Isolation and identification of aerobic microbial community treating benzene from a constructed wetland system

The molecular identification of the isolates was performed by sequencing the 16S rRNA gene and comparing the sequences to the 16S rRNA database. For strain VS1, a comparison between the sequences of this strain to the 16S rRNA database using BLAST analysis revealed that strain VS1 is most closely related to Pandoraea pnomenusaCM25 at 99.9 % similarity. VS1 is also related to Pandorae apnomenusa AF13914 (99.9 %) and Pandorae apulmonicola AF139176 (99.4 %) (Figure 2).

pdf7 trang | Chia sẻ: honghp95 | Lượt xem: 392 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Isolation and identification of aerobic microbial community treating benzene from a constructed wetland system, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Journal of Science and Technology 54 (4B) (2016) 102-108 ISOLATION AND IDENTIFICATION OF AEROBIC MICROBIAL COMMUNITY TREATING BENZENE FROM A CONSTRUCTED WETLAND SYSTEM Tran Hau Vuong1, Florencio Ballesteros Jr2, Hoang Trong Khiem1, Nguyen Trung Thao1, Le Thi Phung1 1Hochiminh University of Natural Resources and Environment, 236B Le Van Sy, Ward 1, Tan Binh District, Ho Chi Minh City 2University of the Philippines Diliman, Quezon City 1101, Metro Manila, Philippine Received: 15th August 2016; Accepted for publication: 10th November 2016 ABSTRACT The main objective of this study was to isolate and identify the aerobic bacteria in bacterial community of constructed wetland in Vietnam, which were spiked with benzene. For this target, four random samples of rhizosphere soil of phragmiteskarkas from constructed wetlands in Vietnam were collected and mixed together. The soil sample was labeled VS. Bacteria in the sample was grown in 80 mg/L benzene liquid media with optimal conditions of temperature and shaken to find out whether bacteria in the sample can remove benzene or not. The result showed that bacteria in the sample can survive and treat benzene well. Strains of bacteria were isolated through incubation in Burk’s medium mixed with benzene. The strain named VS1 from VS sample was obtained. The strain adapted well in agar medium containing benzene as sole carbon source. Through molecular methods, VS1 was identified as PandoraeapnomenusaCM25. Keywords: benzene treatment, Pandoraeapnomenusa CM25, Wetland, 16S rDNA. 1. INTRODUCTION Benzene is a component of gasoline. It is often found at sites contaminated with petroleum product releases (5). Benzene has been used in industrial syntheses of plastics, paints, pesticides, resins, dyes and solvents of chemicals (18). It is a toxicant and is classified as one of the most important pollutants regulated by the Environmental Protection Agency (6). It causes various human diseases, such as cancer, hematological disorders, etc (2). The USEPA has set a maximum permissible level of benzene in drinking water at 5 µg/L. Treatment of benzene in water is desirable to protect public health. Bioremediation is an effective option for treating benzene since it is economical, as well as energy and environmentally efficient. There is a large number of studies about anaerobic benzene bioremediation (14, 10, 16, 3, 12, 1, 19). There is also a number of anaerobic strains isolated, including Geobacters pp., Desulfobacteriumsp., Azoarcusstrains (DN11 and AN9), Alicycliphilusdenitrificans K601,and Bacillus cereus (17, 19, 11, 20, 10). All isolated anaerobic bacteria were able to degrade benzene. Besides, the Hasda-A sequence which has 85.1% identity Isolation and identification of aerobic microbial community treating benzene 103 with the closest bacterium match, Syntrophusgentianae (16). This indicates that anaerobic play important role in treating benzene. On the other hand, in other study demonstrated that aerobic systems generally shows faster benzene degradation rate than anaerobic systems (4). There has been a few researches using aerobic bacteria in benzene treatment. A variety of aerobic bacteria has also been isolated for treating benzene, including Phanerochaetechrysosporium, Rhodococcussp, Pseudoxanthomonasspadix, and Pseudomonas putida (21, 13, 15). However, little attention has been given to bacteria communities of wetland systems which have been widely applied in recent years. For example, Pseudomonas putidaAY- 10 in the rhizosphere of wastewater treatment reed successfully isolated (7). However, developing information regarding the bacterial communities of wetlands in Vietnam, which have the capacity for benzene treatment, is still required. Therefore, this research is conducted to identify the bacterial strains in the rhizosphere phragmites from constructed wetland. Isolation and identification were based on indigenous phragmites of wetlands constructed in Vietnam. 