Infection status of Mycoplasma hyopneumoniae in experimental pigs at a commercial farm

Resistance to the disease after recovering appears to be dependent on a balance between the immune status of the animals and the pathogen load. In the study, those pigs received antibiotics like other herds in farm via feed and water additives. Additionally, under field conditions, antimicrobial treatment may be effective against bacteria respiratory pathogens specifically MH, and it can be implemented to reach a low infectious pressure in the farm at that moment (Thacker & Minion, 2012). This given medication modifies the pig’ microbiota and alteration of epithelial mucosal bacteria influences development on the study pigs’ respiratory immune system (Arsenakis et al., 2017). Thus, besides vaccination, several treatment strategies should be considered as the sole to mitigate expression of disease and reduce prevalence within herd. 4. Conclusions High prevalence of MH in the farm and the infection occurred from the time of 2-3 weeks after weaning until beginning of finishing period, weeks 9-10. Acknowledgements The study was sponsored by Scientific Research Fund of Nong Lam University, HCMC, Vietnam. We would like to express our gratitude to the farm owner for their facility and other volunteer student for sample collection.

pdf6 trang | Chia sẻ: hachi492 | Lượt xem: 81 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Infection status of Mycoplasma hyopneumoniae in experimental pigs at a commercial farm, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
22 Nong Lam University, Ho Chi Minh City Infection status of Mycoplasma hyopneumoniae in experimental pigs at a commercial farm Huyen T. N. Bui∗, Hien T. Le, & Toan T. Nguyen Faculty of Animal Science and Veterinary Medicine, Nong Lam University, Ho Chi Minh City, Vietnam ARTICLE INFO Research Paper Received: March 05, 2020 Revised: May 11, 2020 Accepted: June 09, 2020 Keywords Antibodies ELISA Infection ratio Mycoplasma hyopneumoniae (MH) PCR ∗Corresponding author Bui Thi Ngoc Huyen Email: huyen.btngoc@gmail.com ABSTRACT The objective of this study was to investigate the profiles of Mycoplasma hyopneumoniae (MH) infection at different ages of pig in a sow – finishing herd using serological and molecular methods. A total of 30 study piglets were born from non-vaccinated sows with MH. They were injected one-dose of inactivated MH vaccine at the 10th week. MH infection status was evaluated by using ELISA to detect MH antibodies from blood samples, and PCR to detect MH DNA in nasal swabs or oral fluid samples every other weeks from newborn to slaughter time. The results of this study showed that PCR positive proportions were low at 1st-2nd week (7-13%), then increased significantly during 5th -7th week (73-79%), and reduced at 8th week (33%); finally became negative after 13th week of age. This pattern corresponds to the one of antibody level. In particular, the level of maternal antibodies against MH was very high due to maternal immunity, then decreased gradually to negative at 7-8 weeks of age, and finally increased gradually from 13 weeks of age to all positive at 25 weeks of age. In conclusion, the result showed that in this herd, MH might invade pigs by the time of 5-7 weeks of age after maternal immunity disappears, and humoral response can overcome the infection at week 13. This should be noted to have appropriate strategies to control MH at the farm. Cited as: Bui, H. T. N., Le, H. T., & Nguyen, T. T. (2020). Infection status of Mycoplasma hyop- neumoniae in experimental pigs at a commercial farm. The Journal of Agriculture and Development 19(3), 22-27. 1. Introduction Mycoplasma hyopneumoniae (MH) is a princi- pal aetiological agent of porcine enzootic pneu- monia (EP), a respiratory disease that mainly affects growing and finishing pigs (Maes et al., 1996). MH infection causes damage to the lung lesions, and modulates immune response of the host. MH primary infection often becomes more serious when getting co-infections by other bac- teria and viruses such as Pasteurella multocida, Streptococcus suis, Actinobacillus pleuropneumo- niae (APP), Porcine Respiratory and Reproduc- tive Syndrome Virus (PRRSV), and Porcine Cir- covirus type 2 (PCV2), etc. leading to a complica- tion called Porcine Respiratory Disease Complex (PRDC) (Thacker et al., 2000). Once infected, pigs become stunted, low growth rate, poor feed conversion ratio (FCR), as a result of high culling rate in the herd, massive cost of treatment, and getting more susceptible to secondary pathogens (Thacker & Minion, 2012). It is estimated that approximately 80% of pig production had been affected with the disease and every one infected pig cost approximately 4-7 USD (Haden et al., 2012). In order to evaluate the effectiveness of the vac- cination plan, it is essential to get a better under- standing the situation of MH infection through- out stages of production in farm. The objective The Journal of Agriculture and Development 19(3) www.jad.hcmuaf.edu.vn Nong Lam University, Ho Chi Minh City 23 of this study was to investigate the dynamics of MH infection at different ages in a pig herd by using ELISA and PCR to detect both antibodies and the bacterium DNA. The result of this study also helped to estimate the infected time and risk period under field conditions. 