Resistance to the disease after recovering appears to be dependent on a balance between the
immune status of the animals and the pathogen
load. In the study, those pigs received antibiotics
like other herds in farm via feed and water additives. Additionally, under field conditions, antimicrobial treatment may be effective against bacteria respiratory pathogens specifically MH, and
it can be implemented to reach a low infectious
pressure in the farm at that moment (Thacker
& Minion, 2012). This given medication modifies the pig’ microbiota and alteration of epithelial mucosal bacteria influences development on
the study pigs’ respiratory immune system (Arsenakis et al., 2017). Thus, besides vaccination,
several treatment strategies should be considered
as the sole to mitigate expression of disease and
reduce prevalence within herd.
4. Conclusions
High prevalence of MH in the farm and the infection occurred from the time of 2-3 weeks after
weaning until beginning of finishing period, weeks
9-10.
Acknowledgements
The study was sponsored by Scientific Research
Fund of Nong Lam University, HCMC, Vietnam.
We would like to express our gratitude to the
farm owner for their facility and other volunteer
student for sample collection.
6 trang |
Chia sẻ: hachi492 | Lượt xem: 96 | Lượt tải: 0Free
Bạn đang xem nội dung tài liệu Infection status of Mycoplasma hyopneumoniae in experimental pigs at a commercial farm, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
22 Nong Lam University, Ho Chi Minh City
Infection status of Mycoplasma hyopneumoniae in experimental pigs at a commercial
farm
Huyen T. N. Bui∗, Hien T. Le, & Toan T. Nguyen
Faculty of Animal Science and Veterinary Medicine, Nong Lam University, Ho Chi Minh City, Vietnam
ARTICLE INFO
Research Paper
Received: March 05, 2020
Revised: May 11, 2020
Accepted: June 09, 2020
Keywords
Antibodies
ELISA
Infection ratio
Mycoplasma hyopneumoniae (MH)
PCR
∗Corresponding author
Bui Thi Ngoc Huyen
Email: huyen.btngoc@gmail.com
ABSTRACT
The objective of this study was to investigate the profiles of
Mycoplasma hyopneumoniae (MH) infection at different ages of pig
in a sow – finishing herd using serological and molecular methods.
A total of 30 study piglets were born from non-vaccinated sows
with MH. They were injected one-dose of inactivated MH vaccine
at the 10th week. MH infection status was evaluated by using
ELISA to detect MH antibodies from blood samples, and PCR to
detect MH DNA in nasal swabs or oral fluid samples every other
weeks from newborn to slaughter time. The results of this study
showed that PCR positive proportions were low at 1st-2nd week
(7-13%), then increased significantly during 5th -7th week (73-79%),
and reduced at 8th week (33%); finally became negative after 13th
week of age. This pattern corresponds to the one of antibody level.
In particular, the level of maternal antibodies against MH was
very high due to maternal immunity, then decreased gradually to
negative at 7-8 weeks of age, and finally increased gradually from
13 weeks of age to all positive at 25 weeks of age. In conclusion,
the result showed that in this herd, MH might invade pigs by the
time of 5-7 weeks of age after maternal immunity disappears, and
humoral response can overcome the infection at week 13. This
should be noted to have appropriate strategies to control MH at
the farm.
Cited as: Bui, H. T. N., Le, H. T., & Nguyen, T. T. (2020). Infection status of Mycoplasma hyop-
neumoniae in experimental pigs at a commercial farm. The Journal of Agriculture and Development
19(3), 22-27.
