ACADEMIA JOURNAL OF BIOLOGY 2020, 42(3): 95–109
DOI: 10.15625/2615-9023/v42n3.14869
95
INVESTIGATION OF SALT-TOLERANT RHIZOSPHERE BACTERIA FROM
SEAWATER-INTRUDING PADDY RICE FIELD IN VIETNAM
Ho Tu Cuong1,*, Bui Van Cuong1,2, Lam Thuong Thuong1,
Tran Mai Hoang1, Luong Thi Thu Huong1, Pham Thi Diem Phuong3,
Nguyen Giang Son4, Nguyen Xuan Canh5
1Institute of Environmental Technology, VAST, Vietnam
2Institute for Tropical Technology, VAST, Vietnam
3Ho Chi Minh University of Natural Resources and Environment, Ho Chi Minh city, Vietnam
4Institute of Biological Resource and Ecology, VAST, Vietnam
5Vietnam National University of Agriculture, Ha Noi, Vietnam
Received 5 May 2020, accepted 6 August 2020
ABSTRACT
Salt‐tolerant plant growth‐promoting rhizobacteria (ST‐PGPR) are known as potential tools to
improve rice salinity tolerance. In this study, we aimed to investigate the plant growth‐promoting
rhizobacteria community richness of the paddy rice fields in Soc Trang and Ben Tre Provinces
where were seriously affected by sea level rise. The salinity in the sampling sites ranged from
0.14‰ to 2.17‰ in November 2018, the rainy season. The microbial abundance of samples was
evaluated by spreading the samples in tryptic soy agar (TSA) medium supplemented with various
concentrations of NaCl. With the increase of salt concentration up to 10% NaCl, a total number
of bacteria decreased for all the samples, ranging from 106 to 104 CFU/g, and bacterial colonies
were not observed at 30% NaCl. Among a total of 48 salt-resisting bacteria isolated from the rice
paddy field mud surrounding the rice root, 22 isolates were able to produce indole-3-acetic acid
(IAA: phytohormone for the plant growth). Seventeen out of 48 isolates were able to grow in the
medium without nitrogen or phosphor sources. Six isolates having high IAA producing activity,
nitrogen fixation and phosphate solubilization were belonged to Bacillus (DT6, LT16, and
LHT8), Halobacillus (DT8), Aeromonas (LHT1), and Klebsiella (LHT7) genera. All the
sequences of the strains DT6, DT8, LT16, LHT1, LHT7, and LHT8 were registered in the
GeneBank with the accession numbers MK335670, MK335671, MK335672, MK335673,
MK335674, and MK335675, respectively.
Keywords: PGPR, seawater intrusion, salinity tolerance, Mekong delta, rhizospherebacteria.
Citation: Ho T. C., Bui V. C., Lam T. T., Tran M. H., Luong T. T. H., Pham T. D. P., Nguyen G. S., Nguyen X. C.,
2020. Investigation of salt-tolerant rhizosphere bacteria from seawater-intruding paddy rice field in Vietnam.
Academia Journal of Biology, 42(3): 95–109. https://doi.org/10.15625/2615-9023/v42n3.14869.
*Corresponding author email:
[email protected]
©2020 Vietnam Academy of Science and Technology (VAST)
Ho Tu Cuong et al.
96
INTRODUCTION
Vietnam is a leading country for rice
(Oryza sativa) export, a half of rice
production and 70% of exported rice comes
from the Mekong Delta (Nguyen Thi Minh &
Kawaguchi, 2002). Recently, production of
rice in this region has been affected by the salt
intrusion and draught. In 2013, in Binh Dien
District, Ben Tre Province, about a half (500
ha) of 1,158 ha of the rice field were suffered
from the draught, lack of water, and high
salinity in the soil, resulted in the reduced
crop production by 70%. Also, SocTrang
Province in the Mekong Delta lost 600 ha of
rice field due to salt intrusion. In 2016, 11 out
of 13 provinces including Ben Tre and Soc
Trang provinces in the Mekong Delta suffered
from natural disasters such as draught and
salinity. Development of salt-tolerant crops
has been a much desired scientific goal but
still little success to date (Munns & Tester,
2008). An alternative possible method may be
the application of salt-tolerant microbes to
rice fields that will enhance crop growth.
Plant Growth Promoting Rhizobacteria
(PGPR) play an important role in sustainable
agricultural systems. PGPR can promote plant
growth because of its ability for non-
symbiotic nitrogen fixation, phosphate
solubilization, increased iron uptake,
suppression of plant pathogenic
microorganisms, and regulation of various
plant hormone levels, which leads
development of resistance to drought and
salinity stress. PGPR also can enhance plant
growth in a wide range of root-zone salinities,
and this strategy can be applied for crops to
manage with climate change-induced abiotic
stresses (Mapelli et al., 2013).
