ACADEMIA JOURNAL OF BIOLOGY 2020, 42(2): 75–84
DOI: 10.15625/2615-9023/v42n2.14985
75
HETEROLOGOUS PHYTASE EXPRESSION IN THE FOOD
FILAMENTOUS FUNGUS Aspergillus oryzae USING THE ADDED
RICE HUSK CULTIVATION MODEL
Thai Hanh Dung1,2, Tran Van Tuan1,2,*
1Department of Microbiology, Faculty of Biology, University of Science,
Vietnam National University, Hanoi
2Genomics Unit, Key Laboratory of Enzyme and Protein Technology,
University of Science, Vietnam National University, Hanoi
Received 10 March 2020, accepted 10 June 2020
ABSTRACT
Aspergillus oryzae, a safe filamentous fungus, is widely used in food and enzyme production. In
this study, we examined a cultivation model using rice husks as carrier to assess the capacity of
recombinant protein production in A. oryzae. The model was first tested with the A. oryzae strain
expressing the DsRed reporter gene. The expression of DsRed was easily detected by the pink
color of the fungal mycelium on culture media and under a fluorescence microscope. The model
was then evaluated with the phyA gene encoding a phytase from the fungus Aspergillus
fumigatus. The phyA expression cassette regulated by the amyB promoter was permanently
integrated into the genome of A. oryzae via Agrobacterium tumefaciens-mediated transformation
with the pyrG nutritional marker. The results showed that transgenic A. oryzae strains carrying
2−3 copies of the phyA gene in their genomes exhibited a significant increase in phytase activity
on agar medium supplemented with phytate. With rice husks added, these transgenic strains
could secrete the recombinant phytase into the culture and phytase activity of the crude enzyme
solution increased by 4.3 times compared to the original A. oryzae. The established cultivation
model and the transgenic strategy in this study represent a potential approach for being exploited
in the production of secreted recombinant enzymes for animal feeds.
Keywords: Aspergillus oryzae, Agrobacterium tumefaciens-mediated transformation, DsRed,
recombinant phytase, rice husk.
Citation: Thai Hanh Dung, Tran Van Tuan, 2020. Heterologous phytase expression in the food filamentous fungus
Aspergillus oryzae using the added rice husk cultivation model. Academia Journal of Biology, 42(2): 75–84.
https://doi.org/10.15625/2615-9023/v42n2.14985.
*Corresponding author email:
[email protected]
©2020 Vietnam Academy of Science and Technology (VAST)
Thai Hanh Dung, Tran Van Tuan
76
INTRODUCTION
Aspergillus oryzae, a safe filamentous
fungus, has been widely used in Asian
countries for the production of traditional foods
and beverages such as soy sauce, miso and
sake (Barbesgaard et al., 1992; Machida et al.,
2008). A. oryzae has the ability to express and
secret a large amount of recombinant enzymes
into the culture media as reported for aspartic
protease and lipase from Rhizomucor miehei
(Christensen et al., 1988; Huge-Jensen et al.,
1989). Currently, the industrial production of
some recombinant enzymes using A. oryzae as
the host has been approved. Rhizomucor miehei
lipase expressed in A. oryzae has been used for
humans in Denmark (Barbesgaard et al., 1992).
Phytase is one of the most prominent
enzymes for animal feed, accounting for
about 60% of the enzyme market for cattle
and poultry nutrition, which costs
approximately $350 million per year. Phytase
is present as an additive in about 70% of
commercial animal feeds. Phytase (also
known as myo-inositol hexakisphosphate
phosphohydrolase) hydrolyzes phytic acid
(or phytate), releasing inorganic phosphorus
that is essential for animal metabolism.
Monogastric animals, which do not possess
phytases, are unable to metabolize phytate
from grains - the main ingredients of
industrial animal feeds. Unmetabolized
phytate may be released by the animals into
the environment as waste, causing pollution
(Haefner et al., 2005; Rao et al., 2009).
Although phytases have been isolated from
various microbial sources, only phytases
from certain microorganisms with attractive
characteristics including the high rate of
phytate hydrolysis, acidic pH tolerance and
heat stability during feed pelleting process
are widely used in the industrial production
(Rao et al., 2009). Phytase from the
filamentous fungus Aspergillus fumigatus has
the ability to recover its activity level after
heat treatment whereas many other phytases
are usually inactivated during feed pelleting
process (Pasamontes et al., 1997). However,
the direct use of A. fumigatus for enzyme
production is not allowed because this
fungus is an opportunistic human pathogen
(Varga et al., 2011). As a result, different
strategies based on genetic engineering have
been used to generate recombinant fungal
strains with safety assurance for industrial-
scale enzyme production (Punt et al., 2002).