1. Introduction
Mycoplasma hyopneumoniae (MH) is a princi-
pal aetiological agent of porcine enzootic pneu-
monia (EP), a respiratory disease that mainly
affects growing and finishing pigs (Maes et al.,
1996). MH infection causes damage to the lung
lesions, and modulates immune response of the
host. MH primary infection often becomes more
serious when getting co-infections by other bac-
teria and viruses such as Pasteurella multocida,
Streptococcus suis, Actinobacillus pleuropneumo-
niae (APP), Porcine Respiratory and Reproduc-
tive Syndrome Virus (PRRSV), and Porcine Cir-
covirus type 2 (PCV2), etc. leading to a complica-
tion called Porcine Respiratory Disease Complex
(PRDC) (Thacker et al., 2000). Once infected,
pigs become stunted, low growth rate, poor feed
conversion ratio (FCR), as a result of high culling
rate in the herd, massive cost of treatment, and
getting more susceptible to secondary pathogens
(Thacker & Minion, 2012). It is estimated that
approximately 80% of pig production had been
affected with the disease and every one infected
pig cost approximately 4-7 USD (Haden et al.,
2012).
In order to evaluate the effectiveness of the vac-
cination plan, it is essential to get a better under-
standing the situation of MH infection through-
out stages of production in farm. The objective
The Journal of Agriculture and Development 19(3) www.jad.hcmuaf.edu.vn
Nong Lam University, Ho Chi Minh City 23
of this study was to investigate the dynamics of
MH infection at different ages in a pig herd by
using ELISA and PCR to detect both antibodies
and the bacterium DNA. The result of this study
also helped to estimate the infected time and risk
period under field conditions.
2. Materials and Methods
2.1. Experimental design
The study was conducted from February 2019
to October 2019 in a medium – scale pig farm
with a scale of 1000 grow-finisher pigs and 200
sows, a type of open-housing system, in Xuan Loc
district, Dong Nai Province.
A total of thirty piglets from five 3rd-5th par-
ity sows that these sows had been checked to be
free of PRRSV, CSFV and MH based on PCR
tests (one week before farrowing) on individual
oral fluid samples and determined level of anti-
body against MH basing on ELISA test (one hour
after farrowing) was enrolled in the study. From
each sow, 3 male and 3 female newborn piglets
with the same size and the same body condi-
tions were selected, and individually marked by
ear tags from number 1 to 30, raised stable during
the whole period of the study. According to vacci-
nation program of farm, all these piglets were in-
jected one-dose of Bayovacr MycoGuardr-1 vac-
cine at the 10th day of age. The piglets were
weaned at 24 days-old and mixed together in only
one pen (basic floor pen) until they were trans-
ported to slaughterhouse.
The MH infection status of experimental pigs
was determined via testing of both blood samples
and nasal swab/ oral fluid samples at different
ages. Sampling timeline was designed according
to life-stage of study pigs, i.e. the first 60 days
of age (week 1-8); nursery phase (week 9-12) and
finishing phase (week 13 – 25). In particular, indi-
vidual blood samples were taken from study pigs
based on week-age, i.e. week 1, 2, 4, 5, 7, 8, 13, 19
and 25 weeks, respectively. In addition to blood
samples, individual nasal swabs were collected for
the first 8 weeks of age, however, pooled oral fluid
samples were collected for whole studied group at
the later stages (week 13, 19 and 25).
Each sampling time, only 50% of studied pigs
would be sampled and 50% remain pigs would be
sampled at the next time to avoid piglets hav-
ing been bled for 2 consecutive weeks. In details,
at the 1st week, 3 piglets per litter were selected
alternately male or female to collect samples for
every 2 weeks, and at the following week the other
half would be sampled for every 2 weeks. It means
a total of 15 piglets were assigned to take samples
per week throughout the timeline except for the
week of weaning.
2.2. ELISA and PCR procedures
From the nasal swabs and oral fluids, DNA
was extracted to run a standard PCR to de-
tect a fragment of 16S rRNA gene of MH. The
assay was previously described and performed
by using primers according to Abhijit et al.