In this research, we focused on the
diversity of salt-tolerant PGPRin the salinity
regions of rice paddy fields in the Mekong
Delta. Some main groups of PGPR were
isolated and identified for future application to
improve the rice fieldsofthe currently difficult
conditions.
MATERIALS AND METHODS
Sampling
Water samples were collected from six
different sites at Dinh Trung, Thanh Phuoc,
An Hiep, Dai An 2, Lieu Tu, Lich Hoi
Thuong Communes along the coastal areas of
the Mekong Delta (Table 1, Fig. 1). Plastic
containers used for the collection of samples
were pre-washed with 0.05 M HCl and then
rinsed with distilled water. After collection,
various physicochemical parameters (pH,
temperature, salinity, total dissolved solids
(TDS), conductivity, dissolved oxygen (DO),
oxidation reduction potential (ORP) of the
samples were measured using a Horiba U-52
Multiparameter Meter (Horiba, Japan).The
rhizosphere rice soils were collected from the
paddy fields in the sampling area (Table 1) for
isolation and selection of PGPR microbes.
Table 1. Coordinates of the sampling sites in the two target provinces
Sampling sites Coordinate
Ben Tre Province
DinhTrung N: 10o13’18” E: 106o39’23”
ThanhPhuoc N: 10o6’33” E: 106o41’5”
An Hiep N: 10o1’23” E: 106o 32’27”
Soc Trang Province
Dai An 2 N: 9o34’36” E: 106o10’12”
Lieu Tu N: 9o25’36” E: 106o7’42”
Lich Hoi Thuong N: 9o34’8” E: 105o36’45”
Long Phu* N: 9o34’36” E: 106o10’12”
Note: *: This site has no water environment but the bare soil.
Investigation of salt-tolerant rhizosphere bacteria
97
Figure 1.The location of sampling sites in the
Ben Tre and Soc Trang provinces
Bacterial Isolation
Salt-tolerant PGPR microbes were
characterized by spreading soil samples in the
TSA (Tryptic Soy Agar) culture media with
variousNaCl concentrations. Briefly, 1 g of
rhizosphere soil muds or a root system from
each sample was suspended in 9 mL of sterile
physiological saline (9 g/L NaCl) and shaken
for 15 min at 200 rpm at room temperature.
Suspensions were serially diluted in ten-fold
and plated in triplicate onto TSA culture
media supplemented with various NaCl
concentrations (0.5, 1, 1.5, 2, 2.5, 5, 10 and
30%). The number of colonies of each
samples were counted and compared.
For the isolation of bacteria, 1 g of
rhizospherical soil from each sample was
suspended in 9 mL of sterile physiological
solution (9 g/L NaCl) and shaken for 15 min
at 200 rpm at room temperature. Suspensions
were serially diluted ten-fold and plated in
triplicate onto TSA culture medium. Then,
colonies were randomly selected from the
TSA medium or NaCl-TSA medium agar
plates and spread onto the original medium
for three times to avoid contamination risks.
Pure isolates were frozen in 25% glycerol at
(-)80 oC (Mapelli et al., 2013; Ferjani et al.,
2015; Soussi et al., 2016).
In vitro Screening of Bacterial Isolates for
their Plant Growth Promoting (PGP)
Activities
All isolates were first screened on
Pikovskaya’s agar plates for phosphate
solubilization as described by Jiang et al.
(2020). The production of indole-3-acetic acid
(IAA) was detected by the method described
by Patten & Glick (2002). The ability of
nitrogen fixation was estimated according to
Singh (2013) and Cappuccino and Welsh
(2019).
Molecular Identification of Isolates
The isolated bacteria were identified based
on 16S rDNA sequences. The total DNA of
the isolated bacteria were used for PCR
amplification of 16S rDNA using the 16S
rDNA universal primer set
(27F:AGAGTTTGATCMTGGCTCAG; and
1492R:CGGYTACCTTGTTACGACTT).
The PCR products were sequenced by
Macrogen (Seoul, Korea). The partial
sequence of 16S rDNA of each isolate was
blasted in NCBI for the identification of the
isolate. Then, the DNA sequences were
aligned with highly identical sequences from
NCBI database using ClustalW tool in
BioEdit software v7.0.5.3 for sequence
identity comparison (Hall, 1999). The
phylogenetic trees were constructed from
aligned sequences using Mega software
(Tamura et al., 2013). Minimum Evolution
method with the best nucleic acid substitution
model and Bootstrap method with 1000
replications were applied for phylogenetic tree
reconstruction.