Recently, our research group has
succeeded in establishing a highly efficient
genetic transformation system for the food
filamentous fungus A. oryzae using the
bacterium Agrobacterium tumefaciens as a
DNA transfer tool (Nguyen et al., 2016;
Nguyen et al., 2017). The A. tumefaciens-
mediated transformation (ATMT) method
has many advantages, especially the direct
use of fungal spores as the transformation
material and the target gene located in T-
DNA is stably integrated into the fungal
genome (Michielse et al., 2005). In this
study, we transferred the phyA gene
encoding a phytase from the opportunistic
human pathogen A. fumigatus into the
genome of the food fungus A. oryzae using
the ATMT method. Instead of common
antibiotic resistance genes, the pyrG gene
was used as a nutritional marker for
selecting fungal transformants. Therefore,
the transgenic A. oryzae strains expressing
the phytase gene would be safe for
recombinant production.
MATERIALS AND METHODS
Microbial strains, plasmids and PCR
primers
The strains and plasmids used in this
study are listed in Table 1.
Primers for PCR amplifications listed in
table 2 were synthesized by Integrated DNA
Technologies (IDT) Inc. (Singapore). The
primer pair (PhyA-F/PhyA-R) employed for
the amplification of the phyA gene was
designed with Primer3 based on the A.
fumigatus phyA sequence (accession
number: Afu4g08630). The primer pair
(pyrG-RT-F/pyrG-RT-R) for the
amplification of the pyrG marker was based
on the pyrG gene sequence (accession
number: AO090011000868). These two
Heterologous phytase expression
77
sequences were extracted from the
Aspergillus genome database at the link:
Table 1. Microbial strains and plasmids used in this study
Strain/ plasmid Description Reference
Escherichia coli
DH5α
F- endA1 hsdR17 supE44 thi-1 λ- recA1 gyrA96 relA1
deoR Δ(lacZYA-argF)-U169 Φ80dlacZΔM15
Nguyen et al., 2016
A. tumefaciens
AGL1
C58, recA::bla, pTiBo542ΔT-DNA, Mop+, CbR Nguyen et al., 2016
A. fumigatus
VTCC 31414
The wild-type A. fumigatus isolated in Vietnam
IMBT, Vietnam National
University, Hanoi
A. oryzae RIB40 The wild-type A. oryzae originated from Japan Machida et al., 2008
A. oryzae
AUT1-PlD
niaD- sC- adeA- ΔargB::adeA- ΔtppA::argB
ΔpepE::adeA aut1- ΔligD ΔpyrG
Zhu et al., 2013
A. oryzae
AUT1-R1
The AUT1-PlD strain expressing the DsRed
fluorescent reporter gene
Nguyen et al., 2017
pEX2B
The binary vector with the pyrG marker and the
DsRed reporter gene under the regulation of the A.
oryzae amyB promoter
Nguyen et al., 2017
pEX2B-phyA
The binary vector with the pyrG marker and the A.
fumigatus phyA gene under the regulation of the A.
oryzae amyB promoter
This study
Table 2. Primers used in this study
Primer name
Primer sequence (5’–3’) with the
underlined sites for restriction enzymes
Product
size
Reference
ITS1 TCCGTAGGTGAACCTGCGG
597 bp White et al., 1990
ITS4 TCCTCCGCTTATTGATATGC
PhyA-F
GGGCACGTGATGAAAAAGCTATAT
AATGGCCGG (PmlI)
1.51 kb This study
PhyA-R
GGGGATCCTCAACTAAAGCACTCTC
CCCA (BamHI)
pyrG-RT-F CGGAAACACAGTCCAAAAGC
196 bp This study
pyrG-RT-R CAAAGATCCCTTGGAGGTCA
Cultivation media
Potato dextrose agar (PDA) medium was
used for cultivating the wild-type strains A.
oryzae RIB40 and A. fumigatus VTCC 31414.
