. 1. The development of an inducer-free expression vector from an IPTG-inducible expression vector for B. subtilis. (a) a schematic depicting the deletion of a part of the lacI gene from the IPTG-inducible vector resulting in an inducer-free expression vector and (b) a map of the phcMc05-bgaB (inducible vector) and phT1672 (inducer-free vector). Non-inducible expression of BgaB from plasmid pHT1672 with the Pspac promoter in B. subtilis In this experiment, we investigated the expression levels of the target protein in B. subtilis, which contains pHT1672 under the control of the Pspac promoter by using the inducer IPTG. B. subtilis strains containing the origin plasmid pHCMC05-bgaB and the inducible expression plasmid based on the Pspac promoter pHT2002 [9] were also tested for comparison. B. subtilis with pHCMC05, a similar expression system without the bgaB gene, was used as a negative control. The BgaB expression of these four B. subtilis strains are shown in Fig. 2. Life ScienceS | Biotechnology Vietnam Journal of Science, Technology and Engineering68 march 2021 • Volume 63 Number 1 Fig. 2. The BgaB expression of the inducible and inducer-free plasmids in B. subtilis 1012. The production of the reporter protein BgaB over the four different B. subtilis strains haboring surveyed vectors phcMc05-bgaB (origin plasmid, Pspac, inducible), phT2002 (Pspac, inducible), phT1672 (Pspac, inducible-free), and phcMc05 (Pspac, negative control without bgaB gene), were evaluated in the presence of different IPTG concentrations (0, 0.1, 1.0 mM IPTG). The activities of β-galactosidase (MuG units) was measured in all samples. all cultures were grown three times and each experiment was repeated at least twice under similar conditions. error bars denote standard deviations. At the same time we collected the aliquots, the MUG units of the B. subtilis strain containing the inducer-free plasmid pHT1672 were equivalent in spite of different IPTG concentrations. After 2 and 4 h, the expression level of BgaB from the inducer-free plasmid pHT1672 in the absence of IPTG were compared to those of the origin inducible plasmids, pHCMC05-bgaB and pHT2002, with 1 mM IPTG. As shown in Fig. 2, the MUG units of pHT1672 after 2 h without induction were about 16.5 times higher than those of pHCMC05-bgaB. These ratios reached about 18.6 for samples received after 4 h of culture. In addition, the expression levels of B. subtilis containing the inducible- free construct pHT1672 were at least 13.2 times higher than that of pHT2002 without induction after 2 and 4 h. After 4 h induction with 1.0 mM IPTG, the value of β-galactosidase activity was equivalent when the comparison of different strains pHT1672 and 2002 was performed. It could be deduced that the deletion of the lacI gene has no effect on the strength of the Pspac promoter and the conversion from inducible to inducer-free plasmids in B. subtilis. The BgaB expression levels of the inducer-free plasmid based on the Pspac promoter pHT1672 were about 16.2 to 20.3 times lower than that of the inducer-free plasmids based on the Pgrac01 and Pgrac100 promoter [9]. A previous study [6] showed that the heterologous bgaB could be induced for the expression at modest amounts in the B. subtilis containing pHT2002 by using IPTG as inducer. As a result of this study, we concluded that the inducible-free plasmid pHT1672 could express the recombinant protein BgaB at a low level without the addition of IPTG. This auto-inducible system can control the expression of target proteins continuously in the B. subtilis host strain without an inducer. The expression of heterologous proteins controlled by the Pspac promoter in B. subtilis was so low that they could not be detected by SDS-PAGE (Fig. 3A). This result was comparable with a previous study [6]. To confirm whether or not BgaB was expressed from these four B. subtilis strains, the Western Blot was conducted with the aliquots of these cells and the volume of the cell suspension was received at an OD of 2.4 after 4 h of induction. The presence of BgaB is shown in Fig. 3. Fig. 3. The Western blot results showing the BgaB expression of inducer-free plasmids based on the Pspac promoter in B. subtilis 1012. The aliquots of surveyed B. subtilis strains (phT1672, phT2002) in the induced conditions (+, 1 mM IPTG) and the non-induced conditions (-, 0 mM IPTG). The origin plasmid phcMc05- bgaB (phcMc05b) was used as a positive control. The three different bacterial strains containing the surveyed vectors were cultured in an lb liquid medium at 37°c to the mid-logarithmic growth phase. Then, each culture was divided into two subcultures, where one was continuously incubated without an IPTG induce (0 mM) and the other was in inducible conditions with 1 mM IPTG (the positive controls were induced at 1 mM IPTG). The