RESULTS AND DISCUSSION
Environmental factors in the sampling sites
The salinity, temperature, pH, TDS,
conductivity, dissolved oxygen, reduction
potential of the water samples from each site
were summarized in table 2. The salinity, pH,
turbidity, DO and conductivity of the water
were the highest at Thanh Phuoc sampling
site, 2.2‰, 32.6 oC, 8.1, 2.7 g/L, 12.2 mg/L
and 4,700 μS/m, respectively. Meanwhile, the
water sample from Dai An 2 showed the
Ho Tu Cuong et al.
98
lowest value of salinity, turbidity, DO and
conductivity. The temperature of the sampling
sites ranged from 29 oC to 34 oC, and the pH
values ranged from 7.4 to 8.1 (Table 2). The
data confirmed that there was salt intrusion in
the several water environments of rice paddy
fields examined.
Environmental parameters of the sampling
sites showed that the rice paddy field of target
provinces are suffering from the seawater
intrusion. The rice cultivation was heavily
affected by salinity, particularly at the Thanh
Phuoc site where the maturation of rice plant
require longer time than normal growth. In
our sampling, the rice at the study site of Dai
An 2 where the soil is low salinity was
matured and could be harvested completely,
whereas in other study sites, some of the rice
remained at immature stage. Such retarded
growth of the rice was supposed to be caused
by salt stress that results in panicle sterility,
especially at pollination and fertilization
stages due to some genetic mechanisms and
nutrient deficiencies (Hussain et al., 2017).
Table 2. Physico-chemical featuresof water samplesfromthe rice fields studied
Sampling Sites
Salinity
(‰)
Temperature
(oC)
pH
TDS
(g/L)
Conductivity
(μS/m)
DO
(%)
DO
(mg/L)
ORP
(mV)
DinhTrung 0.68 34.15 7.4 0.90 1630.5 134.1 7.52 -38.15
ThanhPhuoc 2.17 32.64 8.15 2.68 4735.0 171 12.22 -31.8
An Hiep 1.29 29.12 7.89 1.64 2722.5 114.6 8.74 -27.7
Dai An 2 0.14 30.19 7.85 0.19 335.0 27.8 2.09 -56.2
Lieu Tu 0.68 30.59 7.61 0.89 1505.0 78.65 5.74 -41.55
Lich Hoi Thuong 1.07 32.66 7.4 1.38 2425.0 118.3 8.49 -13.15
Microbial abundance of the rhizosphere
bacteria in the soil mud of rice roots
The total numbers of bacterial colonies
appeared on the TSA medium containing
various NaCl concentrations were described
in Fig. 2. With the increase of NaCl
concentration, the colony count decreased for
all the samples, ranging from 104 to 106
CFU/gr. The number of colonies was the
lowest at NaCl concentration of 5% and 10%,
and colonies were not observed at 30% of
NaCl. The density of bacteria varied at
different sites. At 0.5% NaCl concentration,
the number of bacterial colonies was the
highest at Dai An 2 and An Hiep sites, and the
lowest at Dinh Trung and Lieu Tu. However,
increasing the NaCl in the TSA, the number
of colonies was reduced significantly for the
samples of all the study sites (for example,
36% reduction of Dinh Trung sample, 48%
for Lieu Tu and Dai An samples and about
40% for An Hiep sample) except for the
Thanh Phuoc sample, which gave rather
consistant number of colonies at various NaCl
concentrations up to 2.0% NaCl and then
reduced at 5% and 10% NaCl.
The abundance of salt resistant rhizophere
bacteria in the rice paddy soil from the
sampling provinces were characterized by the
conventional method based on the number of
colonies on the TSA medium containing
various concentration of NaCl. Due to the
limitation of the methods, the present results
did not cover the whole picture of microbiome
of the samples. Instead, as the first step,
morphological description of the colonies of
the isolated rhizobacteria are summarized in
the supplementary figure 1. Apparently, the
samples from the different sites has different
dominant colonies on the medium
supplemented with various concentrations of
NaCl. The abundance of the cultivable
bacteria varied from site to site and it did not
correlate with the salinity of the sampling site.