DPY medium (2% glucose, 1% peptone,
0.5% yeast extract, 0.5% KH2PO4, 0.05%
MgSO4.7H2O, pH 5.5) with required
supplements (0.1% uracil, 0.1% uridine) was
used for collecting spores of the AUT1-PlD
strain. The AUT1-PlD strain, which was
genetically engineered from A. oryzae RIB40,
is a hyper-producing strain for recombinant
protein production (Zhu et al., 2013).
M+met medium (0.2% NH4Cl, 0.1%
(NH4)2SO4, 0.05% KCl, 0.05% NaCl, 0.1%
KH2PO4, 0.05% MgSO4, 0.002% FeSO4, 2%
glucose, 0.15% methionine, pH 5.5) was used
as a minimal medium for selection of fungal
transformants (Zhu et al., 2013).
The induction medium (IM) was
supplemented with 0.05% uridine, 0.05%
uracil and 200 μM acetosyringone (AS). The
liquid IM contained salts of minimal medium
(MM salts), 40 mM 2-(N-morpholino)
ethanesulfonic acid (MES), 10 mM glucose,
0.5% (w/v) glycerol. The solid IM contained
Thai Hanh Dung, Tran Van Tuan
78
only 5 mM glucose. The solution of MM salts
(g/l) consisted of 2.05 g K2HPO4, 1.45 g
KH2PO4, 0.15 g NaCl, 0.5 g MgSO4.7H2O,
0.1 g CaCl2.6H2O, 0.5 g (NH4)2SO4, 0.0025 g
FeSO4.7H2O (Nguyen et al., 2016).
Phytase screening medium (PSM)
contained 1% glucose, 0.4% sodium phytate,
0.2% CaCl2.6H2O, 0.5% NH4NO3, 0.05%
KCl, 0.05% MgSO4.7H2O, 0.001%
FeSO4.7H2O, 0.001% MnSO4.H2O.
For a solid medium, 2% agar was added.
All media were autoclaved before use.
Spore preparation
Fungal strains were cultivated on agar
plates for 3−5 days at 30°C. Sterile distilled
water was added and a sterile glass spreader
was used to scrap the agar surface. The liquid
was collected and filtered through Miracloth
(Calbiochem, Germany). The filtrate was then
centrifuged at 5000 rpm for 10 min.
Collected spore pellets were washed twice
with sterile distilled water and resuspended in
sterile distilled water to obtain the final spore
suspension. Fungal spore concentration was
measured using a Thoma counting chamber
and adjusted to 106 or 107 spores/ml for
further experiments.
Total DNA extraction
The extraction of total DNA from fungal
mycelium was based on the procedure from
our previous study (Nguyen et al., 2016) or
using the commercial E.Z.N.A.® Fungal DNA
Mini Kit (Omega Bio-tek, USA).
Total RNA extraction and cDNA synthesis
Total RNA was extracted from fungal
mycelium using ANAPURE® RNA Mini Kit
(ANABIO R&D JSC, Vietnam). RNA
samples were digested with DNase I (Qiagen,
Germany) at 37oC for 30 min to remove total
DNA. The enzyme DNase I was then
inactivated at 75oC for 15 min. The RNA
samples were immediately kept in ice. The
purity of the RNA samples was then
examined with PCR using the primer pair
ITS1/ITS4 (Table 2) specific for the ITS
region of ribosomal DNA. The purified RNA
was converted into cDNA using ProtoScript®
First Strand cDNA Synthesis (New England
Biolabs, USA).
Construction of the binary vector for
expressing the phyA gene from A. fumigatus
The full-length coding sequence of the
phyA gene was amplified from the A.
fumigatus cDNA sample with PCR using the
specific primer pair PhyA-F/PhyA-R (Table
2). Phusion® high-fidelity DNA polymerase
(Thermo Scientific, USA) was used to ensure
the accuracy of PCR amplification. The
obtained PCR product was purified with
Wizard® SV Gel and PCR Clean-Up System
(Promega, USA). The purified PCR product
was digested with PmlI and BamHI and
ligated into the binary vector pEX2B, which
was also digested with the same restriction
enzymes. The resultant plasmid was
transformed into the competent E. coli DH5α
cells for propagation. The recombinant
plasmid was purified with Wizard® Plus SV
Minipreps DNA Purification System
(Promega, USA). The existence of the phyA
expression cassette was confirmed by PCR
using the specific primer pair PhyA-F/PhyA-
R and by digestion with suitable restriction
enzymes as well as by DNA sequencing. The
constructed binary vector was named
pEX2B-phyA.