(2012) with the specific primers (sequence with
5’ – 3’ direction) for DNA amplification (F:
ACTAGATAGGAAATGCTCTAG and R: AT-
ACTACTCAGGCGGATCATTTAAC) to have a
product of 430bp in length. Blood samples were
stored in cool condition for less than 24 hours, af-
ter that serum was aspirated from the tube and
frozen in refrigerator -20oC until analysis. These
serum samples were analyzed for the presence of
antibodies against MH with an indirect ELISA
(IDEXX M. hyo. Ab test kit, USA). The output
of ELISA was read with a 650 nm filter to calcu-
late the S/P value of each sample. The result is
defined as positive when S/P ratios were > 0.4,
S/P ratios of 0.3 to 0.4 were classified as suspect
and S/P ratios < 0.3 were classified as negative.
MH antibody titer was evaluated from S/P using
the formula recommended by the kit producer:
Titer = Antilog10(1.09 * Log10(S/P) + 3.36).
These laboratory procedures were performed at
the diagnostic center of Veterinary Hospital of
Nong Lam University, Ho Chi Minh City, Viet-
nam.
2.3. Statistical analysis
Data was managed and performed simple anal-
ysis using Microsoft Excel 2013 (Microsoft Corp.,
Redmond, WA). Proportions of sample number
being positive were calculated, and means of
titer with standard error were calculated for each
sampling time. Multilevel regression was used to
model the pattern of MH titer in which depen-
dent variable was titer, independent variables in-
cluded week age, quadratic week age, cubic week
age, sex (male/female), day-0 weight, maternal
MH (positive/negative), and litter identification
was random variable. Backward elimination ap-
www.jad.hcmuaf.edu.vn The Journal of Agriculture and Development 19(3)
24 Nong Lam University, Ho Chi Minh City
proach was used to build the final model with the
statistical significance level (P) of 0.05. The final
parameter model results are applied to a simula-
tion data for graphing dynamics of MH infection
of pig in the herd. These steps were performed
with STATA 14 software (StataCorp., 2015. Stata
Statistical Software: Release 14. College Station,
TX: StataCorp LP).
3. Results and Discussion
3.1. Detection of MH by PCR
The presence of MH detected by PCR in nasal
swabs (week 1 – week 8) and oral fluids (week 13-
week 25) are shown in Figure 1.The MH infection
proportion at the first week was 7% (1/15), then
it gradually rises to 13% and 20% at week 2 and
week 4, respectively (Figure 1). A significant in-
crease of MH infection is observed and reached
79% at week 7. However, at 8 weeks of age, the
MH infection proportion dropped markedly to
33%.
After 8 weeks of age, the number of samples
required to detect MH DNA of study pigs is
high, which result in costly diagnosis. To over-
come some of these limitations, instead of tak-
ing individual nasal swab samples, we obtained
pooled oral fluid samples for the group of study
pigs to perform PCR. For the pooled oral fluid
samples, all of them were negative for MH at week
13, week 19 and week 25. It was generally inter-
preted that the individual could also be consid-
ered all study pigs were negative with MH or MH
infection rate was in very low level, so that the
result was negative at all.
Figure 1. The MH infection proportion defined by
PCR in pigs by the week of age.
MH infection at week 1 was the lowest could be
explained by negative MH shedding sows selected
and the effects of the passive transfer of maternal
MH antibodies and specific cellular immunity to
piglets via colostrum. The maternal immunity are
known critical to prevent or reduce the impact of
infectious diseases in the neonate for a few days to
several weeks after birth. In the studied farm, MH
vaccination is applied for piglets not in sow. That
means enzootic pneumonia might be endemic in
a sow herd particularly in continuous production
systems (Sheldrake et al., 1990; Bandrick et al.,
2008), and the maternal immunity are ready in
sow in such level to transfer to piglets. In fact,
all sows were negative in PCR result for MH but
3/5 sows were positive with antibody by ELISA
(data not shown). And MH might be from the
environment to accidentally infect to a pig.
From week 2, maternal MH antibodies have not
been enough to help them fight the disease; how-
ever, these suckling piglets are in nursing phase so
that rarely exposed to the external environment,
the proportion was increasing slowly. The wean-
ing age of 21 days was the time that the mater-
nally immunity eventually wanes (Meyns et al.,
2004). These piglets separated from their sows
experienced marked physiological, environmen-
tal, mixing and social challenges (stressors) that
could predispose them to MH infection. There-
fore, the period between week 4 and week 7, it
was the potential to increase the susceptibility of
piglets to get infection by impact of MH in the
environment and from the other infectious pen-
mates.