The high salinity was supposed to support the
stable community in the case of Thanh Phuoc
sample, in that the number of bacterial colony
was not changed significantly at different
concentrations of NaCl up to 2%, while the
abundance of the samples from other sites
dramatically decreased with the increase of
NaCl concentration from 0.5% to 1%. We
assume that the high salinity of the soil of
Investigation of salt-tolerant rhizosphere bacteria
99
Thanh Phuoc favored the salt-resistant
bacteria, thereby the total number of bacteria
did not change significantly when the NaCl
concentration increased from 0.5% to 2%.
1.
2.
3.
Figure 2. The abundance of the bacteria in the samples from sites cultured in TSA
supplemented with various concentrations of NaCl
IAA production, phosphate solubilization
and nitrogen fixation of the isolates
The rhizosphere bacteria isolated from the
TSA plates with NaCl concentration of 2.5%
or higher were used for this study. A total of
48 isolates were obtained from the TSA with
high NaCl concentration. Their IAA
production, phosphate solubilization and
nitrogen fixation capacity were tested and the
results were shown in table 3.
Table 3. IAA production, phosphate solubilization and nitrogen fixation
properties of the isolates
No Isolates IAA
Phosphate
solubilization
Nitrogen
fixation
No Isolates IAA
Phosphate
solubilization
Nitrogen
Fixation
1 DT.MR1_1 - - - 25 LT. MR1_7 - - -
2 DT.MR1_2 + - G+ 26 LT.MR1_16 + G+ G+
3 DT.MR1_3 - - G+ 27 ĐA2. MR_1 - G++ G+
4 DT.MR1_4 + G+ - 28 ĐA2. MR_3 - G+ G+N+
5 DT.MR1_5 + - - 29 ĐA2. MR_4 + - -
6 DT.MR1_6 ++ G++ G+ 30 ĐA2. MR_5 + - G+
7 TP. MR1_1 + - G+ 31 ĐA2. MR_6 + G+ -
8 TP. MR1_2 - - G+ 32 ĐA2. MR_7 + - -
9 TP. MR1_5 - - G+ 33 AH. MR1_1 ++ G++ -
10 TP. MR1_6 + G+ G+ 34 AH. MR1_2 - - G+
11 TP. MR1_7 - - G+ 35 AH. MR1_3 + G+ -
12 TP. MR1_8 + - - 36 AH. MR1_4 - - -
13 TP.MR1_10 + G++ G++ 37 AH. MR1_5 - - -
14 LT. MR_1 - - G+ 38 AH. MR1_6 - - -
15 LT. MR_2 - - G+ 39 LHT. MR1_1 + G+ G+
16 LT. MR_3 ++ G+ G+ 40 LHT. MR1_2 + G++ G+
17 LT. MR_4 - - - 41 LHT. MR1_3 + - -
18 LT. MR_5 - G++ G+ 42 LHT. MR1_4 - G+ -
19 LT. MR1_1 + - - 43 LHT. MR1_5 - - -
20 LT. MR1_2 - - - 44 LHT. MR1_6 - G++ G+
21 LT. MR1_3 - G+ G+ 45 LHT. MR1_7 - G+P+ G+N+
22 LT. MR1_4 - G++ G+ 46 LHT. MR1_8 + G+ G+
23 LT. MR1_5 - - G+ 47 LHT. MR1_16 + G+ G+
24 LT. MR1_6 - - - 48 DT.MR1_8 + G+ G+
Total 48 23 22 28
Notes: G++: Strong growth; G+: Weak growth; P+ or N+: Positive for P solubilization or NH3 production.
Ho Tu Cuong et al.
100
As shown in table 3, 23 out of 48 isolates
produced the plant hormone, IAA; 22 isolates
could grow on the phosphate medium
with/without clear zone of phosphate
solubilization; and 25 isolates could grow on
the medium without nitrogen supplementation
and some of them produced ammonium.
While 2 isolates, DT.MR1_6 and
LT.MR1_16, showed high IAA production
activity, 4 isolates, LHT.MR1_2,
LHT_MR1_7, LHT.MR1_8, DT.MR1_8,
showed high phosphate solubilization and
nitrogen fixation activities. Hereafter, those
biologically active isolates were relabeled as
DT6, LT16, LHT1, LHT7, LHT8, and DT8,
respectively. Three (LT16, LHT8 and DT8)
out of those 6 isolates were obtained from
TSA culture with 10% of NaCl.
