Expression and characterization of recombinant trehalose synthase in bacillus subtilis

Characteristics of TreS activity Trehalose synthesis acitivity of recombinant TreS was tested under different conditions. The results showed that TreS was active in a wide range of temperature of 25– 40 oC and most active at 37 oC (Fig. 6A). In addition, TreS activity was highest in pH 7.4– 8.0 and significantly reduced when pH was lower than 7.4 (Fig. 6B). Maltose positively affected TreS in which TreS activity was increased when maltose concentration was increased from 100 mM to 1000 mM (Fig. 6C). Recombinant TreS reached ~80% of maximal activity at 300 mM maltose and increased insignificantly at higher maltose concentration. NaCl, on the other hand, negatively affected TreS. Its activity was reduced by ~25% at 5 mM NaCl and almost completely inhibited at 50 mM NaCl (Fig. 6D). Similarly, KCl and MgCl2 reduced TreS activity at concentration of 5 mM (Fig. 6E). Surprisingly, imidazole increased TreS activity with higher TreS activity at higher imidazole concentration (Fig. 6F). This is the first time such positive effect of imidazole on TreS has been reported. The characteristics of TreS activity in our study were similar to other studies. The enzyme exhibited an optimal activity in temperature range of 35–37 oC and pH range of 7.4–7.5 (Ma et al., 2006; Yan et al., 2013; Wang et al., 2014; Liu et al., 2019); and was inhibited by Mg2+ and K+ (Yan et la., 2013). Under optimal conditions, TreS expressed in B. subtilis 1012 had the specific activity of 1.664 U/g, which was significantly higher than that of TreS isolated from P. putida H76 (Ma et al., 2006) and Thermomonospora curvata TreS expressed in B. licheniformis (Li et al., 2016) and as high as that of P. putida mutant TreS expressed on the surface of B. subtilis WB800N spores (Liu et al., 2019).

pdf10 trang | Chia sẻ: hachi492 | Lượt xem: 136 | Lượt tải: 0Freedownload
Bạn đang xem nội dung tài liệu Expression and characterization of recombinant trehalose synthase in bacillus subtilis, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
ACADEMIA JOURNAL OF BIOLOGY 2020, 42(4): 51–60 DOI: 10.15625/2615-9023/v42n4.14990 51 EXPRESSION AND CHARACTERIZATION OF RECOMBINANT TREHALOSE SYNTHASE IN Bacillus subtilis Nguyen Ngoc Trieu 1 , Nguyen Thi Quynh 1 , Nguyen Duc Hoang 3 , Nguyen Manh Dat 4 , Tran Duc Long 1,2 , Nguyen Thi Hong Loan 1,2,* 1 Key Laboratory of Enzyme and Protein Technology, VNUHN-University of Science 2 Faculty of Biology, VNUHN-University of Science 3 Faculty of Biology and Biotechnology, VNUHCM-University of Science 4 Food Industries Research Institute, Ministry of Industry and Trade Received 17 April 2020, accepted 28 September 2020 ABSTRACT Trehalose synthase (TreS, EC 2.4.1.245) is a potential catalyst for synthesis of trehalose, an important natural disaccharide. In this study, the treS gene of Pseudomonas putida (VTCC 12263) was cloned into pHT01 plasmid at BamHI-XbaI position, expressed in Bacillus subtilis (B. subtilis) 1012, and characterized. The recombinant TreS had molecular weight of 68 kDa when fused with 8xHis tag at the C-terminus. catalyzed conversion of maltose to trehalose in optimal conditions had specific activity of 1.664 U/g. Expression of TreS was highest when B. subtilis 1012 harboring pHT01-treS was cultured in TB medium at 30 o C, induced with 1.0 mM IPTG when OD600 reached 0.8 and harvested after 10 hours of induction. The recombinant TreS purified by Ni-sepharose chromatography had specific activity of 41.700 U/g and formed a single band on Western blot with monoclonal antibody against His-tag. The recombinant TreS had optimal activity at 