Transfer of the phyA expression cassette
into the A. oryzae AUT1-PlD strain using A.
tumefaciens
The binary vector pEX2B-phyA was
transferred into the A. tumefaciens AGL1
cells by the electroporation method. A single
A. tumefaciens colony harboring the vector
was inoculated in a conical flask containing
20 ml of the liquid Luria-Bertani (1%
peptone, 0.5% yeast extract powder, 0.5%
NaCl) supplemented with kanamycin (100
mg/l) through shaking at 200 rpm and 28oC
for 15-17 h. One milliliter of the culture was
mixed with 9 ml of induction medium (IM)
and 200 μM acetosyringone (AS). The
bacteria were additionally incubated for 6 h at
28oC, 200 rpm until the OD600nm reached 0.6-
0.8. A mixture of 100 μl of the AUT1-PlD
Heterologous phytase expression
79
spore suspension (107 spores/ml) and 100 μl
of the induced AGL1 suspension was spread
on 90-mm cellulose filter paper (Sartorius,
Germany), which was placed on the IM agar
plate consisting of 200 μM AS, 0.05%
uridine (w/v) and 0.05% uracil (w/v). The
plate was kept in darkness for 60 h at 22oC.
After that, the filter paper was transferred to a
new plate containing M+met medium
supplemented with cefotaxime (300 mg/l) for
fungal selection. This plate was incubated at
30oC for 5−7 days until fungal transformants
appearing on the filter paper membrane.
Examination of the transformants
The existence of the phyA gene from A.
fumigatus in the genome of the obtained A.
oryzae transformants was confirmed by PCR
using the specific primer pair PhyA-F/PhyA-
R (Table 2). For examining the recombinant
phytase expression, fungal transformants
were directly grown on PSM supplemented
with 0.15% methionine. After 3−5 days, a
zone of clearance surrounding the
transformants was observed.
Determination of the phyA copy number in
the transformants with real-time PCR
Total DNA was isolated from the
selected A. oryzae transformants using
E.Z.N.A.® Fungal DNA Mini Kit (Omega
Bio-tek, USA). DNA quantifications by real-
time PCR were carried out with IQ5 real-
time PCR system (Bio-Rad, USA). HotStart-
IT SYBR Green qPCR Master Mix
(Affymetrix, USA) and the primer pair pyrG-
RT-F/pyrG-RT-R for the pyrG gene (Table
2) were included. The 2-∆Ct formula was used
for determining the phyA gene copy number,
in which ∆Ct corresponds to Ct (in the strain
of interest)-Ct (in the reference strain)
(Schmittgen & Livak, 2008).
Extraction of crude enzyme solution
One milliliter of a spore suspension (107
spores/ml) harvested from the transformants
was added to a 250 ml autoclaved flask
containing 10 ml of liquid M+met and 4 g of
dried clean rice husks. Rice husks were used
as the carrier in order to provide ventilation
for fungal growth. After incubation at 30oC
for different amounts of time, 30 ml of
sodium acetate (200 mM, pH 6) was added.
The mixture was shaken at 200 rpm for 20
min. The crude enzyme supernatant was
collected by filtration using Miracloth
(Calbiochem, Germany) and centrifugation at
5000 rpm, 4oC for 15 min. The crude enzyme
solution was kept at 4oC for later use or used
directly for phytase activity assays.
Phytase activity assay
Phytase activity was determined according
to Heinonen & Lahti (1981) (Heinonnen &
Lahti, 1981) with some modifications. The
reaction included 125 μl of the crude enzyme
solution, 125 μl sodium phytate (15 mM) and
125 μl sodium acetate buffer (200 mM, pH
5.5). The reaction mixture was incubated at
55oC for 30 min, and terminated by adding 0.5
ml of 15% TCA. The color formation was
achieved by transferring 125 μl of the mixture
into 1 ml of AAM solution (10 mM
ammonium molybdate, 100% acetone, 5 N
sulfuric acid, 1:2:1). After 2 min, 100 μl of 1 M
citric acid was added and the absorbance at 355
nm was determined after termination. The non-
transgenic strain AUT1-PlD was selected as
the control and each experiment was repeated
independently three times. One unit (U) of
phytase activity is defined as the amount of
enzyme required for catalysis to produce one
micromole of inorganic phosphate per minute
under standard assay conditions. A standard
curve was constructed using KH2PO4 at
different concentrations.