In high salinity condition, the growth of
plants in general, particularly of rice, is
affected via the reduction of auxin (IAA),
phosphorus and nitrogen uptake. Previous
study showed significant reduction of IAA
level of rice after exposure to salinity stress
over for 5 days (Nilsen and Orcutt, 1996). In
addition, seed priming of salt-intolerant wheat
cultivars with different sources of auxins
(IAA, IBA and tryptophane) was diminished
by salt stress (Iqbal and Ashraf, 2013). It was
also reported that the high salinity reduced the
phosphorus uptake of plant roots by sorption
processes (Rojas-Tapias et al., 2012). The
saline stress inhibits N uptake process of rice
due to an antagonistic effect of salt ions with
NO3- and NH4+ (Teh et al., 2016). The high
salinity condition resulted in the reduction of
the rice height and nitrate content in the rice
shoot and root due to Cl- antagonism.
Therefore, identification/isolation of the salt-
resistant isolates with high activities of IAA
production, phosphorous solubilization and/or
nitrogen fixation is necessary to improve the
salinity fields for better crop of rice.
Species identification of the selected isolates
using partial sequences of 16S rDNA
The six isolates with the high activities of
IAA production, phosphorous solubilization
and nitrogen fixation under salinity condition
were selected and identified using molecular
taxonomy methods. The isolates were cultured
to produce pure biomass, and their total DNA
was extracted, and 16S rDNA was amplified
using PCR reaction with the universal primer
set. The PCR products were sent to Macrogen
(Korea) for sequencing, and the six samples
were sequenced completely and blasted in the
NCBI GeneBank. The results showed that
they belong to Bacillus (DT6, LT16, and
LHT8), Halobacillus (DT8), Aeromonas
(LHT1), and Klebsiella (LHT7) genera. All
the sequence data of DT6, DT8, LT16, LHT1,
LHT7, and LHT8 isolates were registered
tothe Genebank with the accession number of
MK335670, MK335671, MK335672,
MK335673, MK335674 and MK335675,
respectively.
As shown in the phylogenetic tree
(Supplementary figure 2), the DT6 isolate is
highly similar (98.9%) to Bacillus aerophilus
strain BC13-3 (KJ616371.1) and B. altitudinis
strain HICAS60 (JX254660.1). The partial
sequence (860 bp) of the DT6 16S rDNA gene
is clustered to B. altitudinis, although this
gene has nine nucleotides different from both
strains (B. aerophilus and B. altitudinis)
(supplementary data). The LT16 isolate was
similar (99.7%) to B. aquimaris strain GSP18
(AY505499.1) and B. aquimaris strain PPL-
S5 (KM226904.1). The LHT8 was similar
(99.8%) to B. marisflavi strain R3
(KY928104.1). The DT8 was similar (99.8%)
to Halobacillus sp. GSP34 (AY505519.1) và
Halobacillus sp. GSP15(AY505518.1). The
LHT1 isolate was highly similar to
Aeromonas caviae GSH8M-1 (99.9%,
AP019195.1:86381-87921). Lastly, the LHT7
isolate was highly similar (99.9%) to
Klebsiella pneumonia subsp. strain JNM8C2
(CP030857.1:249514-251063).
Recently, salt-tolerant microbes were of
great interest because their properties will
allow potential application in the salt
intruding agricultural areas. Nguyen et al.
(2002) screened the microbes in the rice
fields in Long An and Tien Giang provinces
to isolate the salt-tolerant microbes. His
group found that the isolates mostly
belonged to Bacillus and Azotobacter genera
Investigation of salt-tolerant rhizosphere bacteria
101
with the saline tolerance upto 10‰ NaCl
(Minh, 2018), which was far lower tolerance
level than those of our isolates reported here.
All of identified isolates were able to grow
normally in the condition of 50‰ NaCl and
expressed the plant promoting activities. It
was noticeable that the rice in Long An and
Tien Giang provinces are tolerant to lower
saline stress than the rice in Ben Tre and Soc
Trang provinces.
Among the identified isolates, LHT7 and
LHT1 belonged to the species that were
reported to be ubiquitous pathogens in the
environment, while the other 4 isolates
belonged to the moderate halophilic bacteria.
The LHT7 strain was identified as Klebsiella
pneumoniae, which is found in all types of
waters (fresh, brackish, and salt) and capable
of expressing putative virulence factors
(Podschun et al., 2001). The strain LHT1 was
identified as Aeromonas caviae that are
recognized as emerging pathogen causing
diarrhea in children and found in estuarine
environments with various salinity levels
(Shivaji et al., 2006). Since the isolates LHT1
and LHT7 were identified as Aeromonas
caviae and Klebsiella pneumoniae,
repectively, the water sources used for
farming in the study area were assumed to be
contaminated with human feces. The LT16
and LHT8 strains were identified as Bacillus
aquimaris and Bacillus marisflavi,
respectively, which were reported to have
optimal growth at 2−5% NaCl (Yoon et al.,
2003b). It is interesting that genetically the
DT6 strain is equally similar to two airborne
bacteria, i.e. Bacillus aerophilus and B.
