Fusing two phytase genes by PCR - Driven overlap extension

PCR screening of positive clone harbouring fusion C1A2 gene (a) and determination of fusion C1A2 gene of 2.5 Kb by restriction endonuclease (b); M: 1Kb DNA ladder; PC: positive clone harbouring 1.5 Kb fragment of phyC gene; 16 - 20: different clones grown on LB after the ligation; 1: undigested pE10C2 harbouring 1.5 Kb fragment of phyC gene; 1dig: digested pE10C2 by XhoI and HindIII; 2: undigested plasmid extract from clone 20; 2dig: digested plasmid extract from clone by XhoI and HindIII The molar ratio of 2 C1A2: 1 vector and the ligation at 22 ºC for 30 minutes produced many colonies on LB agar plate. Figure 5a shows the result of PCR screening on these colonies. Among them, a positive clone (clone 20) was detected to carry fusion gene of phyC - linker - appA (C1A2). Double digestion the plasmid from clone 20 with XhoI and HindIII (Figure 5b) confirmed that the recombinant plasmid from clone 20 carries a fusion gene which is about 2.5 Kb in length. No positive clone was detected in the ligation mixture of A1C2 and vector pJET1.2. The molar ratio of insert, vector and the condition of this ligation reaction need to be optimized more, in order to get a positive clone.

pdf10 trang | Chia sẻ: hachi492 | Lượt xem: 177 | Lượt tải: 0Freedownload
Bạn đang xem nội dung tài liệu Fusing two phytase genes by PCR - Driven overlap extension, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
JOURNAL OF SCIENCE OF HNUE DOI: 10.18173/2354-1059.2016-0068 Natural Sci. 2016, Vol. 61, No. 9, pp. 152-161 This paper is available online at 152 FUSING TWO PHYTASE GENES BY PCR - DRIVEN OVERLAP EXTENSION Tran Thi Thuy, Mai Kim Tuyen and Pham Thi Thuy Hang Faculty of Biology, Hanoi National University of Education Abstract. The PCR-driven overlap extension is a modern technique to fuse two or more DNA fragments. Two genes, appA coding for acidic phytase from E. coli B and the phyC coding for alkaline phytase from Bacillus subtilis, were successfully fused using a linker of five residues to form an overlapping primers. The conditions of the two PCR components (PCR1) were optimized; Playing an important role in the yield of PCR products, annealing temperature (of 62 ºC and 57 ºC) was chosen to amplify appA1 and appA2 genes, respectively; and 55 ºC was chosen to amplify both phyC1 and phyC2 in PCR1. In the second PCR (PCR2), similarly, 55 ºC was chosen to extend the overlapping primer, while 64/66 ºC was to amplify fusion genes. A fusion gene of phyC - linker - appA (C1A2) was successful cloned into pJET1.2 resulted in a positive clone of E. coli DH5α. Keywords: Phytase, fusion gene, PCR overlap extension, phyC, appA. 1. Introduction The strategy of fusing proteins to get new characteristics in a fusion protein has been of the interest of scientists since the twentieth century. Gene technology and protein engineering have widely been used to fuse two or more proteins/peptides to create fused proteins which have a stronger substrate binding, an affinity tag for purification, and a catalytic site in an anti-body [1-3]. Alcantara et al. (2007) were successful in preparing two structures of fusion lysozymes: T7K11-lysozyme which contains T7 lysozyme at N-terminal and K11 lysozyme at C terminal, together with K11T7-lysozyme which contains K11 lysozyme at N- terminal and T7 lysozyme at C terminal. These two fusion lysozymes showed 45% higher activity than both native enzymes. Wild type lysozymes lost amidase activity at 75 ºC, however, K11T7-lysozyme retained some at this temperature, and completely lost amidase activity at 85 ºC [1]. A fusion enzyme which has aldolase activity of fructoza-1,6-bisphosphate aldolase (FBPA) from Staphylococcus carnosus, and kinase activity of dihydroxyacetone kinase (DHAK) from Citrobacter freundii CECT 4626 was constructed by Iturrate et al. (2010). Overlap