37 o C in 100 mM pH 7.4 PBS and 300 mM maltose. It was inhibited by NaCl, KCl and MgCl2 (retaining 45% or 75% specific activity in buffer containing 5 mM KCl or 5 mM MgCl2, respectively) and stimulated by imidazol (with specific activity increasing by 30–200%). Keywords: Bacillus subtilis, cloning, expression of recombinant protein, enzyme characteristics, trehalose synthase. Citation: Nguyen Ngoc Trieu, Nguyen Thi Quynh, Nguyen Duc Hoang, Nguyen Manh Dat, Tran Duc Long, Nguyen Thi Hong Loan, 2020. Expression and characterization of recombinant trehalose synthase in Bacillus subtilis. Academia Journal of Biology, 42(4): 51–60. https://doi.org/10.15625/2615-9023/v42n4.14990 *Corresponding author email: [email protected] ©2020 Vietnam Academy of Science and Technology (VAST) Nguyen Ngoc Trieu et al. 52 INTRODUCTION Trehalose (1-α-D-glucopyranosyl-α-D- glucopyranoside), a useful non-reducing disaccharide with two glucoses linked by a α,α-1,1-glycoside linkage, is commonly found in yeasts, bacteria, invertebrates, plants and insects. Trehalose plays important roles as a carbon storage, and a component of the cell wall. It also has several applications in production and preservation of food, pharmaceuticals, cosmetics, and agricultural products (Liu et al., 2019). Trehalose synthase (TreS) catalyzes the synthesis of trehalose from maltose in a single step and is considered to be a convenient, economical, and practical biocatalyst for industrial production of trehalose owing to simple reaction and inexpensive substrate (Wang et al., 2014). TreS from different bacterial strains, such as Pseudomonas stutzeri, Corynebacterium glutamicum, Arthrobacter aurescens and Meiothemus ruber, has been expressed for trehalose production (Lee et al., 2005; Chen et al., 2006; Wu et al., 2009; Yue et al., 2009; Kim et al., 2010). Pseudomonas putida (P. putida), a non- pathogenic member of the genus Pseudomonas, colonizes many different environments and is well known for its metabolic and genetic diversity. This strain has also been extensively used as a host for gene cloning and expression of heterologous genes from gram-negative bacteria in soil. P. putida has been used in production of bioplastics, fine chemicals, as well as in plant growth promotion and plant pest control,... (Nogales et al., 2008). TreS from P. putida has been expressed but its activity was low (Ma et al., 2006; Li et al., 2016). treS isolated from P. putida KT2440 was expressed under the control of the T7 promoter in E. coli BL21 (DE3) and the conditions for producing of TreS at 10 L fermentation scale were optimized (Wang et al., 2014). However, E. coli is pathogenic and not safe for food production. Compared with E. coli, B. sutilis is a safe expression system. Since the method of transforming B. subtilis with plasmid DNA was discovered, B. subtilis has become an effective host for the expression of foreign genes. The advantages of B. subtilis include its non-pathogenic nature, being safe to use, its ability to secrete extracellular proteins directly into culture medium, easy genetic manipulation and rapid growth rate (Sarvas, 1995). In Vietnam, Nguyen et al. (2018) isolated a number of bacterial strains and found that P. putida (VTCC B2263) synthesized trehalose, however, treS has neither been cloned nor expressed. In this study, the treS gene was cloned from P. putida (VTCC 12263) and expressed in B. subtilis strain 1012 under the control of the promoter pgrac of pHT01 vector. This research provides the basis for production of safe recombinant TreS, which can be used in the food processing industry. MATERIALS AND METHODS P. putida (VTCC 12263) was bought from Vietnam