JOURNAL OF SCIENCE OF HNUE DOI: 10.18173/2354-1059.2016-0068
Natural Sci. 2016, Vol. 61, No. 9, pp. 152-161
This paper is available online at
152
FUSING TWO PHYTASE GENES BY PCR - DRIVEN OVERLAP EXTENSION
Tran Thi Thuy, Mai Kim Tuyen and Pham Thi Thuy Hang
Faculty of Biology, Hanoi National University of Education
Abstract. The PCR-driven overlap extension is a modern technique to fuse two or more DNA
fragments. Two genes, appA coding for acidic phytase from E. coli B and the phyC coding for
alkaline phytase from Bacillus subtilis, were successfully fused using a linker of five residues
to form an overlapping primers. The conditions of the two PCR components (PCR1) were
optimized; Playing an important role in the yield of PCR products, annealing temperature
(of 62 ºC and 57 ºC) was chosen to amplify appA1 and appA2 genes, respectively; and 55 ºC
was chosen to amplify both phyC1 and phyC2 in PCR1. In the second PCR (PCR2), similarly,
55 ºC was chosen to extend the overlapping primer, while 64/66 ºC was to amplify fusion
genes. A fusion gene of phyC - linker - appA (C1A2) was successful cloned into pJET1.2
resulted in a positive clone of E. coli DH5α.
Keywords: Phytase, fusion gene, PCR overlap extension, phyC, appA.
1. Introduction
The strategy of fusing proteins to get new characteristics in a fusion protein has been of the
interest of scientists since the twentieth century. Gene technology and protein engineering have
widely been used to fuse two or more proteins/peptides to create fused proteins which have a
stronger substrate binding, an affinity tag for purification, and a catalytic site in an anti-body [1-3].
Alcantara et al. (2007) were successful in preparing two structures of fusion lysozymes:
T7K11-lysozyme which contains T7 lysozyme at N-terminal and K11 lysozyme at C terminal,
together with K11T7-lysozyme which contains K11 lysozyme at N- terminal and T7 lysozyme at
C terminal. These two fusion lysozymes showed 45% higher activity than both native enzymes.
Wild type lysozymes lost amidase activity at 75 ºC, however, K11T7-lysozyme retained some at
this temperature, and completely lost amidase activity at 85 ºC [1].
A fusion enzyme which has aldolase activity of fructoza-1,6-bisphosphate aldolase (FBPA)
from Staphylococcus carnosus, and kinase activity of dihydroxyacetone kinase (DHAK) from
Citrobacter freundii CECT 4626 was constructed by Iturrate et al. (2010). Overlap extension PCR
method has been used to fuse two enzymes with a linker of five residues (Gln-Gly-Gln-Gly-Gln)
which connected these two enzymes. Fusion enzyme (Dhak-Linker-FBPA) was cloned, and
expressed in E. coli BL21 (DE3). Purified enzyme showed a faster reaction speed (substrate was
transformed at the rate of 0.41 mmol/min) compared to the reaction speed of two separate enzymes
Received April 6, 2016. Accepted November 30, 2016.
Contact Tran Thi Thuy, e-mail address:
[email protected]
Fusing two phytase genes by PCR - driven overlap extension
153
in a reaction (0.02 mmol/min). The increase in reaction speed, due to the substrate transportation
between the two enzymes fused together, was faster, more efficient and continuous than that
between the two enzymes separated in a reaction solution [2].
Overlap extension PCR was successfully used to construct a mosaic enzyme Glu-Xyl by Lu
et al in 2006. Gene coding for Glu-Xyl enzyme contains 1.275 bp and the enzyme is 46 KDa. This
recombinant enzyme has xylanase activity from B. subtilis 168, and β-glucanase activity from B.
amyloliquefaciens 1.831. Compared to the native enzymes, Glu-Xyl showed 3.15 times higher
activity than native glucanase and 31% lower activity than native xylanase [3].
In this paper, we report the use of overlap extension PCR method to fuse two phytase genes:
one coding for acid phytase from E. coli B, and the other coding for alkaline phytase from
Bacillus subtilis.