altitudinis (Shivaji et al., 2006). The DT6
strain was isolated in the medium with 5%
NaCl. As for the salt tolerance property of two
airborne Bacillus species, B. aerophilus can
grow in high salt concentration upto 16%,
whereas the salt tolerance of B. altitudinis was
only 2%. Thus, in terms of salt tolerance, the
DT6 strain is more similar to B. aerophilus
than to B. altitudinis. The strain DT8 was
identified as a member of genus Halobacillus,
which comprises of species having different
physiological characteristics including salt
tolerance. The strain DT8 can grow in the
presence of NaCl at 10% but not at 30%. In
contrast, H. trueperi, a representative of this
genus, can grow at 30% NaCl concentration
(Spring et al., 1996; Yoon et al., 2003a). Thus,
DT8 might not be H. trueperi but a new strain
of Halobacillus.
CONCLUSION
In conclusion, moderate halophilic
bacteria were isolated from rice paddy
fields.In total, 48 isolates of salt-resistant
bacteria were obtained from the rice root
mud using TSA medium supplemented with
high concentrations of NaCl. Among these
isolates, 22 isolates were able to produce
IAA (phytohormone for the plant growth).
Several isolates were found to possess the
capability of nitrogen fixation and phosphate
solubilization. Six of them that possess high
activity of IAA, nitrogen fixation and
phosphate solubilization, were identified to
be Bacillus (DT6, LT16, and LHT8),
Halobacillus (DT8), Aeromonas (LHT1) and
Klebsiella (LHT7) genera. Four out of six
isolates were potential PGPR bacteria for
promoting rice growth in the saline
condition. For future application for
promoting the rice growth in the high saline
condition, further investigation including co-
fermentation of the isolates and their
antagonistic properties is essential.
Acknowledgement: We would like to thank
the Grant 2018 by The International
Environment Research Institute, Gwangju
Institute of Science and Technology.
REFERENCES
Cappuccino J. G., Welsh C., 2019.
Microbiology: a laboratory manual, 12th
edn. Pearson.
Ferjani R., Marasco R., Rolli E., Cherif H.,
Cherif A., Gtari M., Boudabous A.,
Daffonchio D., Ouzari H. I., 2015. The
date palm tree rhizosphere is a niche for
plant growth promoting bacteria in the
oasis ecosystem. Biomed. Res. Int., doi:
10.1155/2015/153851.
Ho Tu Cuong et al.
102
Hall T. A., 1999. BIOEDIT: a user-friendly
biological sequence alignment editor and
analysis program for Windows 95/98/ NT.
Nucleic Acids Symp Ser.
Hussain S., Zhang J. H., Zhong C., Zhu L. F.,
Cao X. C., Yu S. M., Allen B. J., Hu J. J.,
Jin Q. Y., 2017. Effects of salt stress on
rice growth, development characteristics
and the regulating ways: A review. J.
Integr. Agric., 16.
Iqbal M., Ashraf M., 2013. Salt tolerance and
regulation of gas exchange and hormonal
homeostasis by auxin-priming in wheat.
Pesqui. Agropecu. Bras., 48: 1210–1219.
https://doi.org/10.1590/S0100204X201300
0900004.
Jiang H., Wang T., Chi X., Wang M., Chen
N., Chen M., Pan L., Qi P., 2020.
Isolation and characterization of
halotolerant phosphate solubilizing
bacteria naturally colonizing the peanut
rhizosphere in salt-affected soil.
Geomicrobiol. J., 37. https://doi.org/
10.1080/01490451.2019.1666195.
Mapelli F., Marasco R., Rolli E., Barbato M.,
Cherif H., Guesmi A., Ouzari I.,
Daffonchio D., Borin S., 2013. Potential
for plant growth promotion of
rhizobacteria associated with Salicornia
growing in Tunisian hypersaline soils.
Biomed. Res. Int., https://doi.org/
10.1155/2013/248078.
Minh N. Van, 2018. Screening of salt tolerant
bacteria for plant growth promotion
activities and biological control of rice
blast and sheath blight disease on manrove
rice. Vietnam J. Sci. Technol., 55: 54.
https://doi.org/10.15625/2525-
2518/55/1a/12382.
Munns R., Tester M., 2008. Mechanisms of
Salinity Tolerance. Annu. Rev. Plant Biol.,
59. Doi: 10.1146/annurev.arplant.59.
032607.092911.