extension PCR method has been used to fuse two enzymes with a linker of five residues (Gln-Gly-Gln-Gly-Gln) which connected these two enzymes. Fusion enzyme (Dhak-Linker-FBPA) was cloned, and expressed in E. coli BL21 (DE3). Purified enzyme showed a faster reaction speed (substrate was transformed at the rate of 0.41 mmol/min) compared to the reaction speed of two separate enzymes Received April 6, 2016. Accepted November 30, 2016. Contact Tran Thi Thuy, e-mail address: [email protected] Fusing two phytase genes by PCR - driven overlap extension 153 in a reaction (0.02 mmol/min). The increase in reaction speed, due to the substrate transportation between the two enzymes fused together, was faster, more efficient and continuous than that between the two enzymes separated in a reaction solution [2]. Overlap extension PCR was successfully used to construct a mosaic enzyme Glu-Xyl by Lu et al in 2006. Gene coding for Glu-Xyl enzyme contains 1.275 bp and the enzyme is 46 KDa. This recombinant enzyme has xylanase activity from B. subtilis 168, and β-glucanase activity from B. amyloliquefaciens 1.831. Compared to the native enzymes, Glu-Xyl showed 3.15 times higher activity than native glucanase and 31% lower activity than native xylanase [3]. In this paper, we report the use of overlap extension PCR method to fuse two phytase genes: one coding for acid phytase from E. coli B, and the other coding for alkaline phytase from Bacillus subtilis. 2. Content 2.1. Materials and methods 2.1.1. Materials Micro-organism: Escherichia coli DH 5α and E. coli B were purchased from Novagen to be used as a cloning host and a source of acidic phytase gene (appA), respectively. Alkaline phytase gene (phyC) was obtained from recombinant E.coli BL21(DE3) carrying phyC in recombinant plasmid pE10C2 [4]. Plasmid DNA and primer: pJET1.2 was purchased from Thermo-scientific Fermentas to use as cloning vector. Primers using in polymerase chain reaction (PCR) are listed in Table 1. Table 1. Primers used in overlap extension PCR No. Name of primer 5 ’ - 3 ’ nucleotide sequence of primers 1 T1-F AAGCTTCAGAGTGAGCCGGAGCTGAAG 2 T2-R ATTGGTGGTATTGGTCAAACTGCACGCCGGTATG 3 T3-F ACCAATACCACCAATCTGTCTGATCCTTATCATTTTACCGTG 4 T4-R CTCGAGTTTTCCGCTTCTGTCGGTC 5 T5-F AAGCTTCTGTCTGATCCTTATCATTTTACCGTG 6 T6-R ATTGGTGGTATTGGTTTTTCCGCTTCTGTCGGTC 7 T7-F ACCAATACCACCAATCAGAGTGAGCCGGAGCTGAAG 8 T8-R CTCGAGCAAACTGCACGCCGGTATG Note: Underline letters are the sequence of linkers, bolt letters are sequence of restriction enzymes (XhoI and HindIII) Media and chemicals: Luria-Betani (LB) medium was purchased from Difco, 100 mg ampicillin was added per litter medium when it is used to cultivate E. Coli strain haboring Tran Thi Thuy, Mai Kim Tuyen and Pham Thi Thuy Hang 154 pJET1.2 or pE10C2. All chemicals (Ampicillin, dNTPs, agarose, ethidium bromide, EDTA, Tris- base, HCl), and enzymes (phusion DNA polymerase, restriction enzymes) are analytical grade. 2.1.2. Methods * Extraction of total genomic DNA A separated colony of E. coli strain on LB agar medium was tricked and cultivated overnight in 2 mL of LB medium, at 37 ºC, in an orbital shaker at 200 rpm/min. Bacterial cells were collected by centrifugation at 6000 rpm/min for 10 minutes, then subjected to cell disruption, and DNA purification by Gene Jet Genomic DNA purification kit R1511 (Thermo-Fisher scientific). * Overlap extension PCR Overlap extension PCR is used to fuse two DNA fragments when they have a complementary sequence overlapped each other. In this case, the overlapped sequence is a suitable linker included in revert primer of the first DNA sequence (phyC1 or appA1), and also in the forward primer of the second DNA sequence (phyC2 or appA2) to construct two kinds of fused enzyme (A1C2 and C1A2). The A1C2 has appA at C-terminal, and phyC at N-terminal; the C1A2 has phyC at C-terminal and appA at N-terminal. The PCR overlap