Môn Sinh học - Chapter 17: From gene to protein
In prokaryotes, translation of mRNA can begin before transcription has finished
In a eukaryotic cell, the nuclear envelope separates transcription from translation
Eukaryotic RNA transcripts are modified through RNA processing to yield the finished mRNA
97 trang |
Chia sẻ: huyhoang44 | Lượt xem: 956 | Lượt tải: 0Free
Bạn đang xem trước 20 trang tài liệu Môn Sinh học - Chapter 17: From gene to protein, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
From Gene to ProteinChapter 17Overview: The Flow of Genetic InformationThe information content of DNA is in the form of specific sequences of nucleotidesThe DNA inherited by an organism leads to specific traits by dictating the synthesis of proteinsProteins are the links between genotype and phenotypeGene expression, the process by which DNA directs protein synthesis, includes two stages: transcription and translation© 2011 Pearson Education, Inc.Concept 17.1: Genes specify proteins via transcription and translationHow was the fundamental relationship between genes and proteins discovered?© 2011 Pearson Education, Inc.Evidence from the Study of Metabolic DefectsIn 1902, British physician Archibald Garrod first suggested that genes dictate phenotypes through enzymes that catalyze specific chemical reactionsHe thought symptoms of an inherited disease reflect an inability to synthesize a certain enzymeLinking genes to enzymes required understanding that cells synthesize and degrade molecules in a series of steps, a metabolic pathway© 2011 Pearson Education, Inc.Nutritional Mutants in Neurospora: Scientific InquiryGeorge Beadle and Edward Tatum exposed bread mold to X-rays, creating mutants that were unable to survive on minimal mediaUsing crosses, they and their coworkers identified three classes of arginine-deficient mutants, each lacking a different enzyme necessary for synthesizing arginineThey developed a one gene–one enzyme hypothesis, which states that each gene dictates production of a specific enzyme© 2011 Pearson Education, Inc.The Products of Gene Expression: A Developing StorySome proteins aren’t enzymes, so researchers later revised the hypothesis: one gene–one proteinMany proteins are composed of several polypeptides, each of which has its own geneTherefore, Beadle and Tatum’s hypothesis is now restated as the one gene–one polypeptide hypothesisNote that it is common to refer to gene products as proteins rather than polypeptides© 2011 Pearson Education, Inc.Basic Principles of Transcription and TranslationRNA is the bridge between genes and the proteins for which they codeTranscription is the synthesis of RNA using information in DNATranscription produces messenger RNA (mRNA)Translation is the synthesis of a polypeptide, using information in the mRNARibosomes are the sites of translation© 2011 Pearson Education, Inc.In prokaryotes, translation of mRNA can begin before transcription has finishedIn a eukaryotic cell, the nuclear envelope separates transcription from translation Eukaryotic RNA transcripts are modified through RNA processing to yield the finished mRNA© 2011 Pearson Education, Inc.A primary transcript is the initial RNA transcript from any gene prior to processingThe central dogma is the concept that cells are governed by a cellular chain of command: DNA RNA protein© 2011 Pearson Education, Inc.Figure 17.3DNAmRNARibosomePolypeptideTRANSCRIPTIONTRANSLATIONTRANSCRIPTIONTRANSLATIONPolypeptideRibosomeDNAmRNAPre-mRNARNA PROCESSING(a) Bacterial cell(b) Eukaryotic cellNuclearenvelopeThe Genetic CodeHow are the instructions for assembling amino acids into proteins encoded into DNA? There are 20 amino acids, but there are only four nucleotide bases in DNAHow many nucleotides correspond to an amino acid?