RESULTS AND DISCUSSION
A. oryzae AUT1-PlD represents an excellent
host for heterologous expression
A. oryzae AUT1-PlD used in this study is
a hyper-producing strain for recombinant
protein production. This strain was
genetically engineered from the wild strain
A. oryzae RIB40 (Zhu et al., 2013). The
DsRed expressing transformant (AUT1-R1)
formed the pink mycelium, which could be
observed even with the naked eye (Nguyen et
al., 2017). This strain was selected for
evaluating the suitability of the rice husk
Thai Hanh Dung, Tran Van Tuan
80
cultivation model. The expression of the
DsRed reporter was regulated by the strong
amyB promoter (Figure 1A). This promoter
could be induced by starch or maltose, and
repressed by glucose (Tsuchiya et al., 1992).
In this study, we reported that glucose was
still able to activate the function of the amyB
promoter, but it was not as strong as the
specific inducer maltose (Figure 1B). The
amyB promoter worked better for regulating
gene expression in the solid-state cultivation
rather than in the liquid-state fermentation.
However, the collection of secreted enzymes
from agar media seemed to be complicated.
Here, we constructed a cultivation model
using rice husks as the carrier for fungal
growth. This is a promising approach for
low-cost isolation of secreted enzymes. We
tested the growth of the transgenic strain
AUT1-R1 on the rice husk cultivation model
and the results showed a strong expression of
the DsRed gene, which resulted in the pink
mycelium on agar plates. When observed
under Axioplan fluorescence microscope, the
red mycelium fully covered and adhered to
the rice husks (Figure 1C).
Figure 1. Heterologous expression of the DsRed reporter gene in A. oryzae. Glucose and
maltose were used as the sole carbon sources to examine the ability for gene expression
regulation of the amyB promoter. (A) The structure of T-DNA of the binary vector pEX2B. (B)
The expression of the DsRed gene in AUT1-R1 cultivated on the agar medium and on the added
rice husk medium with glucose as the sole carbon source. The mycelium of AUT1-R1 from the
rice husk cultivation model was observed under the fluorescence microscope. (C) A similar
experiment was carried out with maltose as the sole carbon source
Heterologous phytase expression
81
The successful construction of a binary
vector carrying the phyA expression
cassette for the transformation of A. oryzae
AUT1-PlD
The coding sequence of the phyA gene from
the opportunistic human pathogen A. fumigatus
was amplified from a cDNA sample and
inserted into the pEX2B binary vector for
genetic transformation of the safe filamentous
fungus A. oryzae. The DsRed reporter gene in
pEX2B was replaced with the phyA gene. The
expression of phyA was controlled by the amyB
promoter (Figure 2). Transfer of the phyA
expression cassette from the binary vector
pEX2B-phyA into A. oryzae AUT1-PlD was
conducted as previously described (Nguyen et
al., 2016). In this strategy, the pyrG gene was
recruited as a selection marker and the well-
known Agrobacterium tumefaciens AGL1
strain was used as a tool for gene transfer into
the fungal genome. The utilization of the A.
oryzae pyrG gene as the nutritional marker for
genetic transformation in A. oryzae would help
to construct fungal transgenic strains without
using antibiotic resistance genes.
Figure 2. The diagram for the generation of the phyA expression construct. The phyA coding
sequence was amplified from an A. fumigatus cDNA sample by PCR. The PCR products were
treated with PmlI and BamHI prior to being ligated into the respective restriction sites in the
pEX2B binary vector to generate the recombinant vector pEX2B-phyA
Genetic transformation of A. oryzae
AUT1-PlD using the ATMT method and the
binary vector pEX2B-phyA resulted in 5−7
transformants per plate (Figure 3A). The
obtained phyA expressing strains were
cultivated on PSM agar plates for screening
phytase activity. Bigger clearance zones of
phytate degradation indicated stronger phytase
activity in the transgenic strains. The non-
transgenic A. oryzae AUT1-PlD strain was
used as the control. Three transgenic strains
with the best activity for phytate degradation,
designated as P1, P2, P3, (Figure 3B) were
selected for DNA extraction to examine the
presence of the phyA gene in fungal genomes
by PCR using the specific primer pair PhyA-
F/PhyA-R. The results indicated that the phyA
expression cassette was successfully
integrated into the genomes of the selected
transformants (Figure 3C).