2. MATERIALS AND METHODS 2.1. Samples for isolation and identification One Constructed wetland (CW) was built with local common reed Phargmiteskarkasin Vietnam. The acclimation process involved spiking of the water with 100 mg/L of benzene weekly for 16 weeks to encourage the growth of benzene-degrading bacteria. This CW performed better and gave reliable and stable results for the removal of benzene from the contaminated water (8). Samples utilized for isolation and identification in this study were collected randomly from different parts of this CW, including rhizosphere soil of Phragmiteskarkas. The soil sample from this CW was labeled VS. 2.2. Bacterial growth medium Component of BH medium includes MgSO4·7H2O, 0.2 g/L; CaCl2, 0.02 g/L; KH2PO4,1 g/L; K2HPO4, 1 g/L; NH4NO3, 1 g/L; FeCl3, 0.05 g/L and benzene was used as sole carbon source for incubating in liquid medium (7). Agar medium used was Burk’s medium, including C6H12O6, 10 g/L; KH2PO4, 0.41 g/L; K2HPO4, 0.52 g/L; Na2SO4, 0.05 g/L; CaCl2, 0.2 g/L; MgSO4·7H2O, 0.1 g/L; FeSO4·7H2O, 0.005 g/L; Na2MoO4·2H2O, 0.0025 g/L; Agar, 15 g/L for isolation. 2.3. Experimental design Benzene degradation assay of bacterial consortia in samples For incubation under aerobic condition, reed rhizosphere soil (10g ) was collected randomly from constructed wetland. Soil was transferred to 1000 mL bottles; 300 mL BH medium spiked with 80mg/L benzene concentration was then added. The bottle wassealed with rubber stopper and sticking-plaster. The culture was incubated at 31 0C for three days, with shaking at 110 rpm. After three days, benzene concentration in the bottle was measured to determine if bacterial consortia in the sample can treat benzene or not. The sample which yielded good degradation of benzene was subjected to isolation. Tran Huu Vuong, et al 104 Isolation of bacteria The isolation of benzene degrading strain was done by first serially diluting 10mL of solution collected from the precultured BH medium. Five rates of dilution, including 1/10, 1/100, 1/1000 and 1/10000, were used for incubation. 100µL of each diluted solution were spread on petri plates containing Burk’s medium mixed with benzene. The strains were isolated by serial dilution. Representative colonies were selected based upon morphology and color properties, and transferred to new plates. After isolation, the strains were incubated with new medium. The specific medium was used to enable isolated strain to acclimate with high benzene. Isolated strains were incubated on Burk’s medium mixed with higher benzene concentration (25 %) in order to improve tolerance of bacteria. After two days of incubation, colonies were transferred to new plates containing a higher benzene concentration (50 %) and lower glucose concentration (50 %). The process was repeated with benzene concentration increasing (75 % to 100 %) and glucose concentration decreasing (25 % to 0 %). When glucose concentration equaled zero, benzene was considered as sole carbon source for the growth of bacteria. Pure bacterial strains obtained were kept on LB (10.0 g NaCl, 10.0 g peptone, 5.0 g yeast extract). Identification of isolated strains The strains isolated in Vietnam were sent to Molecular Biotechnology Laboratory- Institute of Biotechnology, Vietnam Academy of Science and Technology for identification. Identification was done through the following procedure: DNA Extraction and 16S PCR Total DNA was extracted by following the procedure described in (9). PCR amplification was performed using the universal primers F: AGAGTTTGATCCTGGCTCAG and R:TGAGCCAGGATCAAACTCT. Amplifications were carried out for 30 cycles (94 °C for 30 seconds, 55 °C for 30 seconds, and 72 °C for 60 seconds). The PCR products were sequenced using ABI PRISMR 3100 Avant Genetic Analyzer. 16S Identification through BLAST and Phylogenetic Analysis 16S rRNA gene sequence was subjected to the Basic Local Alignment Search Tool (BLAST) for identity comparison. Selected top 25 hit sequences were then gathered and used for phylogenetic tree analysis using MEGA 4 Phylogenetic Analysis software. 