© 2011 Pearson Education, Inc.Codons: Triplets of NucleotidesThe flow of information from gene to protein is based on a triplet code: a series of nonoverlapping, three-nucleotide wordsThe words of a gene are transcribed into complementary nonoverlapping three-nucleotide words of mRNAThese words are then translated into a chain of amino acids, forming a polypeptide© 2011 Pearson Education, Inc.Figure 17.4DNAtemplatestrandTRANSCRIPTIONmRNATRANSLATIONProteinAmino acidCodonTrpPheGly55SerUUUUU3353GGGGCCTCAAAAAAATTTTTGGGGCCCGGDNAmoleculeGene 1Gene 2Gene 3CCDuring transcription, one of the two DNA strands, called the template strand, provides a template for ordering the sequence of complementary nucleotides in an RNA transcriptThe template strand is always the same strand for a given geneDuring translation, the mRNA base triplets, called codons, are read in the 5 to 3 direction© 2011 Pearson Education, Inc.Codons along an mRNA molecule are read by translation machinery in the 5 to 3 direction Each codon specifies the amino acid (one of 20) to be placed at the corresponding position along a polypeptide© 2011 Pearson Education, Inc.Cracking the CodeAll 64 codons were deciphered by the mid-1960sOf the 64 triplets, 61 code for amino acids; 3 triplets are “stop” signals to end translationThe genetic code is redundant (more than one codon may specify a particular amino acid) but not ambiguous; no codon specifies more than one amino acidCodons must be read in the correct reading frame (correct groupings) in order for the specified polypeptide to be produced© 2011 Pearson Education, Inc.Figure 17.5Second mRNA baseFirst mRNA base (5 end of codon)Third mRNA base (3 end of codon)UUUUUCUUACUUCUCCUACUGPheLeuLeuIleUCUUCCUCAUCGSerCCUCCCCCACCGUAUUACTyrProThrUAA StopUAG StopUGA StopUGUUGCCysUGGTrpGCUUCAUUCCCAUAAAGGHisGlnAsnLysAspCAUCGUCACCAACAGCGCCGACGGGAUUAUCAUAACUACCACAAAUAACAAAAGUAGCAGAArgSerArgGlyACGAUGAAGAGGGUUGUCGUAGUGGCUGCCGCAGCGGAUGACGAAGAGValAlaGGUGGCGGAGGGGluGlyGUCAMet orstartUUGGEvolution of the Genetic CodeThe genetic code is nearly universal, shared by the simplest bacteria to the most complex animalsGenes can be transcribed and translated after being transplanted from one species to another© 2011 Pearson Education, Inc.Figure 17.6(a) Tobacco plant expressing a firefly genegene(b) Pig expressing a jellyfishConcept 17.2: Transcription is the DNA-directed synthesis of RNA: a closer lookTranscription is the first stage of gene expression© 2011 Pearson Education, Inc.Molecular Components of TranscriptionRNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotidesThe RNA is complementary to the DNA template strandRNA synthesis follows the same base-pairing rules as DNA, except that uracil substitutes for thymine© 2011 Pearson Education, Inc.The DNA sequence where RNA polymerase attaches is called the promoter; in bacteria, the sequence signaling the end of transcription is called the terminatorThe stretch of DNA that is transcribed is called a transcription unit© 2011 Pearson Education, Inc.Figure 17.7-4PromoterRNA polymeraseStart pointDNA53Transcription unit35Elongation5335Nontemplate strand of DNATemplate strand of DNARNAtranscriptUnwoundDNA235353RewoundDNARNAtranscript5Termination3355Completed RNA transcriptDirection of transcription (“downstream”)533Initiation1Synthesis of an RNA TranscriptThe three stages of transcriptionInitiationElongationTermination© 2011 Pearson Education, Inc.RNA Polymerase Binding and Initiation of TranscriptionPromoters signal the transcriptional start point and usually extend several dozen nucleotide pairs upstream of the start pointTranscription factors mediate the binding of RNA polymerase and the initiation of transcriptionThe completed assembly of transcription factors and RNA polymerase II bound to a promoter is called a transcription initiation complexA promoter called a TATA box is crucial in forming the initiation complex in eukaryotes© 2011 Pearson Education, Inc.Figure 17.8Transcription initiationcomplex forms3DNAPromoterNontemplate strand535353TranscriptionfactorsRNA polymerase IITranscription