Type Culture Collection, Institute of Microbiology and Biotechnology, Vietnam National University, Ha Noi. B. subtilis 1012 and pHT01 vector were from Nguyen et al. (2007). Construction of recombinant expression vector The cloning primers treS-F cggGGATCCATGACCCAGCCCGACCCGT C (the BamHI cleavage site is underlined and the start codon is in bold) and treS-R cggTCTAGATCAGTGATGGTGATGGTGAT GGTGATGAACATGCCCGCTGCTGTTGA (the XbaI cleavage site is underlined, the stop codon is in bold, and 24 nucleotides encoding 8 histidine are italic) were designed based on the treS gene sequence of P. putida KT2440 (Accession No: NC_002947.4). The treS-F and treS-R primers were used to amplify treS gene from P. putida (VTCC 12263) using Phusion High-Fidelity PCR Master Mix (Thermo Scientific). The PCR product (2106 Expression and characterization of recombinant 53 bp in size, of which 2064 bp is specific to treS) was digested with BamHI (NEB) and XbaI (NEB) and then ligated to pHT01, which had been digested with the corresponding restriction enzymes and dephosphorylated by QuickCIP (NEB). The ligation product was transformed into E. coli DH5 competent cells and bacteria were plated on LB agar medium supplemented with ampicillin 100 µg/mL. The recombinant pHT01 containing treS gene (pHT01-treS) was verified by PCR with cloning primers or pHT01-F TACGATCTTTCAGCCGACTC and pHT01- R ATCTCCATGGACGCGTGAC primers flanking pHT01 multiple cloning site and then sequenced. The pHT01-treS was transformed into B. subtilis 1012 to express recombinant TreS, which has a predicted molecular weight of approximately 68 kDa (67 kDa of TreS and ~1 kDa of 8xHis-tag) (Wang et al., 2014). Expression of recombinant TreS The recombinant B. subtilis 1012 harboring pHT01-treS was pre-cultured in 50 mL LB broth supplemented with 10 µg/mL chloramphenicol for 14–16 hours at 37 oC, shaking at 200 rpm (Phan et al., 2017). The starter culture was then diluted into four media: LB (15 g/L tryptone, 5 g/L yeast extract, 5 g/L NaCl, and 300 µl 3 M NaOH), LB containing 1% (w/v) glucose, terrific broth (TB; 12 g/L tryptone, 24 g/L yeast extract, 2.2 g/L KH2PO4, 9.4 g/L K2HPO4, and 8 mL/L glycerol) supplemented with 1% (w/v) glucose, and 2YT medium (16 g/L tryptone, 10 g/L yeast extract, 5 g/L NaCl) to OD600 of 0.05. Bacteria were grown at 18–37 oC under vigorous shaking (200 rpm) until OD600 reached 0.4–1.0. Expression of treS was induced by IPTG at different concentrations of 0.1–1 mM and cells were harvested 3–16 h after induction by centrifugation at 6000 rpm, 4 o C for 10 minutes. Cell mass was resuspended in 2 mL ice-cold buffer A (PBS pH 7.4 with 50 mM NaCl, 1 mM PMSF), sonicated and centrifuged at 12,000 rpm, 4 o C for 30 minutes to obtain the soluble fraction of the enzyme. Insoluble fraction was resuspended in 2 mL of 1X sample buffer containing SDS, and β- mecaptoethanol to completely dissolve insoluble protein. Puriffication of recombinant TreS using Ni-sepharose Immobilized metal affinity chromatography was used to purified recombinant TreS. One milliliter of Nickel– sepharose was packed into a column (7 × 1 cm), saturated with 4 mL of 50 mM NiCl2 flowing at a rate of 15–20 mL/h and equilibrated with 10 mL buffer A containing 5 mM imidazole at 20–30 mL/h. Weakly bound proteins were washed by buffer A containing 5 mM imidazol until A280 < 0.05. The bound proteins were then eluted from the column using buffer A containing 250 mM imidazole. Collected protein fractions were analyzed by SDS–PAGE and blotted with anti-6xHis-tag monoclonal antibodies. Western blot using anti-6xHis-tag monoclonal antibodies Western blot was carried out as previously described by Mahmood & Yang (2012). Crude extract of B. subtilis 1012 harboring pHT01-treS or purified protein fractions were seperated by SDS-PAGE and proteins were transferred onto PVDF (Polyvinylidene fluoride) membrane in Tris-Glycine containing 10% methanol. The membrane was blocked in PBS pH 7.4 containing 3% BSA at 4 o C overnight or 30–60 minutes at room temperature with constant agitation and then washed 3 times in PBS, pH 7.4 containing 0.1% Tween 80. After that, membrane was incubated with the primary anti-6xHis-tag monoclonal antibody (Clontech, USA) for one hour at room temperature, rinsed and incubated with secondary alkaline phosphatase (AP) conjugated antibody. Alkaline phosphatase converts colorless NBT (p-nitro blue Nguyen Ngoc Trieu et al. 54 tetrazolium chloride) and BCIP (5-bromo-4- chloro-3-indolyl phosphate) substrates in 0.1 M Tris-HCl pH 9.5 containing 5 mM MgCl2 and 0.1 M NaCl to colored substances, thus visualizing recombinant TreS. The reaction was stopped by incubating the membrane in 1x PBS pH 7.1 containing 20 mM EDTA. TreS activity assay Crude extracts of B. subtilis harboring or not haboring plasmids were incubated with maltose of different concentrations ranging from 100 mM to 1000 mM in 100 mM PBS pH 6.0–8.0 at 25–45 oC for 2 hours and then heated at 90 o C for 10 min to stop enzyme activity. Maltose will be converted to trehalose if TreS is present in the crude extract. Extracts of B. subtilis 1012, or B. subtilis 1012 harboring pHT01 vector or non-induced B. subtilis 1012 harboring pHT01-treS served as negative controls (without TreS). The amount of trehalose in the reaction product was measured by Trehalose Assay Kit (Megazyme, USA) following kit producer’s instruction. One unit of TreS was defined as the amount of enzyme that catalyzes the formation of 1 mg of trehalose in one hour. The relative enzyme activity (%) was defined as the percentage of enzyme activity in the control (Ma et al., 2006). RESULTS AND DISCUSSION Clonning of treS gene into pHT01 vector The treS gene was amplified from genome of P. putida by PCR with treS-F/R (Fig. 1A, lane 2) and inserted into the pHT01 plasmid. The recombinant pHT01-treS plasmid was verified by PCR with treS-F/R or pHT01-F/R primers (Fig.1B-C). PCR from the pHT01-treS produced a single DNA band of ~2 kb (Fig. 1B, lane 2) similar to PCR product from P. putida (Fig. 1A, lane 2) and a ~2,4 kb DNA band (~0,4 kb fragment around multiple cloning sites of pHT01 vector and ~2 kb of treS) (Fig. 1C, lane 5). Sequencing results of pHT01-treS confirmed that P. putida treS gene was cloned successfully into the pHT01 vector. Figure 1. Clonning of treS gene into pHT01 vector. M: DNA marker 1 kb; A1, B1, C1 and C4: no template controls; A2: treS amplified from P. putida using treS-F/R primers; B2: treS amplified from pHT01-treS using treS-F/R primers; C2: fragment amplified from empty pHT01 with pHT01-F/R primers; C5,: treS fragment amplified from pHT01-treS using pHT01-F/R primers Expression of TreS by pHT01-treS vector in B. subtilis 1012 Protein was extracted from B. subtilis 1012 harboring or not harboring plasmid and kb 1,5 2,5 M 1 2 1,0 2,0 treS 1,5 M 1 2 kb 2,5 2,0 1,0 treS A B C Expression and characterization of recombinant 55 analyzed by Western blot. The results indicated that recombinant TreS was only expressed in IPTG-induced B. subtilis 1012 harboring pHT01-treS in both soluble and insoluble forms (Fig. 2A, lanes 4 and 5). The recombinant TreS had a molecular weight of ~68 kDa as predicted, similar to TreS expressed in E. coli BL21 by Wang et al. (2014). Furthermore, the recombinant TreS converted maltose to trehalose with the specific activity of 1120 U/g (Fig. 2B). While