2. Materials and Methods 2.1. Experimental design The study was conducted from February 2019 to October 2019 in a medium – scale pig farm with a scale of 1000 grow-finisher pigs and 200 sows, a type of open-housing system, in Xuan Loc district, Dong Nai Province. A total of thirty piglets from five 3rd-5th par- ity sows that these sows had been checked to be free of PRRSV, CSFV and MH based on PCR tests (one week before farrowing) on individual oral fluid samples and determined level of anti- body against MH basing on ELISA test (one hour after farrowing) was enrolled in the study. From each sow, 3 male and 3 female newborn piglets with the same size and the same body condi- tions were selected, and individually marked by ear tags from number 1 to 30, raised stable during the whole period of the study. According to vacci- nation program of farm, all these piglets were in- jected one-dose of Bayovacr MycoGuardr-1 vac- cine at the 10th day of age. The piglets were weaned at 24 days-old and mixed together in only one pen (basic floor pen) until they were trans- ported to slaughterhouse. The MH infection status of experimental pigs was determined via testing of both blood samples and nasal swab/ oral fluid samples at different ages. Sampling timeline was designed according to life-stage of study pigs, i.e. the first 60 days of age (week 1-8); nursery phase (week 9-12) and finishing phase (week 13 – 25). In particular, indi- vidual blood samples were taken from study pigs based on week-age, i.e. week 1, 2, 4, 5, 7, 8, 13, 19 and 25 weeks, respectively. In addition to blood samples, individual nasal swabs were collected for the first 8 weeks of age, however, pooled oral fluid samples were collected for whole studied group at the later stages (week 13, 19 and 25). Each sampling time, only 50% of studied pigs would be sampled and 50% remain pigs would be sampled at the next time to avoid piglets hav- ing been bled for 2 consecutive weeks. In details, at the 1st week, 3 piglets per litter were selected alternately male or female to collect samples for every 2 weeks, and at the following week the other half would be sampled for every 2 weeks. It means a total of 15 piglets were assigned to take samples per week throughout the timeline except for the week of weaning. 2.2. ELISA and PCR procedures From the nasal swabs and oral fluids, DNA was extracted to run a standard PCR to de- tect a fragment of 16S rRNA gene of MH. The assay was previously described and performed by using primers according to Abhijit et al. (2012) with the specific primers (sequence with 5’ – 3’ direction) for DNA amplification (F: ACTAGATAGGAAATGCTCTAG and R: AT- ACTACTCAGGCGGATCATTTAAC) to have a product of 430bp in length. Blood samples were stored in cool condition for less than 24 hours, af- ter that serum was aspirated from the tube and frozen in refrigerator -20oC until analysis. These serum samples were analyzed for the presence of antibodies against MH with an indirect ELISA (IDEXX M. hyo. Ab test kit, USA). The output of ELISA was read with a 650 nm filter to calcu- late the S/P value of each sample. The result is defined as positive when S/P ratios were > 0.4, S/P ratios of 0.3 to 0.4 were classified as suspect and S/P ratios < 0.3 were classified as negative. MH antibody titer was evaluated from S/P using the formula recommended by the kit producer: Titer = Antilog10(1.09 * Log10(S/P) + 3.36). These laboratory procedures were performed at the diagnostic center of Veterinary Hospital of Nong Lam University, Ho Chi Minh City, Viet- nam. 2.3. Statistical analysis Data was managed and performed simple anal- ysis using Microsoft Excel 2013 (Microsoft Corp., Redmond, WA). Proportions of sample number being positive were calculated, and means of titer with standard error were calculated for each sampling time. Multilevel regression was used to model the pattern of MH titer in which depen- dent variable was titer, independent variables in- cluded week age, quadratic week age, cubic week age, sex (male/female), day-0 weight, maternal MH (positive/negative), and litter identification was random variable. Backward elimination ap- www.jad.hcmuaf.edu.vn The Journal of Agriculture and Development 19(3) 24 Nong Lam University, Ho Chi Minh City proach was used to build the final model with the statistical significance level (P) of 0.05. The final parameter model results are applied to a simula- tion data for graphing dynamics of MH infection of pig in the herd. These steps were performed with STATA 14 software (StataCorp., 2015. Stata Statistical Software: Release 14. College Station, TX: StataCorp LP). 