extension to amplify fusion phytase was designed in two PCR reactions which occurred in sequence. In the first PCR, appA and phyC genes were amplified separately, they then purified, and used as a DNA template and also as the overlapped primers for the second PCR (Figure 1). The content and thermo-cycle of each PCR shall be investigated to gain the highest PCR product. * DNA electrophoresis Sample of total genomic DNA or PCR products of two steps of overlap extension PCR were subjected to electro-phoresis on 0.8% agarose gel in TAE buffer at 100V. DNA fragments on agarose gel were, then stained in the solution of ethidium bromide 0.5 mg/L for 30 minutes, and visualized under UV light in order to verify DNA molecular weight, purity, and quantity prior to further experiments. Figure 1. Two steps of overlap extension PCR to fuse appA gene to phyC gene Fusing two phytase genes by PCR - driven overlap extension 155 * DNA extraction and purification from agarose gel Target DNA fragment on agarose gel were excised and melted at 60 ºC in binding buffer of Quick gel extraction kit (K210012) from Thermo-Fisher scientific. Following different steps of the Kit, DNA fragment, then be recovered in silica membrane and eluted in TB buffer. Pure DNA samples were stored at -20 ºC for further experiments. * Ligation of fusion DNA fragment to pJET 1.2 vector This method allows blunt DNA fragment to be ligated in to pJET1.2 vector (Fermentas). Sticky ends of fusion DNA fragments were eliminated by a blunting enzyme. Fusion DNA was mixed with linear pJET1.2 vector in the ligation; buffer with the molar ratio of 3:1. T4-DNA ligase was added; and ligation occurred at 22 ºC for 30 minutes prior to transform to E. coli DH5α competent cells. * Preparation of E. coli DH5α competent cells E. coli DH5α competent cells were chemically prepared [4], and stored at -80 ºC before using in DNA transformation by heat-shock method. A singe colony of E. coli DH5α was picked from agar plate, cultivated overnight in 5 mL LB broth, at 37 ºC and 200 rpm. This culture (3 was used to inoculate 150 mL of the same medium at the same condition in gyratory shaker incubator. When the optical density (OD) of the culture at 600nm reached 0.4 - 0.6, E. coli cells were collected by centrifugation at 4 ºC, 5000 rpm for 10 minutes. Cells were dispersed in 37.5 mL of cold 100mM MgCl2, incubated in ice for 5 minutes before collected by centrifugation at 4000 rpm, and 4 ºC for 10 minutes. Cells then continued be dispersed in 7.5 mL of cold 100 mM CaCl2, incubated in ice for 10 minutes before being collected by centrifugation at 4000 rpm., and 4 ºC for 10 minutes. Finally, E. coli cells were dispersed well in 1.5 mL solution of 100 mM CaCl2 containing 15% glycerol, divided in small tubes (50 µL competent cell per tube), and stored at -80 ºC. Transformation frequency of E. coli competent cell was checked before DNA transformation. Known concentration of pUC19 (10 ρM) was mixed with 50 µL competent cell and heat shocked at 42 ºC for 90 seconds before being spred on LB agar plate containing 100 mg/L of ampicillin and incubated at 37 ºC. Transformation frequency was calculated based on the colonies grown: about 5 × 10 6 or more colonies per µM of plasmid are considered good competent cells. * DNA transformation and selection of positive clone Prior to the transformation, E. coli competent cells were thawed in ice for about 15 to 30 minutes; 3 to 5 µL of ligation mixture was added, and the competent cell tube were incubated in ice for 30 minutes. Heat shock the tube at 42 ºC for 90 seconds before spreading on LB agar plate containing 100mg/L of ampicillin, and incubating at 37 ºC overnight to collect colonies. Colonies were collected and checked for the present of fusion DNA fragment by PCR screening [5]. Single colony was dispersed in 50 µL of de-ionized water; incubate 10 minutes in