2. Content
2.1. Materials and methods
2.1.1. Materials
Micro-organism: Escherichia coli DH 5α and E. coli B were purchased from Novagen to be
used as a cloning host and a source of acidic phytase gene (appA), respectively. Alkaline phytase
gene (phyC) was obtained from recombinant E.coli BL21(DE3) carrying phyC in recombinant
plasmid pE10C2 [4].
Plasmid DNA and primer: pJET1.2 was purchased from Thermo-scientific Fermentas to use
as cloning vector. Primers using in polymerase chain reaction (PCR) are listed in Table 1.
Table 1. Primers used in overlap extension PCR
No. Name of
primer
5
’
- 3
’
nucleotide sequence of primers
1 T1-F AAGCTTCAGAGTGAGCCGGAGCTGAAG
2 T2-R ATTGGTGGTATTGGTCAAACTGCACGCCGGTATG
3 T3-F ACCAATACCACCAATCTGTCTGATCCTTATCATTTTACCGTG
4 T4-R CTCGAGTTTTCCGCTTCTGTCGGTC
5 T5-F AAGCTTCTGTCTGATCCTTATCATTTTACCGTG
6 T6-R ATTGGTGGTATTGGTTTTTCCGCTTCTGTCGGTC
7 T7-F ACCAATACCACCAATCAGAGTGAGCCGGAGCTGAAG
8 T8-R CTCGAGCAAACTGCACGCCGGTATG
Note: Underline letters are the sequence of linkers, bolt letters are sequence
of restriction enzymes (XhoI and HindIII)
Media and chemicals: Luria-Betani (LB) medium was purchased from Difco, 100 mg
ampicillin was added per litter medium when it is used to cultivate E. Coli strain haboring
Tran Thi Thuy, Mai Kim Tuyen and Pham Thi Thuy Hang
154
pJET1.2 or pE10C2. All chemicals (Ampicillin, dNTPs, agarose, ethidium bromide, EDTA, Tris-
base, HCl), and enzymes (phusion DNA polymerase, restriction enzymes) are analytical grade.
2.1.2. Methods
* Extraction of total genomic DNA
A separated colony of E. coli strain on LB agar medium was tricked and cultivated overnight
in 2 mL of LB medium, at 37 ºC, in an orbital shaker at 200 rpm/min. Bacterial cells were
collected by centrifugation at 6000 rpm/min for 10 minutes, then subjected to cell disruption, and
DNA purification by Gene Jet Genomic DNA purification kit R1511 (Thermo-Fisher scientific).
* Overlap extension PCR
Overlap extension PCR is used to fuse two DNA fragments when they have a
complementary sequence overlapped each other. In this case, the overlapped sequence is a
suitable linker included in revert primer of the first DNA sequence (phyC1 or appA1), and also in
the forward primer of the second DNA sequence (phyC2 or appA2) to construct two kinds of
fused enzyme (A1C2 and C1A2). The A1C2 has appA at C-terminal, and phyC at N-terminal; the
C1A2 has phyC at C-terminal and appA at N-terminal. The PCR overlap extension to amplify
fusion phytase was designed in two PCR reactions which occurred in sequence. In the first PCR,
appA and phyC genes were amplified separately, they then purified, and used as a DNA template
and also as the overlapped primers for the second PCR (Figure 1). The content and thermo-cycle
of each PCR shall be investigated to gain the highest PCR product.
* DNA electrophoresis
Sample of total genomic DNA or PCR products of two steps of overlap extension PCR were
subjected to electro-phoresis on 0.8% agarose gel in TAE buffer at 100V. DNA fragments on
agarose gel were, then stained in the solution of ethidium bromide 0.5 mg/L for 30 minutes, and
visualized under UV light in order to verify DNA molecular weight, purity, and quantity prior to
further experiments.