The infection proportion began to diminish and
especially reach zero with MH at week 13, 19 and
25 by pooled oral fluid samples. It was generally
supposed that the results of these pooled samples
could be as follows: if the results are negative,
the individual could also be considered all study
pigs were negative with MH or MH infection rate
was in very low level inconsiderably, so that the
result was negative at all. It is known that the
high-risk period of MH infections occurrence un-
der field production conditions is the phase after
transfer of animals to the finishing facilities (10
weeks of age) (Le´on et al., 2001). Moreover, dur-
ing this period, the farm increased the use of an-
timicrobials, minerals and vitamins via feed and
water to control MH and maintain pig health.
Thus, these antimicrobials for the treatment and
control of MH infections could be helpful in af-
fected pigs. Based on above considerations, the
negative results of pooled oral fluid samples at
every sampling time demonstrated for efficiency
of antibiotics on reducing the positive rate with
The Journal of Agriculture and Development 19(3) www.jad.hcmuaf.edu.vn
Nong Lam University, Ho Chi Minh City 25
MH infection by PCR. These findings is similar
to the previous study that all pen-based oral fluid
samples for MH in finishing phase were negative
(Sibila et al., 2007). Piglets were vaccinated with
inactivated vaccine which might slow induce im-
munity, but at these points of time, high level of
antibody from field infection and vaccine could
boost to the level of eliminating the bacteria. Fi-
nally, these results indicated the presence of MH
in the respiratory tract, which could be related to
the presence of antibodies in the blood of study
pigs.
3.2. Detection of MH antibody
After performing ELISA tests for serum sam-
ples, the MH antibody positive proportion and
means of titers by week age are illustrated in
Figure 2. At the first week of age, the anti-
body positive proportion with MH was highest
(53%), equivalent to the highest antibody titer of
1532.47. After that, the rate of positive serum for
MH began to decrease from the second week (pro-
portion of 40%, titer of 904.04) to week 8, only
0%, equivalent to the antibody concentration of
204.59. Then, the antibody positive proportion as
well as mean of titer increased significantly and
reached 100% (1321.59) at week 25. These results
coincide with those obtained in field studies using
ELISA by Morrison et al. (1985) who noted that
antibodies to M. hyopneumoniae were detected
again at 90 to 150 days of age, and Sheldrake et
al. (1990) reported that most pigs seroconverted
between 86 and 144 days of age.
According to Figure 1 and Figure 2, the MH
infection status was illustrated compatibly when
positive ratios in PCR and ELISA result had con-
trary directions. In the present study, high preva-
lence of MH infection occurred around the time of
post-weaning period until beginning of finishing
period. The critical moment for the exposure to
M. hyopneumoniae was around 9-10 weeks of age
and most of them have very low concentrations
of antibodies against the agent.
3.3. Modeling of antibody titer against MH
Antibody titer values from the studied piglets
by age were modeled to understand the pattern
of its change and any other related factors such as
gender, body weight, maternal antibody, etc. The
result from modeling found that week-age has a
cubic relationship with antibody titer. Maternal
antibody (MAB) in this model is a binary vari-
able in which the sow transferred MH antibody
to piglets or not. The reason is that each piglet
can receive different level of MAB. The other con-
cerned variables were not significant in the mod-
eling construction. The final model is described
in Table 1 and the simulation of this model can
be seen in Figure 3. The positive result was con-
firmed when S/P ratios were > 0.4, so the cut-off
value was calculated as 843 according to the kit
formula with S/P = 0.4 to classify boundary of
MH titer with or without MAB.
According to modeling illustration, we found
that the average age at which piglets lost pro-
tection lies well between 2nd week and 4th week.