samples were collected 4 h after induction. The size of the BgaB lane was about 78 kDa. (a) The SDS-PaGe result shows fuzzy BgaB lines that are difficult to identify and (b) The Western blot result clearly reflects the expression of BgaB in the B. subtilis strains. Life ScienceS | Biotechnology Vietnam Journal of Science, Technology and Engineering 69march 2021 • Volume 63 Number 1 As shown in Fig. 3, we confirmed that using polyclonal antibodies developed in our laboratory could detect a 78 kDa protein corresponding to the molecular size of BgaB. The thickest band of each line was BgaB, while the other fuzzy bands were non-specific binding proteins of the cells. The BgaB expression levels of the two surveyed B. subtilis strains that contained the inducer-free plasmids (pHT1672, pHT2002) were similar. Besides, there was no significant difference between the BgaB bands of these strains in the presence or absence of the inducer IPTG. The expression level of heterologous protein BgaB in the B. subtilis strain pHT1672 was equivalent to the level of that in the B. subtilis strain pHT2002, which is an inducer-free plasmid based on Pspac promoter recently published in Ref. [6]. These levels were higher than that of the positive control pHCMC05- bgaB. Thus, we conclude that the inducer-free vectors based on the Pspac promoter could express modest amounts of the heterologous protein. Therefore, these vectors are suitable for basic research to express proteins for metabolic engineering or membrane proteins. Inducer-free production of GFP from plasmid pHT1692 with the Pspac promoter in B. subtilis The target protein using an inducer-free expression system is continuously expressed in the B. subtilis host strain without inducer. Therefore, protein overexpression under strong promoter systems might cause a change of the protein’s structure, resulting in inactivation of the protein’s function [12]. Basic research has shown that it is important to use an inducer-free vector to allow the target heterologous protein to be produced continuously at low levels. To reconfirm the potential application of inducer-free plasmids based on the Pspac promoter, the expression of another target protein was also investigated. For this study, the auto- inducible plasmid pHT1692 was created by engineering the origin of the inducer-free plasmid pHT1675 (Pgrac100- gfp, ∆lacI, lacO1-lacO3 406 bp) [9]. First, the Pspac gene was received from the basic plasmid pHCMC05 by using PCR with the primer pair ON1512/ON1249. Next, the PCR products were treated with KpnI/BamHI enzymes while the origin plasmid pHT1675 was treated with KpnI/BamHI and alkaline phosphatase to remove the Pgrac100 promoter. Then, the enzymatic products were ligated by T4 DNA ligase, resulting in the pHT1692 vector consisting of a Pspac promoter. The activity of GFP produced by the B. subtilis strain with an inducer-free vector based on Pspac promoter pHT1692 was evaluated by fluorescent spectrometry (plate reader). B. subtilis with pHCMC05, a similar expression system without gfp+ gene, was used as a negative control. The B. subtilis strain containing the inducible expression plasmid based on the Pspac promoter pHT1535 was also tested for comparison. The GFP expression of these B. subtilis strains is shown in Fig. 4. Fig. 4. The GFP expression of the inducible and inducer-free plasmids in B. subtilis 1012. The production of the reporter protein GFP in the different B. subtilis strains contained surveyed vectors phT1535 (Pspac, inducible), phT1692 (Pspac, inducible- free), and phcMc05 (Pspac, negative control without gfp+ gene) was evaluated in the presence of different IPTG concentrations (0, 0.1, 1.0 mM IPTG). The activities of GFP (rFu units) was measured in all samples. all cultures were grown three times and each experiment was repeated at least twice with similar conditions. error bars denote standard deviations. GFP activities of the B. subtilis strain pHT1692 changed from 6416 to 12640 RFU and were significantly different between the surveyed samples in non-induced conditions by time. The activity of GFP measured from the strain pHT1692 achieved the highest activity of 12640 RFU, which was 2-fold higher than that of the inducible plasmid pHT1535. The expression levels of the strain pHT1692 were about 24.7 to 34.3 less than that of some inducer- free plasmids based on Pgrac01 and Pgrac100 previously reported in Ref. [9]. Life ScienceS | Biotechnology Vietnam Journal of Science, Technology and Engineering70 march 2021 • Volume 63 Number 1 Fig. 5. The Western blot results showing the GFP expression of inducer-free plasmids based on the Pspac promoter in B. subtilis 1012. The suspension of the surveyed B. subtilis strains (phT1692, phT1535) under induced conditions (+, 1 mM IPTG) and non-induced conditions (-, 0 mM IPTG). The