Figure 1. Two steps of overlap extension PCR to fuse appA gene to phyC gene
Fusing two phytase genes by PCR - driven overlap extension
155
* DNA extraction and purification from agarose gel
Target DNA fragment on agarose gel were excised and melted at 60 ºC in binding buffer of
Quick gel extraction kit (K210012) from Thermo-Fisher scientific. Following different steps of
the Kit, DNA fragment, then be recovered in silica membrane and eluted in TB buffer. Pure DNA
samples were stored at -20 ºC for further experiments.
* Ligation of fusion DNA fragment to pJET 1.2 vector
This method allows blunt DNA fragment to be ligated in to pJET1.2 vector (Fermentas).
Sticky ends of fusion DNA fragments were eliminated by a blunting enzyme. Fusion DNA was
mixed with linear pJET1.2 vector in the ligation; buffer with the molar ratio of 3:1. T4-DNA
ligase was added; and ligation occurred at 22 ºC for 30 minutes prior to transform to E. coli DH5α
competent cells.
* Preparation of E. coli DH5α competent cells
E. coli DH5α competent cells were chemically prepared [4], and stored at -80 ºC before using
in DNA transformation by heat-shock method. A singe colony of E. coli DH5α was picked from
agar plate, cultivated overnight in 5 mL LB broth, at 37 ºC and 200 rpm. This culture (3 was used
to inoculate 150 mL of the same medium at the same condition in gyratory shaker incubator.
When the optical density (OD) of the culture at 600nm reached 0.4 - 0.6, E. coli cells were
collected by centrifugation at 4 ºC, 5000 rpm for 10 minutes. Cells were dispersed in 37.5 mL of
cold 100mM MgCl2, incubated in ice for 5 minutes before collected by centrifugation at 4000 rpm,
and 4 ºC for 10 minutes. Cells then continued be dispersed in 7.5 mL of cold 100 mM CaCl2,
incubated in ice for 10 minutes before being collected by centrifugation at 4000 rpm., and 4 ºC for
10 minutes. Finally, E. coli cells were dispersed well in 1.5 mL solution of 100 mM CaCl2
containing 15% glycerol, divided in small tubes (50 µL competent cell per tube), and stored at -80 ºC.
Transformation frequency of E. coli competent cell was checked before DNA transformation.
Known concentration of pUC19 (10 ρM) was mixed with 50 µL competent cell and heat shocked
at 42 ºC for 90 seconds before being spred on LB agar plate containing 100 mg/L of ampicillin
and incubated at 37 ºC. Transformation frequency was calculated based on the colonies grown:
about 5 × 10
6
or more colonies per µM of plasmid are considered good competent cells.
* DNA transformation and selection of positive clone
Prior to the transformation, E. coli competent cells were thawed in ice for about 15 to 30
minutes; 3 to 5 µL of ligation mixture was added, and the competent cell tube were incubated in
ice for 30 minutes. Heat shock the tube at 42 ºC for 90 seconds before spreading on LB agar plate
containing 100mg/L of ampicillin, and incubating at 37 ºC overnight to collect colonies.
Colonies were collected and checked for the present of fusion DNA fragment by PCR
screening [5]. Single colony was dispersed in 50 µL of de-ionized water; incubate 10 minutes in
boiling water to break cells, centrifuged 12000 rpm for 2 minutes to collect the supernatant. This
supernatant (5 µL) was used as DNA template for 35 cycles of PCR screening (94 C for 1 minute,
55 °C for 1 minute, 72 °C for 2 minute) accompany by an extra extending step at 72 °C for 7
minutes. PCR products were checked on agarose gel to confirm the present of fusion DNA
fragment.
Tran Thi Thuy, Mai Kim Tuyen and Pham Thi Thuy Hang
156
2.2. Results and discussion
2.2.1. Designing primers for fusion phytase gene
Gene banks and protein data base (PDB) were scanned to look for acidic and alkaline
phytases coding genes. Due to the codon bias between eukaryotic and prokaryotic cells, we
decided to use 13 sequences of E. coli phytase (an acidic phytase) and 8 sequences of Bacillus
subtilis phytase (an alkaline phytase) to design primers for fusion phytase gene. Result of the
analysis of the restriction endonuclease sites on these 21 DNA sequence has led to use HindIII
and XhoI site on the primers, due to the absence of these two restriction enzyme sites on DNA
sequences coding for both phytases.