Thai Hanh Dung, Tran Van Tuan
82
Figure 3. Transfer of the expressing construct for the A. fumigatus phyA gene into A. oryzae
AUT1-PlD using ATMT. (A) Fungal transformants appeared on cellulose filter paper. (B) The
ability for phytate degradation of three transgenic strains. (C) Confirmation of the phyA gene in
the A. oryzae transgenic strains by PCR. M: 1 kb DNA ladder, (-) and (+) correspond to the
negative and positive controls, respectively
The selected transgenic strains harbored
more than one copy of the A. fumigatus
phyA gene in their genomes
T-DNA of pEX2B-phyA carried both
pyrG and phyA, which were simultaneously
transferred into the A. oryzae AUT1-PlD
strain. Therefore, the copy number of pyrG
also reflected the copy number of phyA in
genomes of the transgenic strains. Based on
the genome database of A. oryzae RIB40
( the pyrG
gene has only one copy (accession number:
AO090011000868) in chromosome 7.
Therefore, the RIB40 strain (the original of
the AUT1-PlD strain) was selected as the
reference control for determining the phyA
copy number in the transgenic strains (P1, P2,
P3). The primer pair pyrG-RT-F/pyrG-RT-R
was designed for specific amplification of a
piece of the pyrG gene with a product size of
196 bp. Analysis of real-time PCR
quantifications based on Ct (cycle threshold)
values and the 2-∆Ct formula revealed the copy
numbers of the A. fumigatus phyA gene in the
genomes of three transgenic strains to be
between 2 and 3 (Table 3).
The level of gene expression strongly
relied on the copy number of the gene in the
host cell (Li et al., 2013). Our results showed
that three selected strains harbored 2 or 3
copies of the phyA expression cassette in
their genomes (Table 3). The transgenic
strain P2 with a high phytase activity on
PSM (Figure 3B) exhibited the integration of
3 copies of the phyA gene in its genome
(Table 3).
Table 3. The copy numbers of the phyA gene in the transgenic strains
Strain Ct Copy number (2-Ct)
AUT1-PlD - 0
RIB40 17.68 1
P1 16.47 2
P2 16.07 3
P3 16.75 2
The strain P2 appears to be a promising
candidate for recombinant phytase
production
The strain P2 and the control strain AUT1-
PlD were grown in the cultivation medium
with added rice husk and supplemented with
2% maltose as the sole carbon source for
induction of the amyB promoter. The crude
enzyme solutions extracted from fungal
cultures were used for phytase activity
Heterologous phytase expression
83
evaluation. The obtained results indicated that
the transgenic strain P2 displayed a phytase
activity level 4.3 times higher than the control
strain AUT1-PlD (Figure 4A). The data also
showed that the amount of time suitable for
optimal phytase activity of the strain P2 was
approximately 6 to 7 days at 30oC (Figure
4B). In this study, we have succeeded in
expressing the phyA gene from the
pathogenic fungus A. fumigatus in the hyper-
producing strain A. oryzae AUT1-PlD. The
transgenic strains can be exploited for future
studies, in which the recombinant phytase
will be purified and analyzed in more detail
for favored characteristics such as heat
stability or pH tolerance.
Figure 4. Phytase activity measurement. (A) Phytase activity of the phyA expressing strain P2
compared with the AUT1-PlD strain when cultivated in the added rice husk medium for 7 days
at 30oC. (B) Phytase activity of the strain P2 at different time intervals of cultivation
CONCLUSION
This work demonstrated the possibility of
heterologous expression of genes of interest
from a fungal pathogen in the safe fungus A.
oryzae using the cultivation model with rice
husk as the carrier for ventilation. The
obtained transgenic strains possessed a high
efficiency for phytase biosynthesis in this
cultivation model. Heterologous expression of
phytases in A. oryzae using the cultivation
model with added rice husks may be exploited
for low-cost production of these secreted
enzymes as animal supplements.
Acknowledgments: The authors thank MSc.
Nguyen Van Minh for his support in some real-
time PCR experiments. The research is funded
by Vietnam National Foundation for Science
and Technology Development (NAFOSTED)
under grant number: 106.04-2018.36.
REFERENCE
Barbesgaard P., Heldt-Hansen H. P.,
Diderichsen B., 1992. On the safety of
Aspergillus oryzae: a review. Appl.
Microbiol. Biotechnol., 36: 569−572.