3. Results and Discussion 3.1. Detection of MH by PCR The presence of MH detected by PCR in nasal swabs (week 1 – week 8) and oral fluids (week 13- week 25) are shown in Figure 1.The MH infection proportion at the first week was 7% (1/15), then it gradually rises to 13% and 20% at week 2 and week 4, respectively (Figure 1). A significant in- crease of MH infection is observed and reached 79% at week 7. However, at 8 weeks of age, the MH infection proportion dropped markedly to 33%. After 8 weeks of age, the number of samples required to detect MH DNA of study pigs is high, which result in costly diagnosis. To over- come some of these limitations, instead of tak- ing individual nasal swab samples, we obtained pooled oral fluid samples for the group of study pigs to perform PCR. For the pooled oral fluid samples, all of them were negative for MH at week 13, week 19 and week 25. It was generally inter- preted that the individual could also be consid- ered all study pigs were negative with MH or MH infection rate was in very low level, so that the result was negative at all. Figure 1. The MH infection proportion defined by PCR in pigs by the week of age. MH infection at week 1 was the lowest could be explained by negative MH shedding sows selected and the effects of the passive transfer of maternal MH antibodies and specific cellular immunity to piglets via colostrum. The maternal immunity are known critical to prevent or reduce the impact of infectious diseases in the neonate for a few days to several weeks after birth. In the studied farm, MH vaccination is applied for piglets not in sow. That means enzootic pneumonia might be endemic in a sow herd particularly in continuous production systems (Sheldrake et al., 1990; Bandrick et al., 2008), and the maternal immunity are ready in sow in such level to transfer to piglets. In fact, all sows were negative in PCR result for MH but 3/5 sows were positive with antibody by ELISA (data not shown). And MH might be from the environment to accidentally infect to a pig. From week 2, maternal MH antibodies have not been enough to help them fight the disease; how- ever, these suckling piglets are in nursing phase so that rarely exposed to the external environment, the proportion was increasing slowly. The wean- ing age of 21 days was the time that the mater- nally immunity eventually wanes (Meyns et al., 2004). These piglets separated from their sows experienced marked physiological, environmen- tal, mixing and social challenges (stressors) that could predispose them to MH infection. There- fore, the period between week 4 and week 7, it was the potential to increase the susceptibility of piglets to get infection by impact of MH in the environment and from the other infectious pen- mates. The infection proportion began to diminish and especially reach zero with MH at week 13, 19 and 25 by pooled oral fluid samples. It was generally supposed that the results of these pooled samples could be as follows: if the results are negative, the individual could also be considered all study pigs were negative with MH or MH infection rate was in very low level inconsiderably, so that the result was negative at all. It is known that the high-risk period of MH infections occurrence un- der field production conditions is the phase after transfer of animals to the finishing facilities (10 weeks of age) (Le´on et al., 2001). Moreover, dur- ing this period, the farm increased the use of an- timicrobials, minerals and vitamins via feed and water to control MH and maintain pig health. Thus, these antimicrobials for the treatment and control of MH infections could be helpful in af- fected pigs. Based on above considerations, the negative results of pooled oral fluid samples at every sampling time demonstrated for efficiency of antibiotics on reducing the positive rate with The Journal of Agriculture and Development 19(3) www.jad.hcmuaf.edu.vn Nong Lam University, Ho Chi Minh City 25 MH infection by PCR. These findings is similar to the previous study that all pen-based oral fluid samples for MH in finishing phase were negative (Sibila et al., 2007). Piglets were vaccinated with inactivated vaccine which might slow induce im- munity, but at these points of time, high level of antibody from field infection and vaccine could boost to the level of eliminating the bacteria. Fi- nally, these results indicated the presence of MH in the respiratory tract, which could be related to the presence of antibodies