Data base of natural linker was check for a linker having a suitable length and structure
which allow the two phytases to be flexible enough to show their activity in their fusion forms. A
sequence of 5 residues (Thr-Asn-Thr-Thr-Asn) was chosen since: (1) DNA sequence coding for
this 5 residues does not have restriction site of HindIII and XhoI, (2) this linker sequence
containing all aliphatic and neutral residues which may not interfere the structure of the two
phytases fused at the two ends of this linker, (3) the structure of this linker is quite open, allowing
the two fused phytases to be quite flexible. Structure and sequence of a chosen linker are shown in
Figure 2 and Table 2.
Figure 2. Structure of alkaline phytase from Bacillus subtilis (a), linker (b)
and acidic phytase from E. coli
(source: PDB and Natural linker data base)
Table 2. Sequence of chosen linker for fusion phytase
Amino acid sequence DNA sequence
Linker Thr-Asn-Thr-Thr-Asn
(TNTTN)
ACCAATACCACCAAT
This linker allowed us to design two structures of fusion phytase:
Fusing two phytase genes by PCR - driven overlap extension
157
(1) appA - linker - phyC (A1C2) consist of acidic phytase at N terminal and alkane phytase at
C terminal.
(2) phyC - linker - appA (C1A2) consist of alkane phytase at N terminal and acidic phytase at
C terminal.
Primers designed for A1C2 structure are T1-F, T2-R, T3-F, T4-R and for C1A2 structure are
T5-F, T6-R, T7-F, T8-R (Table 1). Melting temperature of each primer was determined based on
their sequence.
2.2.2. Amplification of alkaline and acidic phytase genes separately in PCR1
Annealing temperature for each PCR reaction was designed based on the melting temperature
of primers. However, changing this temperature from 55 to 67 ºC showed strong effect to the yield
of PCR products (Table 3). Increasing the concentration of Phusion HF DNA polymerase in PCR
reaction to 2 IU/reaction also improved the yield of PCR reaction.
Table 3. Effect of annealing temperature and the concentration of DNA polymerase
to the yield of PCR reaction to amplify appA and phyC gene
PCR
product
Annealing
temperature (ºC)
Concentration of Phusion
HF DNA polymerase (u/µL)
Yield of PCR
product
appA1
62 1 u/50 µL +
60 1 u/50 µL -
57 1 u/50 µL -
62 2 u/50 µL +++
appA2
67 2 u/50 µL ++
67 1 u/50 µL -
65 1 u/50 µL -
62 1 u/50 µL -
60 1 u/50 µL +
57 1 u/50 µL ++
57 2 u/ 50 µL +++
phyC1 62 1 u/50 µL +
60 1 u/50 µL ++
55 1 u/50 µL +++
phyC2 62 1 u/50 µL +
60 1 u/50 µL ++
55 1 u/50 µL +++
Note: (-) no product; (+) (++) (+++) from faint band light band intensive band of product
Tran Thi Thuy, Mai Kim Tuyen and Pham Thi Thuy Hang
158
In the range of 100 ng - 1000 ng per 50 µL reaction, the concentration of DNA template did
not show strong effect to the amplification of phyC gene; however, it showed some effects on the
amplification of appA gene. In this case, different DNA extraction methods could introduce
different inter-ferences to PCR reaction. Therefore, we have chosen the concentration of 187 ng
DNA template per 50 reaction for undergoing the PCR1 to amplify appA gene.
AppA and phyC genes were amplified in separated reactions, and purified from the agarose
gel (Figure 3) to be the DNA template for PCR2.