boiling water to break cells, centrifuged 12000 rpm for 2 minutes to collect the supernatant. This supernatant (5 µL) was used as DNA template for 35 cycles of PCR screening (94 C for 1 minute, 55 °C for 1 minute, 72 °C for 2 minute) accompany by an extra extending step at 72 °C for 7 minutes. PCR products were checked on agarose gel to confirm the present of fusion DNA fragment. Tran Thi Thuy, Mai Kim Tuyen and Pham Thi Thuy Hang 156 2.2. Results and discussion 2.2.1. Designing primers for fusion phytase gene Gene banks and protein data base (PDB) were scanned to look for acidic and alkaline phytases coding genes. Due to the codon bias between eukaryotic and prokaryotic cells, we decided to use 13 sequences of E. coli phytase (an acidic phytase) and 8 sequences of Bacillus subtilis phytase (an alkaline phytase) to design primers for fusion phytase gene. Result of the analysis of the restriction endonuclease sites on these 21 DNA sequence has led to use HindIII and XhoI site on the primers, due to the absence of these two restriction enzyme sites on DNA sequences coding for both phytases. Data base of natural linker was check for a linker having a suitable length and structure which allow the two phytases to be flexible enough to show their activity in their fusion forms. A sequence of 5 residues (Thr-Asn-Thr-Thr-Asn) was chosen since: (1) DNA sequence coding for this 5 residues does not have restriction site of HindIII and XhoI, (2) this linker sequence containing all aliphatic and neutral residues which may not interfere the structure of the two phytases fused at the two ends of this linker, (3) the structure of this linker is quite open, allowing the two fused phytases to be quite flexible. Structure and sequence of a chosen linker are shown in Figure 2 and Table 2. Figure 2. Structure of alkaline phytase from Bacillus subtilis (a), linker (b) and acidic phytase from E. coli (source: PDB and Natural linker data base) Table 2. Sequence of chosen linker for fusion phytase Amino acid sequence DNA sequence Linker Thr-Asn-Thr-Thr-Asn (TNTTN) ACCAATACCACCAAT This linker allowed us to design two structures of fusion phytase: Fusing two phytase genes by PCR - driven overlap extension 157 (1) appA - linker - phyC (A1C2) consist of acidic phytase at N terminal and alkane phytase at C terminal. (2) phyC - linker - appA (C1A2) consist of alkane phytase at N terminal and acidic phytase at C terminal. Primers designed for A1C2 structure are T1-F, T2-R, T3-F, T4-R and for C1A2 structure are T5-F, T6-R, T7-F, T8-R (Table 1). Melting temperature of each primer was determined based on their sequence. 2.2.2. Amplification of alkaline and acidic phytase genes separately in PCR1 Annealing temperature for each PCR reaction was designed based on the melting temperature of primers. However, changing this temperature from 55 to 67 ºC showed strong effect to the yield of PCR products (Table 3). Increasing the concentration of Phusion HF DNA polymerase in PCR reaction to 2 IU/reaction also improved the yield of PCR reaction. Table 3. Effect of annealing temperature and the concentration of DNA polymerase to the yield of PCR reaction to amplify appA and phyC gene PCR product Annealing temperature (ºC) Concentration of Phusion HF DNA polymerase (u/µL) Yield of PCR product appA1 62 1 u/50 µL + 60 1 u/50 µL - 57 1 u/50 µL - 62 2 u/50 µL +++ appA2 67 2 u/50 µL ++ 67 1 u/50 µL - 65 1 u/50 µL - 62 1 u/50 µL - 60 1 u/50 µL + 57 1 u/50 µL ++ 57 2 u/ 50 µL +++ phyC1 62 1 u/50 µL + 60 1 u/50 µL ++ 55 1 u/50 µL +++ phyC2 62 1 u/50 µL + 60 1 u/50 µL ++ 55 1 u/50 µL +++ Note: (-) no product; (+) (++) (+++) from faint band  light band  intensive band of product Tran Thi Thuy, Mai Kim Tuyen and Pham Thi Thuy Hang 158 In the range of 100 ng - 1000 ng per 50 µL reaction, the concentration of DNA template did not show strong effect to the amplification of phyC