in the blood of study pigs. 3.2. Detection of MH antibody After performing ELISA tests for serum sam- ples, the MH antibody positive proportion and means of titers by week age are illustrated in Figure 2. At the first week of age, the anti- body positive proportion with MH was highest (53%), equivalent to the highest antibody titer of 1532.47. After that, the rate of positive serum for MH began to decrease from the second week (pro- portion of 40%, titer of 904.04) to week 8, only 0%, equivalent to the antibody concentration of 204.59. Then, the antibody positive proportion as well as mean of titer increased significantly and reached 100% (1321.59) at week 25. These results coincide with those obtained in field studies using ELISA by Morrison et al. (1985) who noted that antibodies to M. hyopneumoniae were detected again at 90 to 150 days of age, and Sheldrake et al. (1990) reported that most pigs seroconverted between 86 and 144 days of age. According to Figure 1 and Figure 2, the MH infection status was illustrated compatibly when positive ratios in PCR and ELISA result had con- trary directions. In the present study, high preva- lence of MH infection occurred around the time of post-weaning period until beginning of finishing period. The critical moment for the exposure to M. hyopneumoniae was around 9-10 weeks of age and most of them have very low concentrations of antibodies against the agent. 3.3. Modeling of antibody titer against MH Antibody titer values from the studied piglets by age were modeled to understand the pattern of its change and any other related factors such as gender, body weight, maternal antibody, etc. The result from modeling found that week-age has a cubic relationship with antibody titer. Maternal antibody (MAB) in this model is a binary vari- able in which the sow transferred MH antibody to piglets or not. The reason is that each piglet can receive different level of MAB. The other con- cerned variables were not significant in the mod- eling construction. The final model is described in Table 1 and the simulation of this model can be seen in Figure 3. The positive result was con- firmed when S/P ratios were > 0.4, so the cut-off value was calculated as 843 according to the kit formula with S/P = 0.4 to classify boundary of MH titer with or without MAB. According to modeling illustration, we found that the average age at which piglets lost pro- tection lies well between 2nd week and 4th week. The titer of pigs having MAB did not decline as rapidly as those of without-MAB pigs. Addition- ally, we observed that the lowest level of anti- bodies was in the period from 8th week to 10th week of age; and protection afforded by MAB had higher level than piglets lacking of MAB. After- wards, from week 16 to 20, the diagram indicated that both groups had a seroconversion that the antibody level reached to detectable values and continued to increase. However, we assessed that MAB group increased titer earlier than that of the without MAB pigs. 3.4. General discussion Thacker et al. (2000) suggested that both local mucosal antibodies and systemic cell-mediated immunity responses are important for protection. Therefore, by using serum to detect IgG antibod- ies to MH by ELISA, this study cannot evaluate the mucosal antibody because MH is a mucosal pathogen which mainly adheres to the cilia of the epithelial cells on the respiratory tract, the pro- duction of IgA antibody blocking MH attachment to the mucosal surface is believed to play a key role in protection (Zhang et al., 1995). It is gener- ally that IgA predominates in the mucosal secre- tions, whereas IgG predominates in serum. How- ever, there was no correlation between antibody titer or IgG concentrations in serum and level of protection against MH infection (Djordjevic et al., 1997). Thus, it is difficult to link the antibody to the presence of MH on the respiratory track, and this presence cannot refer to infection. How- ever, at least, the antibody level in serum can im- ply the time of infection in piglet. That means it is valuable comparing to PCR which might more refer to the high risk time. www.jad.hcmuaf.edu.vn The Journal of Agriculture and Development 19(3) 26 Nong Lam University, Ho Chi Minh City Figure 2. Antibody positive percentage (bars) and antibody level against MH ± SE (line) in pigs by week of age. Table 1. Modeling of piglet antibody titer values by variables Variables Coefficient 95% Confidence Interval P value (Week age) -391.825 -499.498 -284.152 < 0.001 (Week age)2 28.678 18.921 38.435 < 0.001 (Week age)3 -0.549 -0.794 -0.305 < 0.001 MAB 383.192 213.323 553.062 < 0.001 Constant 1510.820 1193.526 1828.114 < 0.001 Figure 3. Modeling pig MH antibody titer values by variables (week age, with or without maternal immu- nity). The Journal of Agriculture and