2.4. Analysis of benzene concentration Samples of culture were withdrawn from the bottles every four hours with a syringe, and benzene concentrations were extracted by solvent (Hexane) and analyzed through the following procedures: Benzene extraction procedure Four milliliters hexane solvent was added to 50 mL solution withdrawn from the incubation with syringe. Then, this mixable solution was shaken at 120 rpm in room temperature for 20 minutes. After shaking, the mixable solution formed two layers. Syringe was used to pick up 1mLfrom the top layer of the mixable solution. This sample was transferred to 1mL vials, which were then closed tightly. To prevent the benzene from evaporating, the samples were stored at 4 0C. Isolation and identification of aerobic microbial community treating benzene 105 GC-FID analysis Analysis of benzene was performed on a 7890A- Agilent (USA), equipped with a flame ionization detector (FID, Agilent 6890N, USA). The GC was fitted with an A g i l e n t H P - 5 M S capillary column (30 m × 0.25 mm × 0.25 μm). The following temperature program was employed: The initial oven temperature of 50 °C was maintained for 1 minute; then increased at 10 0C min-1 to 85 0C, and held for 1 minute; then increased at 11 0C min-1 to 280 0C and held for 10 minutes. The injector temperature was 300 °C. The detector temperature was set at 280 ºC. Nitrogen (N2) was used as the carrier gas. 3. RESULTS AND DISCUSSION 3.1. Benzene biodegradation assay of rhizosphere soil sample In order to investigate the benzene degradation characteristic of the sample bacterial consortiums, after three days of incubation, residual benzene were extracted from the culture and analyzed with GC-FID. The result of analysis shows that benzene concentration in the VS samplewas 0 mg/L (Table 1). This suggests that the bacterial consortium in the rhizosphere soil sample was able to remove benzene effectively. Besides, an increase in turbidity in the sample indicates increase in population (Figure 1). Table 1. Benzene degradation by VS sample of rhizosphere under aerobic condition. Time (days) Benzene concentration (mg/l) 0 80 3 0 0 day of incubation 3 days of incubation Figure 1. Increase in population as indicated by an increase in turbidity. 3.2. Isolation of bacteria After finding out which bacterial consortiums has the capacity for benzene removal, a bacterial strain from the sample was isolated after incubating them in Burk’s medium mixed with benzene. The isolated strain from the sample was labeled VS1. Colonies of VR1 were circle, transparent and approximatively1.5 – 2 mm in diameter. The strain grew well in agar medium that only has benzene as sole carbon source. Tran Huu Vuong, et al 106 3.3. Identification of isolated bacteria Figure 2. Identity Match Percentage of strain VS1. The molecular identification of the isolates was performed by sequencing the 16S rRNA gene and comparing the sequences to the 16S rRNA database. For strain VS1, a comparison between the sequences of this strain to the 16S rRNA database using BLAST analysis revealed that strain VS1 is most closely related to Pandoraea pnomenusaCM25 at 99.9 % similarity. VS1 is also related to Pandorae apnomenusa AF13914 (99.9 %) and Pandorae apulmonicola AF139176 (99.4 %) (Figure 2). Figure 3.Phylogenetic tree of benzene degrading isolate (VS1) with other Pandoraea species shows close relatedness between VS1 with Pandoraea pnomenusa CM25 KF378759 compared to other species. Phylogenetic analysis using the 16s rRNA gene validates the BLAST results, which linked the VS isolate (VS1) most with Pandorae apnomenusa AF139174 compared to other Pandoraea species (Figure 3). Isolation and identification of aerobic microbial community treating benzene 107 4. CONCLUSIONS The bacterial consortium in the rhizosphere soil sample was able to remove benzene effectively. Bacteria from the sample can grow in Burk’s medium mixed with benzene well. The strain VS1 was isolated from the benzene degradation culture VS. After considering their 16S rRNA genes sequences, the strain VS1 was identified as Pandorae apnomenusa CM25. REFERENCES 1. Anderson R. T., Rooney-Varga J. N., Gaw C. V., Lovley D. R. - Anaerobic benzene oxidation in the Fe(III) reduction zone of petroleum-contaminated aquifers, Environmental Science &Technology 32 (1998) 1222–1229. 