gene; however, it showed some effects on the amplification of appA gene. In this case, different DNA extraction methods could introduce different inter-ferences to PCR reaction. Therefore, we have chosen the concentration of 187 ng DNA template per 50 reaction for undergoing the PCR1 to amplify appA gene. AppA and phyC genes were amplified in separated reactions, and purified from the agarose gel (Figure 3) to be the DNA template for PCR2. Figure 3. Amplification of appA and phyC genes in PCR1 PCR product of appA1 and appA2 (a); appA1, appA2 after purification (b); and PCR product of appA1 and appA2 (c); phyC1, phyC2 after purification (d); First lane of each gel is 1Kb DNA ladder After purification, DNA concentration of each gene was determined by spectro-photo-metter: The concentration of appA1 is 50 ng/µL and appA2 is 40 ng/µL; the concentration of phyC1 and phyC2 were 180 and 90 ng/µL, respectively. 2.2.3. Amplification of fusion phytase genes in PCR2 In PCR2 (an overlap extension reaction), the annealing temperature, the concentration and the molecular ratio of template genes play a vital role in order to get good yield of PCR product. Due to the different melting temperature (Tm) of the primers and the linker, we decided to use two annealing steps at two different temperatures. The first step (PCR2a) use Tm of the linker to design the annealing temperature of PCR2 in order to improve the annealing possibility of the linker from different gene (phyC and appA). The second step (PCR2b) use Tm of normal primers listed in Table 1 to design the annealing temperature of PCR2. Figure 4 shows the effect of PCR2a and PCR2b annealing temperature to the yield of PCR2 product. Table 4 shows the effect of PCR2b annealing temperature, and the molar ratio of template DNA to the yield of PCR2 product. Fusing two phytase genes by PCR - driven overlap extension 159 Figure 4. Amplification of fusion genes in PCR2 Effect of PCR2a annealing temperature to the yield of PCR2a product (a); Effect of PCR2b annealing temperature to the yield of PCR2b product (b); M: 1Kb DNA ladder; Pur: purified DNA fragment of fusion gene Table 4. Effect of annealing temperature, the molar ratio of DNA template to the yield of PCR2 reaction to amplify fusion gene Fusion gene Tm of PCR2b (ºC) Molar ratio of DNA template (mol/mol) PCR product appA - linker - phyC (A1C2) 68 appA1: 3 phyC2: 1 + 68 appA1: 4 phyC2: 1 + 68 appA1: 5 phyC2: 1 - 68 appA1: 1 phyC2: 3 - 68 appA1: 1 phyC2: 4 - 68 appA1: 1 phyC2: 5 + 66 appA1: 1 phyC2: 5 ++ phyC – linker – appA (C1A2) 68 phyC1: 3 appA2: 1 - 68 phyC1: 4 appA2: 1 - 68 phyC1: 5 appA2: 1 + 68 phyC1: 1 appA2: 3 + 68 phyC1: 1 appA2: 4 - 68 phyC1: 1 appA2: 5 - 64 phyC1: 1 appA2: 3 ++ Note: (-) no product; (+)  (++) (+++) from faint band  light band  intensive band of product Tran Thi Thuy, Mai Kim Tuyen and Pham Thi Thuy Hang 160 Based on the result in Figure 4 and Table 4, the condition of PCR2 to amplify fusion phytases was chosen bellow: (1) To amplify appA – linker – phyC (A1C2), the molar ratio of template DNA should be 1 appA (A1) : 5 phyC (C2), annealing temperature should be 55 ºC for PCR2a and 66 ºC for PCR2b. (2) To amplify phyC – linker – appA (C1A2) the molar ratio of template DNA should be 1 phyC (C1) : 3 appA (A2), annealing temperature should be 55 ºC for PCR2a and 64 ºC for PCR2b. 2.2.4. Cloning fusion phytase genes to pJET1.2 vector in E. coli DH5α Ligation was carried out between purified fragment of fusion genes (A1C2 and C1A2) and pJET1.2 vector. This is a blunt end ligation; therefore, blunting enzyme was used to clip out any extra end of PCR product due to the overwork of DNA polymerase. The molar ratio of DNA insert, together with the vector play an important role in the ligation mixture. This ratio has been vary from 5:1 to 1:1 in a ligation reaction, at room temperature (22 ºC), from 5 to 30 minutes. Five