Christensen T., Woeldike H., Boel E.,
Mortensen S.B., Hjortshoej K., Thim L.,
Hansen M.T., 1988. High level expression
of recombinant genes in Aspergillus
oryzae. Nat. Biotechnol., 6: 1419−1422.
Haefner S., Knietsch A., Scholten E., Braun
J., Lohscheidt M., Zelder O., 2005.
Biotechnological production and
application of phytases. Appl. Microbiol.
Biotechnol., 68: 588−597.
Heinonnen J. K., Lahti R. J., 1981. A new and
convenient colorimetric determination of
inorganic orthophosphate and its
application to the assay of inorganic
pyrophosphatase. Anal. Biochem., 113:
313−317.
Huge-Jensen B., Andreasen F., Christensen
T., Christensen M., Thim L., Boel E.,
1989. Rhizornucor miehei triglyceride
lipase is processed and secreted from
Thai Hanh Dung, Tran Van Tuan
84
transformed Aspergillus oryzae. Lipids,
24: 781−785.
Li M., Zhou L., Liu M., Huang Y., Sun X., Lu
F., 2013. Construction of an engineering
strain producing high yields of
α-transglucosidase via Agrobacterium
tumefaciens-mediated transformation of
Aspergillus niger. Biosci. Biotechnol.
Biochem., 77: 1860−1866.
Machida M., Yamada O., Gomi K., 2008.
Genomics of Aspergillus oryzae: learning
from the history of koji mold and
exploration of its future. DNA Res., 15:
173−183.
Michielse C. B., Hooykaas P. J. J., van den
Hondel C. A. M. J. J., Ram A. F. J., 2005.
Agrobacterium-mediated transformation
as a tool for functional genomics in fungi.
Curr. Genet., 48:1−17.
Nguyen T. K., Ho N. Q., Pham H. T., Phan T.
N., Tran V. T., 2016. The construction and
use of versatile binary vectors carrying
pyrG auxotrophic marker and fluorescent
reporter genes for Agrobacterium-
mediated transformation of Aspergillus
oryzae. World J. Microbiol. Biotechnol.,
32: 204.
Nguyen T. K., Ho Q. N., Do L. T. B. X., Mai
L. T. D., Pham D. N., Tran H. T. T., Le D.
H., Nguyen H. Q., Tran V. T., 2017. A
new and efficient approach for
construction of uridine/uracil auxotrophic
mutants in the filamentous fungus
Aspergillus oryzae using Agrobacterium
tumefaciens-mediated transformation.
World J. Microbiol. Biotechnol., 33: 107.
Pasamontes L., Haiker M., Wyss M., Tessier
M., van Loon A. P. G. M., 1997. Gene
cloning, purification, and characterization
of a heat-stable phytase from the fungus
Aspergillus fumigatus. Appl. Environ.
Microbiol., 63: 1696−1700.
Punt P. J., van Biezen N., Conesa A., Albers
A., Mangnus J., van der Hondel C., 2002.
Filamentous fungi as cell factories for
heterologous protein production. Trends
Biotechnol., 20: 200−206.
Rao D. E. C. S., Rao K. V., Reddy T. P.,
Reddy V. D., 2009. Molecular
characterization, physicochemical
properties, known and potential
applications of phytases: an overview.
Crit. Rev. Biotechnol., 29: 182−198.
Schmittgen T. D., Livak K. J., 2008.
Analyzing real-time PCR data by the
comparative Ct method. Nat. Protoc., 3:
1101−108.
Tsuchiya K., Tada S., Gomi K., Kitamoto K.,
Kumagai C., Tamura G., 1992. Deletion
analysis of the Taka-amylase A gene
promoter using a homologous
transformation system in Aspergillus
oryzae. Biosci. Biotechnol. Biochem., 56:
1849−1853.
Varga J., Frisvad J. C., Samson R., 2011. Two
new aflatoxin producing species, and an
overview of Aspergillus section Flavi.
Stud. Mycol., 69: 57−80.
White T. J., Bruns T., Lee S. J. W. T., Taylor
J., 1990. Amplification and direct
sequencing of fungal ribosomal RNA
genes for phylogenetics. PCR protocols: a
guide to methods and applications, 18:
315−322.
Zhu L., Maruyama J. I., Kitamoto K., 2013.
Further enhanced production of
heterologous proteins by double-gene
disruption (ΔAosedD ΔAovps10) in a
hyper-producing mutant of Aspergillus
oryzae. Appl. Biochem. Biotechnol., 97:
6347−6357.