The titer of pigs having MAB did not decline as
rapidly as those of without-MAB pigs. Addition-
ally, we observed that the lowest level of anti-
bodies was in the period from 8th week to 10th
week of age; and protection afforded by MAB had
higher level than piglets lacking of MAB. After-
wards, from week 16 to 20, the diagram indicated
that both groups had a seroconversion that the
antibody level reached to detectable values and
continued to increase. However, we assessed that
MAB group increased titer earlier than that of
the without MAB pigs.
3.4. General discussion
Thacker et al. (2000) suggested that both local
mucosal antibodies and systemic cell-mediated
immunity responses are important for protection.
Therefore, by using serum to detect IgG antibod-
ies to MH by ELISA, this study cannot evaluate
the mucosal antibody because MH is a mucosal
pathogen which mainly adheres to the cilia of the
epithelial cells on the respiratory tract, the pro-
duction of IgA antibody blocking MH attachment
to the mucosal surface is believed to play a key
role in protection (Zhang et al., 1995). It is gener-
ally that IgA predominates in the mucosal secre-
tions, whereas IgG predominates in serum. How-
ever, there was no correlation between antibody
titer or IgG concentrations in serum and level
of protection against MH infection (Djordjevic et
al., 1997). Thus, it is difficult to link the antibody
to the presence of MH on the respiratory track,
and this presence cannot refer to infection. How-
ever, at least, the antibody level in serum can im-
ply the time of infection in piglet. That means it
is valuable comparing to PCR which might more
refer to the high risk time.
www.jad.hcmuaf.edu.vn The Journal of Agriculture and Development 19(3)
26 Nong Lam University, Ho Chi Minh City
Figure 2. Antibody positive percentage (bars) and antibody level against MH ± SE (line) in pigs by week
of age.
Table 1. Modeling of piglet antibody titer values by variables
Variables Coefficient 95% Confidence Interval P value
(Week age) -391.825 -499.498 -284.152 < 0.001
(Week age)2 28.678 18.921 38.435 < 0.001
(Week age)3 -0.549 -0.794 -0.305 < 0.001
MAB 383.192 213.323 553.062 < 0.001
Constant 1510.820 1193.526 1828.114 < 0.001
Figure 3. Modeling pig MH antibody titer values by variables (week age, with or without maternal immu-
nity).
The Journal of Agriculture and Development 19(3) www.jad.hcmuaf.edu.vn
Nong Lam University, Ho Chi Minh City 27
Resistance to the disease after recovering ap-
pears to be dependent on a balance between the
immune status of the animals and the pathogen
load. In the study, those pigs received antibiotics
like other herds in farm via feed and water addi-
tives. Additionally, under field conditions, antimi-
crobial treatment may be effective against bac-
teria respiratory pathogens specifically MH, and
it can be implemented to reach a low infectious
pressure in the farm at that moment (Thacker
& Minion, 2012). This given medication modi-
fies the pig’ microbiota and alteration of epithe-
lial mucosal bacteria influences development on
the study pigs’ respiratory immune system (Ar-
senakis et al., 2017). Thus, besides vaccination,
several treatment strategies should be considered
as the sole to mitigate expression of disease and
reduce prevalence within herd.
4. Conclusions
High prevalence of MH in the farm and the in-
fection occurred from the time of 2-3 weeks after
weaning until beginning of finishing period, weeks
9-10.
Acknowledgements
The study was sponsored by Scientific Research
Fund of Nong Lam University, HCMC, Vietnam.
We would like to express our gratitude to the
farm owner for their facility and other volunteer
student for sample collection.
References
Abhijit, K. B., Lee, H. Y., Jeong, H. W., Truong, L.
Q., Joo, H. G., & Hahn, T. W. (2012). An improved
multiplex PCR for diagnosis and differentiation of My-
coplasma hyopneumoniae and Mycoplasma hyorhinis.
Korean Journal of Veterinary Research 52, 39-43.