Nguyen Thi Minh H., Kawaguchi T., 2002.
Overview of rice production system in the
Mekong Delta-Vietnam. J. Fac. Agric.
Kyushu Univ.
Nilsen E. T., Orcutt D. M., 1996. Physiology
of plants under stress. Abiotic factors.
Patten C. L., Glick B. R., 2002. Regulation of
indoleacetic acid production in
Pseudomonas putida GR12-2 by
tryptophan and the stationary-phase sigma
factor RpoS. Can. J. Microbiol.,
https://doi.org/10.1139/w02-053.
Podschun R., Pietsch S., Höller C., Ullmann
U., 2001. Incidence of Klebsiella Species
in Surface Waters and Their Expression of
Virulence Factors. Appl. Environ.
Microbiol., 67: 3325–3327.
https://doi.org/10.1128/AEM.67.7.3325-
3327.2001.
Rojas-Tapias D., Moreno-Galván A., Pardo-
Díaz S., Obando M., Rivera D., Bonilla
R., 2012. Effect of inoculation with plant
growth-promoting bacteria (PGPB) on
amelioration of saline stress in maize (Zea
mays). Appl. Soil Ecol., 61: 264–272.
https://doi.org/10.1016/j.apsoil.2012.01.006.
Shivaji S., Chaturvedi P., Suresh K., Reddy G.
S. N., Dutt C. B. S., Wainwright M.,
Narlikar J. V., Bhargava P. M., 2006.
Bacillus aerius sp. nov., Bacillus
aerophilus sp. nov., Bacillus
stratosphericus sp. nov. and Bacillus
altitudinis sp. nov., isolated from
cryogenic tubes used for collecting air
samples from high altitudes. Int. J. Syst.
Evol. Microbiol.,
https://doi.org/10.1099/ijs.0.64029-0.
Singh R. K. S., 2013. Determination of
nitrogen fixing capacity of bacteria
isolated from the rhizosphere soil of
Crotolaria pallida from the Valley
Districts of Manipur, India. IOSR J.
Pharm. Biol. Sci., 8: 20–24. Doi:
10.9790/3008-0842024.
Soussi A., Ferjani R., Marasco R., Guesmi A.,
Cherif H., Rolli E., Mapelli F., Ouzari H.
I., Daffonchio D., Cherif A., 2016. Plant-
associated microbiomes in arid lands:
diversity, ecology and biotechnological
potential. Plant Soil.
Investigation of salt-tolerant rhizosphere bacteria
103
Spring S., Ludwig W., Marquez M. C.,
Ventosa A., Schleifer K. H., 1996.
Halobacillus gen. nov., with descriptions
of Halobacillus litoralis sp. nov. and
Halobacillus trueperi sp. nov., and
transfer of Sporosarcina halophila to
Halobacillus halophilus comb. nov. Int. J.
Syst. Bacteriol., 46: 492–496.
Tamura K., Stecher G., Peterson D., Filipski
A., Kumar S., 2013. MEGA6: Molecular
evolutionary genetics analysis version 6.0.
Mol. Biol. Evol., https://doi.org/:
10.1093/molbev/mst197.
Teh C. Y., Shaharuddin N. A., Ho C. L.,
Mahmood M., 2016. Exogenous proline
significantly affects the plant growth and
nitrogen assimilation enzymes activities in
rice (Oryza sativa) under salt stress. Acta
Physiol. Plant., https://doi.org/
10.1007/s11738-016-2163-1.
Yoon J. H., Hee Kang K., Park Y. H., 2003a.
Halobacillus salinus sp. nov., isolated from
a salt lake on the coast of the East Sea in
Korea. Int. J. Syst. Evol. Microbiol.,
https://doi.org/10.1099/ijs.0.02421-0.
Yoon J. H., Kim I. G., Kang K. H., Oh T. K.,
Park Y. H., 2003b. Bacillus marisflavi sp.
nov. and Bacillus aquimaris sp. nov.,
isolated from sea water of a tidal flat of
the Yellow Sea in Korea. Int. J. Syst. Evol.
Microbiol., 53: 1297–1303.
https://doi.org/10.1099/ijs.0.02365-0.
APHA, AWWA, WEF, 2012. Standard
Methods for examination of water and
wastewater. APHA, AWWA, WEF
“Standard Methods Exam water
wastewater”, 5.
https://doi.org/10.5209/rev_ANHM.2012.
v5.n2.40440.
Ho Tu Cuong et al.