Development 19(3) www.jad.hcmuaf.edu.vn Nong Lam University, Ho Chi Minh City 27 Resistance to the disease after recovering ap- pears to be dependent on a balance between the immune status of the animals and the pathogen load. In the study, those pigs received antibiotics like other herds in farm via feed and water addi- tives. Additionally, under field conditions, antimi- crobial treatment may be effective against bac- teria respiratory pathogens specifically MH, and it can be implemented to reach a low infectious pressure in the farm at that moment (Thacker & Minion, 2012). This given medication modi- fies the pig’ microbiota and alteration of epithe- lial mucosal bacteria influences development on the study pigs’ respiratory immune system (Ar- senakis et al., 2017). Thus, besides vaccination, several treatment strategies should be considered as the sole to mitigate expression of disease and reduce prevalence within herd. 4. Conclusions High prevalence of MH in the farm and the in- fection occurred from the time of 2-3 weeks after weaning until beginning of finishing period, weeks 9-10. Acknowledgements The study was sponsored by Scientific Research Fund of Nong Lam University, HCMC, Vietnam. We would like to express our gratitude to the farm owner for their facility and other volunteer student for sample collection. References Abhijit, K. B., Lee, H. Y., Jeong, H. W., Truong, L. Q., Joo, H. G., & Hahn, T. W. (2012). An improved multiplex PCR for diagnosis and differentiation of My- coplasma hyopneumoniae and Mycoplasma hyorhinis. Korean Journal of Veterinary Research 52, 39-43. Arsenakis, I., Michiels, A., del Pozo Sacrista´n, R., Boyen, F., Haesebrouck, F., & Maes, D. (2017). Mycoplasma hyopneumoniae vaccination at or shortly before wean- ing under field conditions: a randomised efficacy trial. Veterinary Record 181(1), 19. Bandrick, M., Pieters, M., Pijoan, C., & Molitor, T. W. (2008). Passive transfer of maternal Mycoplasma hyop- neumoniae-specific cellular immunity to piglets. Clin- ical and vaccine immunology 15, 540-543. Djordjevic, S. P., Eamens, G. J., Romalis, L. F., Nicholls, P. J., Taylor, V., & Chin, J. (1997). Serum and mu- cosal antibody responses and protection in pigs vacci- nated against Mycoplasma hyopneumoniae with vac- cines containing a denatured membrane antigen pool and adjuvant. Australian Veterinary Journal 75, 504- 511. Haden, D. C., Painter, T., Fangman, T., & Holtkamp, D. (2012). Assessing production parameters and eco- nomic impact of swine influenza, PRRS and My- coplasma hyopneumoniae on finishing pigs in a large production system. Proceedings of American Associa- tion of Swine Veterinarians Annual (75-76). Denver, Colorado, America. Le´on, E. A., Madec, F., Taylor, N. M., & Kobisch, M. (2001). Seroepidemiology of Mycoplasma hyopneumo- niae in pigs from farrow-to-finish farms. Veterinary Microbiology 78, 331-341. Maes, D., Verdonck, M., Deluyker, H., & de Kruif, A. (1996). Enzootic pneumonia in pigs. Veterinary Quar- terly 18, 104-109. Meyns T., Maes D., Dewulf J., Vicca, J., Haesebrouck F., & de K. A. (2004). Quantification of the spread of Mycoplasma hyopneumoniae in nursery pigs using transmission experiments. Preventative Vetererinary Medicine 66, 265-275. Morrison, R. B., Hilley, H. D., & Leman, A. D. (1985). Comparison of methods for assessing the prevalence and extent of pneumonia in market weight swine. Canadian Veterinary Journal 26, 381-384. Sheldrake, R. F., Gardner, L. A., Saunders, M. M., & Ro- malis, L. F. (1990). Serum antibody response to My- coplasma hyopneumoniae measured by enzyme-linked immunosorbent assay after experimental and natural infection of pigs. Australian Veterinary Journal 67, 39- 42. Sibila, M., Nofrarias, M., Lopez-Soria, S., Segales, J., Valero, O., Espinal, A., & Calsamiglia, M. (2007). Chronological study of Mycoplasma hyopneumoniae infection, seroconversion and associated lung lesions in vaccinated and non-vaccinated pigs. Veterinary Mi- crobiology 122, 97-107. Thacker, E. L., Thacker, B. J., Kuhn, M., Hawkins, P. A., & Waters, W. R. (2000). Evaluation of local and systemic immune responses induced by intramuscu- lar injection of a Mycoplasma hyopneumoniae bacterin to pigs. American Journal of Veterinary Research 61, 1384-1389. Thacker E., & Minion, F. (2012). Mycoplasmosis. In Zimmerman, J. J., Karriker, L. A., Ramirez, A., Schwartz, K. J., & Stevenson, W. G. (Eds.). Diseases of Swine (10th ed., 779–798). New Jersey, USA: Wiley- Blackwell. Zhang, Q., Young, T. F., & Ross, R. F. (1995). Identifi- cation and characterisation of a Mycoplasma hyopneu- moniae adhesin. lnfection lmmunology 63, 1013-1019. www.jad.hcmuaf.edu.vn The Journal of Agriculture and Development 19(3)

Các file đính kèm theo tài liệu này:

  • pdfinfection_status_of_mycoplasma_hyopneumoniae_in_experimental.pdf