other protein extracts did not shown any TreS activity (Fig. 2B). Figure 2. Western blot analysis (A) and activity plot (B) of extracts from B. subtilis 1012 harboring pHT01-treS vector M: protein marker, 1: extract of B. subtilis 1012 (), 2: extract of B. subtilis 1012 harboring pHT01 (); 3, 4: extracts of non-induced and induced B. subtilis 1012 harboring pHT01-treS (Δ), (), respectively; 5: insoluble fraction of B. subtilis 1012 harboring pHT01-treS vector. Suitable expression conditions of TreS using B. subtilis 1012 harboring pHT01- treS vector To improve expression of TreS, different cultivating media and induction conditions were tested. In each experiment, only one condition (induction time in Fig. 3A, IPTG concentration in Fig. 3B, culture temperature after induction in Fig. 3C, cutivation duration in Fig. 3D, medium composition in Fig. 3E and lactose induction in Fig. 3F) was changed while the other conditions were kept constant. The results showed that TreS expression was highest when bacteria were induced by 1.0 mM IPTG at the mid- exponential phase (OD600 = 0.8), subsequently cultured at 30 o C and harvested 10 hours after induction (Fig. 3A-D). Of the 4 media (LB, LB with 1% glucose (w/v), TB and 2YT) tested, the TB medium resulted in the highest TreS expresion (Fig. 3E). The recombinant TreS was under the control of synthetic Pgrac promoter containing E. coli lac operator, however, lactose (up to concentration of 20 mM, which is twice the usual lactose concentration) failed to induce recombinant TreS expression (Fig. 3F). In another study, Liu et al (2019) cultured B. subtilis WB800N in TB medium at 37 o C with extended cultivation time of 96 hours to express P.putida TreS. While in E. coli BL21, the highest expression of P. putida TreS was obtained when bacteria were grown in LB medium at 25 o C, induced by 0.6 mM IPTG at OD600 = 0.6 and harvested after 6 hours adding IPTG (Wang et al., 2014). A Nguyen Ngoc Trieu et al. 56 Figure 3. The effects of IPTG induction time (A), IPTG concentration (B), culture temperature after induction (C), cultivation duration (D), medium composition (E) and lactose concentration (F) on expression level of TreS using B. subtilis 1012 harboring pHT01-treS vector Initial purification of TreS from extract of B. subtilis 1012 harboring pHT01-treS vector Extract of B. subtilis 1012 harboring pHT01-treS vector was loaded onto the Ni- sepharose affinity column in buffer A containing 5 mM imidazol. The elution profile of Ni-sepharose (Fig. 4) showed that unbound fractions had a wide peak (peak 1) while bound fractions eluted by buffer A containing 250 mM imidazole had one narrow peak (peak 2). SDS-PAGE result showed a thick band at ~68 kDa besides several non specific protein bands (Fig. 5A, lane 5–6). This ~68 kDa band was also recognized specifically by anti-6xHis-tag monoclonal antibody (Fig. 5B, lane 5–6). In addition, these protein fractions converted maltose to trehalose with specific activity of 41.700 U/g, suggesting that the ~68 kDa band is truly recombinant TreS. 18oC 25oC 30oC 37oC LB LB with glucose 2YT TB Expression and characterization of recombinant 57 Figure 4. Elution profile of TreS from extract of B. subtilis 1012 harboring pHT01-treS vector using Ni-sepharose column Figure 5. SDS-PAGE (A) and Western blot (B) of purified fractions from extract of B. subtilis 1012 harboring pHT01-treS M: protein marker, 1-2: extracts of non-induced and induced B. subtilis 1012 harboring pHT01- treS, respectively; 3: Ni-sepharose unbound fraction, 4-7: fractions bound to Ni-sepharose eluted with imidazole at 58 th -61 st mL, respectively. Characteristics of TreS activity Trehalose