104
APPENDIX
Supplementary Figure 1. Composition structure of the different color and shape colonies in the samples cultured in the different concentration of NaCl,
only colonies that possessed more than 1% were counted and calculated
NaCl%
Sites
0.5% 1.0% 1.5% 2.0% 2.5% 5.0% 10.0%
Thanh
Phuoc
Lieu Tu
Dai An
An Hiep
Investigation of salt-tolerant rhizosphere bacteria
105
Lich Hoi
Thuong
Dinh
Trung
Ho Tu Cuong et al.
106
Supplement Figure 2. Phylogenetic trees of the isolates: the numbers at the node of clades are
bootstrap percentage (%). The number at scale bar is the genetic distance. The reference
sequence labels include NCBI accession number, species name, and strain’s voucher
Investigation of salt-tolerant rhizosphere bacteria
107
Ho Tu Cuong et al.
108
Investigation of salt-tolerant rhizosphere bacteria
109
10 20 30 40 50 60 70 80
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
DT6 CAATGGAAGAAAGTTTGACGGACCAACGCCGCTTGAGTGATGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTAGGGAAGA
MF787652.1 .......C......C.......G.........................................................
KJ616371.1 .......C......C.......G.........G...............................................
JX254660.1 .......C......C.......G.........................................................
MG937634.1 .......C......C.......G.........G...............................................
90 100 110 120 130 140 150 160
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
DT6 ACAAGTGCAAGAGTAACTGCTTGCACCTTGACGGTACCTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGT
MF787652.1 ................................................................................
KJ616371.1 ................................................................................
JX254660.1 ................................................................................
MG937634.1 ................................................................................
170 180 190 200 210 220 230 240
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
DT6 AATATGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGC
MF787652.1 ....C...........................................................................
KJ616371.1 ....C...........................................................................
JX254660.1 ....C...........................................................................
MG937634.1 ....C...........................................................................
250 260 270 280 290 300 310 320
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
DT6 CCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCACGTGTAGCGG
MF787652.1 ................................................................................
KJ616371.1 ................................................................................
JX254660.1 ................................................................................
MG937634.1 ................................................................................
330 340 350 360 370 380 390 400
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
DT6 TGAAATGCGTAGAGATGTGGAGGAACACCAGTGGCGAAGGCGACTCTCTGGTCTGTAACTGACGCTGAGGAGCGAAAGCG
MF787652.1 ................................................................................
KJ616371.1 ................................................................................
JX254660.1 ................................................................................
MG937634.1 ................................................................................
410 420 430 440 450 460 470 480
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
DT6 TGGGGAGCGAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAGTGCTA-GTGTTAGGGGGTTTCCGCCCCT
MF787652.1 .........................................................A......................
KJ616371.1 .........................................................A......................
JX254660.1 .........................................................A......................
MG937634.1 .........................................................A......................
490 500 510 520 530 540 550 560
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
DT6 TAGTGCTGCAGCTAACGCATTAAGCACTCCGCCTGGGGAGTACGGTCGCAAGACTGAAACTCAAAGGAATTGACGGGGGC
MF787652.1 ................................................................................
KJ616371.1 ................................................................................
JX254660.1 ................................................................................
MG937634.1 ................................................................................
570 580 590 600 610 620 630 640
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
DT6 CCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAACCTTACCAGGTCTTGACATCCTCTGACAACCC
MF787652.1 ................................................................................
KJ616371.1 ................................................................................
JX254660.1 ................................................................................
MG937634.1 ................................................................................
650 660 670 680 690 700 710 720
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
DT6 TAGAGATAGGGCTTTCCCTTCGGGGACAGAGTGACAGGTGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAGATGTTGGGT
MF787652.1 ................................................................................
KJ616371.1 ................................................................................
JX254660.1 ................................................................................
MG937634.1 ................................................................................
730 740 750 760 770 780 790 800
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
DT6 TAAGTCCCGCAACGAGCGCAACCCTTGATCTTAGTTGCCAGCATTCAGTTGGGCACTCTAAGGTGACTGCCAGTGACAAA
MF787652.1 .......................................................................G........
KJ616371.1 .......................................................................G........
JX254660.1 .......................................................................G........
MG937634.1 .......................................................................G........
810 820 830 840 850 860
....|....|....|....|....|....|....|....|....|....|....|....|
DT6 CCGGAAGAACGTGGGGATGACGTCAAATCAACATGCCCCTTATGACCTGGGCTACACACG
MF787652.1 .....G...G....................T.............................
KJ616371.1 .........G....................T.............................
JX254660.1 .....G...G....................T.............................
MG937634.1 .....R...G....................T.............................