Figure 3. Amplification of appA and phyC genes in PCR1
PCR product of appA1 and appA2 (a); appA1, appA2 after purification (b);
and PCR product of appA1 and appA2 (c); phyC1, phyC2 after purification (d); First lane of each
gel is 1Kb DNA ladder
After purification, DNA concentration of each gene was determined by spectro-photo-metter:
The concentration of appA1 is 50 ng/µL and appA2 is 40 ng/µL; the concentration of phyC1 and
phyC2 were 180 and 90 ng/µL, respectively.
2.2.3. Amplification of fusion phytase genes in PCR2
In PCR2 (an overlap extension reaction), the annealing temperature, the concentration and
the molecular ratio of template genes play a vital role in order to get good yield of PCR product.
Due to the different melting temperature (Tm) of the primers and the linker, we decided to use two
annealing steps at two different temperatures. The first step (PCR2a) use Tm of the linker to
design the annealing temperature of PCR2 in order to improve the annealing possibility of the
linker from different gene (phyC and appA). The second step (PCR2b) use Tm of normal primers
listed in Table 1 to design the annealing temperature of PCR2. Figure 4 shows the effect of
PCR2a and PCR2b annealing temperature to the yield of PCR2 product. Table 4 shows the
effect of PCR2b annealing temperature, and the molar ratio of template DNA to the yield of
PCR2 product.
Fusing two phytase genes by PCR - driven overlap extension
159
Figure 4. Amplification of fusion genes in PCR2
Effect of PCR2a annealing temperature to the yield of PCR2a product (a); Effect of PCR2b
annealing temperature to the yield of PCR2b product (b); M: 1Kb DNA ladder; Pur: purified
DNA fragment of fusion gene
Table 4. Effect of annealing temperature, the molar ratio of DNA template
to the yield of PCR2 reaction to amplify fusion gene
Fusion gene Tm of
PCR2b (ºC)
Molar ratio of DNA
template (mol/mol)
PCR
product
appA - linker -
phyC (A1C2)
68 appA1: 3 phyC2: 1 +
68 appA1: 4 phyC2: 1 +
68 appA1: 5 phyC2: 1 -
68 appA1: 1 phyC2: 3 -
68 appA1: 1 phyC2: 4 -
68 appA1: 1 phyC2: 5 +
66 appA1: 1 phyC2: 5 ++
phyC – linker –
appA (C1A2)
68 phyC1: 3 appA2: 1 -
68 phyC1: 4 appA2: 1 -
68 phyC1: 5 appA2: 1 +
68 phyC1: 1 appA2: 3 +
68 phyC1: 1 appA2: 4 -
68 phyC1: 1 appA2: 5 -
64 phyC1: 1 appA2: 3 ++
Note: (-) no product; (+) (++) (+++) from faint band light band intensive band of product
Tran Thi Thuy, Mai Kim Tuyen and Pham Thi Thuy Hang
160
Based on the result in Figure 4 and Table 4, the condition of PCR2 to amplify fusion phytases
was chosen bellow:
(1) To amplify appA – linker – phyC (A1C2), the molar ratio of template DNA should be 1
appA (A1) : 5 phyC (C2), annealing temperature should be 55 ºC for PCR2a and 66 ºC for PCR2b.
(2) To amplify phyC – linker – appA (C1A2) the molar ratio of template DNA should be 1
phyC (C1) : 3 appA (A2), annealing temperature should be 55 ºC for PCR2a and 64 ºC for PCR2b.
2.2.4. Cloning fusion phytase genes to pJET1.2 vector in E. coli DH5α
Ligation was carried out between purified fragment of fusion genes (A1C2 and C1A2) and
pJET1.2 vector. This is a blunt end ligation; therefore, blunting enzyme was used to clip out any
extra end of PCR product due to the overwork of DNA polymerase. The molar ratio of DNA
insert, together with the vector play an important role in the ligation mixture. This ratio has been
vary from 5:1 to 1:1 in a ligation reaction, at room temperature (22 ºC), from 5 to 30 minutes. Five
micro-liters of each ligation were mixed, then transformed to E. coliDH5α by heat-shock at 42 ºC
for 90 seconds before being spred on LB agar plate containing 100mg/L of ampicillin, and
incubated at 37 ºC overnight to collect colonies.