synthesis acitivity of recombinant TreS was tested under different conditions. The results showed that TreS was active in a wide range of temperature of 25– 40 o C and most active at 37 o C (Fig. 6A). In addition, TreS activity was highest in pH 7.4– 8.0 and significantly reduced when pH was lower than 7.4 (Fig. 6B). Maltose positively affected TreS in which TreS activity was increased when maltose concentration was increased from 100 mM to 1000 mM (Fig. 6C). Recombinant TreS reached ~80% of maximal activity at 300 mM maltose and increased insignificantly at higher maltose concentration. NaCl, on the other hand, negatively affected TreS. Its activity was reduced by ~25% at 5 mM NaCl and almost completely inhibited at 50 mM NaCl (Fig. 6D). Similarly, KCl and MgCl2 reduced TreS activity at concentration of 5 mM (Fig. 6E). Surprisingly, imidazole increased TreS activity with higher TreS activity at higher imidazole concentration (Fig. 6F). This is the first time such positive effect of imidazole on TreS has been reported. The characteristics of TreS activity in our study were similar to other studies. The enzyme exhibited an A B Nguyen Ngoc Trieu et al. 58 optimal activity in temperature range of 35–37 o C and pH range of 7.4–7.5 (Ma et al., 2006; Yan et al., 2013; Wang et al., 2014; Liu et al., 2019); and was inhibited by Mg 2+ and K + (Yan et la., 2013). Under optimal conditions, TreS expressed in B. subtilis 1012 had the specific activity of 1.664 U/g, which was significantly higher than that of TreS isolated from P. putida H76 (Ma et al., 2006) and Thermomonospora curvata TreS expressed in B. licheniformis (Li et al., 2016) and as high as that of P. putida mutant TreS expressed on the surface of B. subtilis WB800N spores (Liu et al., 2019). CONCLUSION The P. putida treS gene was cloned into pHT01 vector and expressed in B. subtilis. Recombinant TreS was fused with 8xHis-tag at the C terminus, had molecular weight of ~68 kDa and specific activity of 1120 U/g. Expression of TreS was the highest when B. subtilis 1012 harboring pHT01-treS was cultured in TB medium at 30 o C with vigorous shaking, induced by 1.0 mM IPTG when OD600 reached 0.8 and harvested 10 hours after induction. Ni-sepharose purified TreS had specific activity of 41.700 U/g and generated a single band on Western blot with monoclonal antibody against 6xHis-tag. TreS had optimal activity at 37 o C in 100 mM PBS pH 7.4 buffer and 300 mM maltose. It was inhibited by NaCl, KCl and MgCl2 at concentration of 5 mM (remained activity from 75−45%) and activated by imidazole (activity increased by 30–200%). Under optimal conditions, TreS expressed in B. subtilis 1012 had specific activity of 1.664 U/g. Figure 6. The effect of temperature (A), pH (B), maltose (C), NaCl (D), MgCl2, KCl 5 mM (E) and Imidazole (F) on TreS activity 0 20 40 60 80 100 25oC 30oC 37oC 40oC 45oC 50oC R el a ti v e a ct iv it y (% ) Temperature (oC) A. The effect of reaction temperature 0 25 50 75 100 R el a ti v e a ct iv it y ( % ) pH B. The effect of pH 0 25 50 75 100 0.05 0.1 0.2 0.3 0.5 1.0 R el a ti v e a ct iv it y ( % ) [Maltose] (M) C. The effect of Maltose concention 0 25 50 75 100 0.0 5.0 10.0 50.0 R el a ti v e a ct iv it y ( % ) [NaCl] (mM) D. The effect of NaCl 0 25 50 75 100 0 Mg2+ K+R el a ti v e a ct v it y ( % ) E. The effect of metal ions 25o 30oC 37oC 40oC 45oC 0 Mg2+ K + 0 25 50 75 100 0.0 5.0 10.0 50.0 R el a ti v e a ct iv it y ( % ) Imidazol (mM) F. The effect of Imidazol Expression and characterization of recombinant 59 Acknowledgements: This research was financially supported by the Ministry of Science and Technology of Vietnam (project code ĐTĐLCN.11/18). The