Arsenakis, I., Michiels, A., del Pozo Sacrista´n, R., Boyen,
F., Haesebrouck, F., & Maes, D. (2017). Mycoplasma
hyopneumoniae vaccination at or shortly before wean-
ing under field conditions: a randomised efficacy trial.
Veterinary Record 181(1), 19.
Bandrick, M., Pieters, M., Pijoan, C., & Molitor, T. W.
(2008). Passive transfer of maternal Mycoplasma hyop-
neumoniae-specific cellular immunity to piglets. Clin-
ical and vaccine immunology 15, 540-543.
Djordjevic, S. P., Eamens, G. J., Romalis, L. F., Nicholls,
P. J., Taylor, V., & Chin, J. (1997). Serum and mu-
cosal antibody responses and protection in pigs vacci-
nated against Mycoplasma hyopneumoniae with vac-
cines containing a denatured membrane antigen pool
and adjuvant. Australian Veterinary Journal 75, 504-
511.
Haden, D. C., Painter, T., Fangman, T., & Holtkamp,
D. (2012). Assessing production parameters and eco-
nomic impact of swine influenza, PRRS and My-
coplasma hyopneumoniae on finishing pigs in a large
production system. Proceedings of American Associa-
tion of Swine Veterinarians Annual (75-76). Denver,
Colorado, America.
Le´on, E. A., Madec, F., Taylor, N. M., & Kobisch, M.
(2001). Seroepidemiology of Mycoplasma hyopneumo-
niae in pigs from farrow-to-finish farms. Veterinary
Microbiology 78, 331-341.
Maes, D., Verdonck, M., Deluyker, H., & de Kruif, A.
(1996). Enzootic pneumonia in pigs. Veterinary Quar-
terly 18, 104-109.
Meyns T., Maes D., Dewulf J., Vicca, J., Haesebrouck
F., & de K. A. (2004). Quantification of the spread
of Mycoplasma hyopneumoniae in nursery pigs using
transmission experiments. Preventative Vetererinary
Medicine 66, 265-275.
Morrison, R. B., Hilley, H. D., & Leman, A. D. (1985).
Comparison of methods for assessing the prevalence
and extent of pneumonia in market weight swine.
Canadian Veterinary Journal 26, 381-384.
Sheldrake, R. F., Gardner, L. A., Saunders, M. M., & Ro-
malis, L. F. (1990). Serum antibody response to My-
coplasma hyopneumoniae measured by enzyme-linked
immunosorbent assay after experimental and natural
infection of pigs. Australian Veterinary Journal 67, 39-
42.
Sibila, M., Nofrarias, M., Lopez-Soria, S., Segales, J.,
Valero, O., Espinal, A., & Calsamiglia, M. (2007).
Chronological study of Mycoplasma hyopneumoniae
infection, seroconversion and associated lung lesions
in vaccinated and non-vaccinated pigs. Veterinary Mi-
crobiology 122, 97-107.
Thacker, E. L., Thacker, B. J., Kuhn, M., Hawkins, P.
A., & Waters, W. R. (2000). Evaluation of local and
systemic immune responses induced by intramuscu-
lar injection of a Mycoplasma hyopneumoniae bacterin
to pigs. American Journal of Veterinary Research 61,
1384-1389.
Thacker E., & Minion, F. (2012). Mycoplasmosis. In
Zimmerman, J. J., Karriker, L. A., Ramirez, A.,
Schwartz, K. J., & Stevenson, W. G. (Eds.). Diseases
of Swine (10th ed., 779–798). New Jersey, USA: Wiley-
Blackwell.
Zhang, Q., Young, T. F., & Ross, R. F. (1995). Identifi-
cation and characterisation of a Mycoplasma hyopneu-
moniae adhesin. lnfection lmmunology 63, 1013-1019.
www.jad.hcmuaf.edu.vn The Journal of Agriculture and Development 19(3)
Các file đính kèm theo tài liệu này:
infection_status_of_mycoplasma_hyopneumoniae_in_experimental.pdf