2. ATSDR (Agency for Toxic Substances and Disease Registry) - Interaction profile for benzene, toluene, ethylbenzene, and xylenes (BTEX), U.S, Department of Health and Human Services, Public Health Service, Atlanta, GA, 2004. 3. Coates J. D., Chakraborty R., Lack J. G., O’Connor S. M., Cole K. A., Bender K. S. l. - Anaerobic benzene oxidation coupled to nitrate reduction in pure culture by two strains of Dechloromonas, Nature 411 (2001) 1039–1043. 4. Corseuil H. X., Hunt C. S., Dos Santos R. C. F., Alvarez P. J. J. - The influence of the gasoline oxygenate ethanol on aerobic and anaerobic BTX biodegradation, Water Research 32 (7) (1998) 2065–2072. 5. Da Silva M. L. B., Alvarez P. J. J. - Assessment of anaerobic benzene degradation potential using 16S rRNAgenetargeted real-time PCR, Environmental Microbiology 9 (1) (2007) 72–80. 6. Dean, B. J. - Recent findings on the genetic toxicology of benzene, toluene, xylenes and phenols, Mutat.Res., 145 (1985) 153-181. 7. Eun Young Lee, Sun Hwa Hong, Min Hwan Oh and JoungSoo Lim -Characterization biodegradation of Benzene, Toluene, Ethylbenzene, and Xylenes by the Newly Isolated Bacterium Pseudomonas putidaAY-10 in Rhizosphere of Wastewater Treatment Reed, 3rd International Conference on Chemical, Biological and Environmental Engineering. IPCBEE vol.20 (2011) © (2011) IACSIT Press, Singapore, 2011. 8. Florencio Ballesteros Jr., Tran Hau Vuong, Mona Freda Secondes, Phan Dinh Tuan - Removal efficiencies of constructed wetland and efficacy of plant on treating benzene, Journal of sustainable environment research, 2016, pp. 1-4. 9. Hong D. D., L. Q. Hai, H. T. M. Hien, N. H. Thu and H. L. Anh - Morphological and molecular identification of Pseudo-nitzschia sp. strain G3 isolated from northern coast of Vietnam based on ITS region sequences. Korean J. Mar. Bioscien. Biotechnol. 2 (2007) 60-67. 10. Junfeng Dou, Aizhong Ding, Xiang Liu, Yongchao Du, Dong Deng, Jinsheng Wang - Anaerobic benzene biodegradation by a pure bacterial culture of Bacillus cereus under nitrate reducing conditions. Journal of Environmental Sciences 22 (5) (2010) 709–715. 11. Kasai Y., Takahata Y., Manefield M., Watanabe K. - RNA based stable isotope probing and isolation of anaerobic benzene-degrading bacteria from gasoline-contaminated groundwater. Applied and Environmental Microbiology 72 (5) (2006) 3586–3592. Tran Huu Vuong, et al 108 12. Kunapuli U., Griebler C., Beller H. R., Meckenstock R. U. - Identification of intermediates formed during anaerobic benzene degradation by an iron-reducing enrichment culture, Environmental Microbiology 10 (7) (2008) 1703–1712. 13. Lee, E. H. and Cho K. S. - Effect of substrate interaction on the degradation of methyl tert-butyl ether, benzene, toluene, ethylbenzene, and xylene by Rhodococcussp, J. Hazard. Mater. 167 (2009) 669-674. 14. Lovley D. R. - Potential for anaerobic bioremediation of BTEX in petroleum- contaminated aquifers, Journal of Industrial Microbiology and Biotechnology 18 (2-3) (1997) 75–81. 15. Mazzeo, D. E. C., Levy C. E., Angelis D. F., and Marin-Morales M. A. -BTEX biodegradation by bacteria from effluents of petroleum refinery, Sci. Total Environ. 408 (2010) 4334-4340. 16. Nahoko Sakai, FutoshiKurisu, Osami Yagi, Fumiyuki Nakajima, Kazuo Yamamoto - Identification of putative benzene-degrading bacteria in methanogenic enrichment cultures. Journal of Bioscience and Bioengineering 108 (6) (2009) 501–507. 17. Rooney-Varga J. N., Anderson R. T., Fraga J. L., Ringelberg D., Lovley D. R. - Microbial communities associated with anaerobic benzene degradation in a petroleum contaminated aquifer, Applied and Environment Microbiology 65 (7) (1999) 3056–3063. 18. Smith M. R. - The biodegradation of aromatic hydrocarbons by bacteria, Biodegradation 1 (1990) 191-206. 19. Ulrich A. C., Edwards E. A. - Physiological and molecular characterization of anaerobic benzenedegrading mixed cultures. Environmental Microbiology 5 (2) (2003) 92–102. 20. Weelink S. A. B., Tan N. C. G., Ten Broeke H., Van Doesburg W., Langenho_ A. A. M., Gerritse J. etal. - Physiological and phylogenetic characterization of a stable benzenedegrading,chlorate – reducingmicrobial community, FEMS Microbiology Ecology 60 (2) (2007) 312–321. 21. Yadav J. S., Reddy C. A. - Degradation of benzene, toluene, ethylbenzene, and xylenes (BTEX) by the lignin-degrading basidiomycetePhanerochaetechrysosporium, Appl Environ Microbiol. 59 (1993) 756–62.

Các file đính kèm theo tài liệu này:

  • pdf12030_103810382542_1_sm_3774_2061633.pdf