plasmid phcMc05 without the gfp+ gene was used as a negative control. The three different bacterial strains containing the surveyed vectors were cultured in an lb liquid medium at 37°c to the mid-logarithmic growth phase. Then, each culture was divided into two subcultures where one was continuously incubated without IPTG inducer (0 mM) and the other was under inducible conditions with 1 mM IPTG (the positive controls were induced at 1 mM IPTG). The samples were collected 4 h after induction. The size of the GFP lane was about 27 kDa. (a) The SDS-PaGe result shows fuzzy GFP lines that are difficult to identify and (b) The Western blot result clearly reflects the expression of GFP in the B. subtilis strains. The Western Blot results (Fig. 5B) also corresponded with previous publications and the sample of surveyed strains (pHT1672, pHT1535) indicated that the GFP protein was present in small quantities. These results certainly demonstrate that the newly constructed inducer- free expression plasmid based on the Pspac promoter could allow low-level GFP expression without controlling. Conclusions Pspac, a well-known IPTG-inducible promoter for B. subtilis, is suitable for studying the role of proteins that are produced at modest concentrations in the cell. We successfully engineered a Pspac cassette by deleting a part of the lacI gene to create the inducer-free expression plasmids, pHT1692 and pHT1672, that express recombinant reporter proteins at low levels in B. subtilis without the addition of IPTG. The inducer-free expression plasmids for low protein expression in B. subtilis could be useful for investigating heterologous proteins at low levels. ACKNOWLEDGEMENTS This research is funded by Vietnam National Foundation for Science and Technology Development (NAFOSTED) under Grant Number 106-NN.02-2015.24. COMPETING INTERESTS The authors declare that there is no conflict of interest regarding the publication of this article. REFERENCES [1] L. Westers, H. Westers, W.J. Quax (2004), “Bacillus subtilis as cell factory for pharmaceutical proteins: a biotechnological approach to optimize the host organism”, Biochim. Biophys. Acta., 1694, pp.299-310. [2] J.M. Van Dijl, M. Hecker (2013), “Bacillus subtilis: from soil bacterium to super-secreting cell factory”, Microb. Cell Factories, 12(3), DOI: 10.1186/1475-2859-12-3. [3] C. Zhou, B. Ye, S. Cheng, L. Zhao, Y. Liu, J. Jiang, X. Yan (2019), “Promoter engineering enables overproduction of foreign proteins from a single copy expression cassette in Bacillus subtilis”, Microb. Cell Factories, 18(1), DOI: 10.1186/s12934-019-1159-0. [4] H.D. Nguyen, Q.A. Nguyen, R.C. Ferreira, L.C. Ferreira, L.T. Tran, W. Schumann (2005), “Construction of plasmid-based expression vectors for Bacillus subtilis exhibiting full structural stability”, Plasmid, 54, pp.241-248. [5] D.G. Yansura, D.J. Henner (1984), “Use of the Escherichia coli lac repressor and operator to control gene expression in Bacillus subtilis”, Proc. Natl. Acad. Sci. USA, 81, pp.439-443. [6] H.T.-T. Phan, N.N.Y. Nhi, L.T. Tien, C.T.B. Phuong, L.T.P Ngan, P.T.P. Trang, H.D Nguyen (2019), “Construction of expression plasmid for Bacillus subtilis using Pspac promoter and BgaB as a reporter”, Sci. Technol. Dev. J., 22, pp.239-246. [7] H.D. Nguyen, W. Schumann (2006), “Establishment of an experimental system allowing immobilization of proteins on the surface of Bacillus subtilis cells”, J. Biotechnol., 122(4), pp.473-482. [8] L. Briand, G. Marcion, A. Kriznik, J.M. Heydel, Y. Artur, C. Garrido, R. Seigneuric, F. Neiers (2016), “A self-inducible heterologous protein expression system in Escherichia coli”, Sci. Rep., 6, pp.33-37. [9] D.T.M. Tran, T.T.P. Phan, T.K. Huynh, N.T.K. Dang, P.T.K. Huynh, T.M. Nguyen, T.T.T. Truong, T.L. Tran, W. Schumann, H.D. Nguyen (2017), “Development of inducer-free expression plasmids based on IPTG-inducible promoters for Bacillus subtilis”, Microb. Cell. Factories., 16(1), DOI: 10.1186/s12934-017-0747-0. [10] P.T.P. Trang, T.T.A. Dao, T.T. Lan, N.T.M. Linh, A.T. Hanh, D.T. Dung, N.D. Hoang (2018), “Developing auto-inducible Pgrac57 promoter in Bacillus subtilis”, Natural Sciences and Technology, 15(3), pp.100-108. [11] T. Phan, P. Huynh, T. Truong, H. Nguyen (2017), “A generic protocol for intracellular expression of recombinant proteins in Bacillus subtilis”, Methods Mol. Biol., pp.325-334, DOI: 10.1007/978- 1-4939-6887-9_21. [12] F. Vidal-Aroca, M. Giannattasio, E. Brunelli, A. Vezzoli, P. Plevani, M. Muzi-Falconi, G. Bertoni (2006), “One-step high- throughput assay for quantitative detection of beta-galactosidase activity in intact gram-negative bacteria, yeast, and mammalian cells”, BioTechniques, 40, pp.433-434.

Các file đính kèm theo tài liệu này:

  • pdfdevelopment_of_inducer_free_expression_plasmids_using_iptg_i.pdf
Tài liệu liên quan