Figure 5. Screening for a clone harboring a fusion genes
PCR screening of positive clone harbouring fusion C1A2 gene (a) and determination of fusion C1A2
gene of 2.5 Kb by restriction endonuclease (b); M: 1Kb DNA ladder; PC: positive clone harbouring 1.5
Kb fragment of phyC gene; 16 - 20: different clones grown on LB after the ligation; 1: undigested
pE10C2 harbouring 1.5 Kb fragment of phyC gene; 1dig: digested pE10C2 by XhoI and HindIII; 2: un-
digested plasmid extract from clone 20; 2dig: digested plasmid extract from clone by XhoI and HindIII
The molar ratio of 2 C1A2: 1 vector and the ligation at 22 ºC for 30 minutes produced many
colonies on LB agar plate. Figure 5a shows the result of PCR screening on these colonies. Among
them, a positive clone (clone 20) was detected to carry fusion gene of phyC - linker - appA
(C1A2). Double digestion the plasmid from clone 20 with XhoI and HindIII (Figure 5b)
confirmed that the recombinant plasmid from clone 20 carries a fusion gene which is about 2.5 Kb
in length.
Fusing two phytase genes by PCR - driven overlap extension
161
No positive clone was detected in the ligation mixture of A1C2 and vector pJET1.2. The
molar ratio of insert, vector and the condition of this ligation reaction need to be optimized more,
in order to get a positive clone.
3. Conclusion
Based on the PCR overlap extension, two fusion genes (appA - linker - phyC and phyC -
linker - appA) which consist of appA phytase gene from E. coli B, phyC phytase gene from
Bacillus subtilis MD2 and a linker of five residues has been constructed. The condition of the two
PCR components were optimized: PCR1 used 187 ng DNA template per 50 µL reaction to
amplify appA gene, annealing temperature was 62 ºC for appA1 and 57 ºC for appA2; the
concentration of DNA template between 100 ng - 1000 ng per 50 µL reaction did not affect to the
amplification of phyC gene, annealing temperature was 55 ºC for both phyC1 and phyC2. PCR2
used the product of PCR1 as a DNA template and also as an overlapping primer to amplify fusion
phytase genes. Two annealing temperatures were used, 55 ºC for PCR2a and 64/66 ºC for PCR2b.
Ligation of the fusion gene to the pJET1.2 resulted in a positive clone of E. coli DH5α harboring
phyC - linker - appA (C1A2) fusion gene.
Acknowledgment. The financial support by the International Foundation for Science (IFS)
for this work is gratefully acknowledged.
REFERENCES
[1] Alcantara EH, Kim DH, Do SIand Lee SS, 2007. Bi-functional activities of chimeric
lysozymes constructed by domain swapping between bacteriophage T7 and K11 lysozymes.
Journal of Biochemistry and Molecular Biology, Vol. 40(4), pp. 539-546.
[2] Iturrate L, Oroz-Guinea ISM, Pérez-Gil J and García-Junceda E, 2010. Preparation and
characterization of a bifunctional aldolase/kinase enzyme. A more efficient biocatalyst for
C-C bond formation. Chemistry - A European Journal, Vol.16(13), pp. 4018-30.
[3] Lu P, Feng MG, Li WF, Hu CX, 2006. Constructionand characterization of a bifunctional
fusion enzyme of Bacillus - Sourcedb β-glucanase and xylanase expressed in Escherichia
coli. FEMS Microbiology Letter, Vol. 261, pp. 224-230.
[4] Thuy Thi Tran, Gashaw Mamo, Bo Mattiasson, Rajni Hatti-Kaul, 2010. A thermostable
phytase from Bacillus sp. MD2: cloning, expression and high-level production in
Escherichia coli. Journal of Industrial Microbiology and Biotechnology, Vol. 37, pp. 279-287.
[5] Sambrook J, Russell D W, 2001. Molercular cloning: A Laboratory Manual. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, New York, Vol. 1,2, pp. 1.31-1.38; 8.18-8.30.