micro-liters of each ligation were mixed, then transformed to E. coliDH5α by heat-shock at 42 ºC for 90 seconds before being spred on LB agar plate containing 100mg/L of ampicillin, and incubated at 37 ºC overnight to collect colonies. Figure 5. Screening for a clone harboring a fusion genes PCR screening of positive clone harbouring fusion C1A2 gene (a) and determination of fusion C1A2 gene of 2.5 Kb by restriction endonuclease (b); M: 1Kb DNA ladder; PC: positive clone harbouring 1.5 Kb fragment of phyC gene; 16 - 20: different clones grown on LB after the ligation; 1: undigested pE10C2 harbouring 1.5 Kb fragment of phyC gene; 1dig: digested pE10C2 by XhoI and HindIII; 2: un- digested plasmid extract from clone 20; 2dig: digested plasmid extract from clone by XhoI and HindIII The molar ratio of 2 C1A2: 1 vector and the ligation at 22 ºC for 30 minutes produced many colonies on LB agar plate. Figure 5a shows the result of PCR screening on these colonies. Among them, a positive clone (clone 20) was detected to carry fusion gene of phyC - linker - appA (C1A2). Double digestion the plasmid from clone 20 with XhoI and HindIII (Figure 5b) confirmed that the recombinant plasmid from clone 20 carries a fusion gene which is about 2.5 Kb in length. Fusing two phytase genes by PCR - driven overlap extension 161 No positive clone was detected in the ligation mixture of A1C2 and vector pJET1.2. The molar ratio of insert, vector and the condition of this ligation reaction need to be optimized more, in order to get a positive clone. 3. Conclusion Based on the PCR overlap extension, two fusion genes (appA - linker - phyC and phyC - linker - appA) which consist of appA phytase gene from E. coli B, phyC phytase gene from Bacillus subtilis MD2 and a linker of five residues has been constructed. The condition of the two PCR components were optimized: PCR1 used 187 ng DNA template per 50 µL reaction to amplify appA gene, annealing temperature was 62 ºC for appA1 and 57 ºC for appA2; the concentration of DNA template between 100 ng - 1000 ng per 50 µL reaction did not affect to the amplification of phyC gene, annealing temperature was 55 ºC for both phyC1 and phyC2. PCR2 used the product of PCR1 as a DNA template and also as an overlapping primer to amplify fusion phytase genes. Two annealing temperatures were used, 55 ºC for PCR2a and 64/66 ºC for PCR2b. Ligation of the fusion gene to the pJET1.2 resulted in a positive clone of E. coli DH5α harboring phyC - linker - appA (C1A2) fusion gene. Acknowledgment. The financial support by the International Foundation for Science (IFS) for this work is gratefully acknowledged. REFERENCES [1] Alcantara EH, Kim DH, Do SIand Lee SS, 2007. Bi-functional activities of chimeric lysozymes constructed by domain swapping between bacteriophage T7 and K11 lysozymes. Journal of Biochemistry and Molecular Biology, Vol. 40(4), pp. 539-546. [2] Iturrate L, Oroz-Guinea ISM, Pérez-Gil J and García-Junceda E, 2010. Preparation and characterization of a bifunctional aldolase/kinase enzyme. A more efficient biocatalyst for C-C bond formation. Chemistry - A European Journal, Vol.16(13), pp. 4018-30. [3] Lu P, Feng MG, Li WF, Hu CX, 2006. Constructionand characterization of a bifunctional fusion enzyme of Bacillus - Sourcedb β-glucanase and xylanase expressed in Escherichia coli. FEMS Microbiology Letter, Vol. 261, pp. 224-230. [4] Thuy Thi Tran, Gashaw Mamo, Bo Mattiasson, Rajni Hatti-Kaul, 2010. A thermostable phytase from Bacillus sp. MD2: cloning, expression and high-level production in Escherichia coli. Journal of Industrial Microbiology and Biotechnology, Vol. 37, pp. 279-287. [5] Sambrook J, Russell D W, 2001. Molercular cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, Vol. 1,2, pp. 1.31-1.38; 8.18-8.30.

Các file đính kèm theo tài liệu này:

  • pdffusing_two_phytase_genes_by_pcr_driven_overlap_extension.pdf