authors would like to thank Vietnam Type Culture Collection, Institute of Microbiology and Biotechnology, Vietnam National University, Ha Noi for providing Pseudomonas putida VTCC 12263 strain. REFERENCES Chen Y. S., Lee G. C., Shaw J. F., 2006. Gene Cloning, Expression, and Biochemical Characterization of a Recombinant Trehalose Synthase from Picrophilus torridusin in Escherichia coli. J. Agric. Food Chem., 54: 7098–7104. Kim T. K., Jang J. H., Cho H. Y., Lee H. S., Kim Y. W., 2010. Gene cloning and characterization of a trehalose synthase from Corynebacterium glutamicum ATCC13032. Food Sci. Biotechnol., 19: 565–569. Lee J. H., Lee K. H., Kim C. G., Lee S. Y., Kim G. J., Park Y. H., Chung S. O., 2005. Cloning and expression of a trehalose synthase from Pseudomonas stutzeri CJ38 in Escherichia coli for the production of trehalose. Appl. Microbiol. Biotechnol., 68: 213–219. Li Y., Gu Z., Zhang L., Ding Z., Shi G., 2016. Inducible expression of trehalose synthase in Bacillus licheniformis. Protein Expr. Purif., 10.005 Lim H. K., Lee S. U., Chung S. I., Ung K. H., Seo J. H., 2004. Induction of the T7 Promoter Using Lactose for Production of Recombinant Plasminogen Kringle 1−3 in Escherichia coli. J. Microbiol. Biotechnol. 14: 225–230. Liu H., Yang S., Wang X., Wang T., 2019. Production of trehalose with trehalose synthase expressed and displayed on the surface of Bacillus subtilis spores. Microb. Cell Fact., 18: 1–13. Ma Y., Xue L., Sun D.W. 2006., Characteristics of trehalose synthase from permeablized Pseudomonas putida cells and its application in convertin maltose into trehalose. J. Food. Eng., 77: 342–347. https://doi.org/10.1016/ j.jfoodeng.2005.06.042 Mahmood T., Yang P. C. 2012., Western blot: technique, theory, and trouble shooting. N. Am. J. Med. Sci., 4: 429–434. Nogales J., Palsson B., Thiele I., 2008. A genome-scale metabolic reconstruction of Pseudomonas putida KT2440: iJN746 as a cell factory. BMC Systems Biology, 2: 1–20. https://doi.org/10.1186/1752-0509- 2-79 Nguyen H. D., Phan T. T. P., Schumann W., 2007. Expression vectors for the rapid purification of recombinant proteins in Bacillus subtilis. Current Microbiology, 55: 89–93. Nguyen T. H. T., Nguyen T. T., Le T. H., Nguyen T. A. T., Nguyen M. D., Le D. M., Do T. T., 2018. Screening bacterial strains for production of maltooligosyl trehalose trehalohydrolase and maltooligosyl trehalose synthase. Journal of Vietnamese Environment, 9(2): 55–60. Phan T., Huynh P., Truong T., Nguyen H., 2017. A generic protocol for intracellular expression of recombinant protein in Bacillus subtilis. Methods Mol. Biol., 1586: 325–334. Sarvas M., 1995. Gene expression in recombinant Bacillus. Bioprocess. Technol., 22: 53–120. Wang T., Jia S., Dai K., Liu H., Wang R., 2014. Cloning and expression of a trehalose synthase from Pseudomonas putida KT2440 for the scale-up production of trehalose from maltose. Canadian Journal of Microbiology, 60(9): 599–604. https://doi.org/10.1139/ cjm- 2014-0330 Xiuli W., Hongbiao D., Ming Y., Yu Q., 2009. Gene cloning, expression, and characterization of a novel trehalose Nguyen Ngoc Trieu et al. 60 synthase from Arthrobacter aurescens. Applied microbiology and biotechnology, 83(3): 477–482. https://doi.org/ 10.1007/s00253-009-1863-5 Yan J., Qiao Y., Hu J., Ding H., 2013. Cloning, expression and characterization of a trehalose synthase gene from Rhodococcus opacus. Protein J., 32: 223–229. Yue M., Wu X. L., Gong W. N., Ding H. B., 2009. Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei. Microb. Cell Fact., 8: 34.

Các file đính kèm theo tài liệu này:

  • pdfexpression_and_characterization_of_recombinant_trehalose_syn.pdf
Tài liệu liên quan