factors535353RNA transcriptTranscription initiation complex53TATA boxTTTTTTAAAAAAATSeveral transcriptionfactors bind to DNA2A eukaryotic promoter1Start pointTemplate strandElongation of the RNA StrandAs RNA polymerase moves along the DNA, it untwists the double helix, 10 to 20 bases at a timeTranscription progresses at a rate of 40 nucleotides per second in eukaryotesA gene can be transcribed simultaneously by several RNA polymerasesNucleotides are added to the 3 end of the growing RNA molecule© 2011 Pearson Education, Inc.Nontemplatestrand of DNARNA nucleotidesRNApolymeraseTemplatestrand of DNA335553Newly madeRNADirection of transcriptionAAAAAAATTTTTTTGGGCCCCCGCCCAAAUUUendFigure 17.9Termination of TranscriptionThe mechanisms of termination are different in bacteria and eukaryotesIn bacteria, the polymerase stops transcription at the end of the terminator and the mRNA can be translated without further modificationIn eukaryotes, RNA polymerase II transcribes the polyadenylation signal sequence; the RNA transcript is released 10–35 nucleotides past this polyadenylation sequence© 2011 Pearson Education, Inc.Concept 17.3: Eukaryotic cells modify RNA after transcriptionEnzymes in the eukaryotic nucleus modify pre-mRNA (RNA processing) before the genetic messages are dispatched to the cytoplasmDuring RNA processing, both ends of the primary transcript are usually alteredAlso, usually some interior parts of the molecule are cut out, and the other parts spliced together© 2011 Pearson Education, Inc.Alteration of mRNA EndsEach end of a pre-mRNA molecule is modified in a particular wayThe 5 end receives a modified nucleotide 5 capThe 3 end gets a poly-A tailThese modifications share several functionsThey seem to facilitate the export of mRNA to the cytoplasmThey protect mRNA from hydrolytic enzymesThey help ribosomes attach to the 5 end© 2011 Pearson Education, Inc.Figure 17.10Protein-codingsegmentPolyadenylationsignal53355CapUTRStartcodonGPPPStopcodonUTRAAUAAAPoly-A tailAAAAAASplit Genes and RNA SplicingMost eukaryotic genes and their RNA transcripts have long noncoding stretches of nucleotides that lie between coding regionsThese noncoding regions are called intervening sequences, or intronsThe other regions are called exons because they are eventually expressed, usually translated into amino acid sequencesRNA splicing removes introns and joins exons, creating an mRNA molecule with a continuous coding sequence© 2011 Pearson Education, Inc.Figure 17.115Exon IntronExon5CapPre-mRNACodonnumbers13031104mRNA5Cap5IntronExon3UTRIntrons cut out andexons spliced together3105 146Poly-A tailCodingsegmentPoly-A tailUTR1146In some cases, RNA splicing is carried out by spliceosomesSpliceosomes consist of a variety of proteins and several small nuclear ribonucleoproteins (snRNPs) that recognize the splice sites© 2011 Pearson Education, Inc.Figure 17.12-3RNA transcript (pre-mRNA)5Exon 1ProteinsnRNAsnRNPsIntronExon 2Other proteinsSpliceosome5SpliceosomecomponentsCut-outintronmRNA5Exon 1Exon 2RibozymesRibozymes are catalytic RNA molecules that function as enzymes and can splice RNAThe discovery of ribozymes rendered obsolete the belief that all biological catalysts were proteins© 2011 Pearson Education, Inc.The Functional and Evolutionary Importance of IntronsSome introns contain sequences that may regulate gene expressionSome genes can encode more than one kind of polypeptide, depending on which segments are treated as exons during splicingThis is called alternative RNA splicingConsequently, the number of different proteins an organism can produce is much greater than its number of genes© 2011 Pearson Education, Inc.Proteins often have a modular architecture consisting of discrete regions called domainsIn many cases, different exons code for the different domains in a proteinExon shuffling may result in the evolution of new proteins© 2011 Pearson Education, Inc.GeneDNAExon 1Exon 2Exon 3IntronIntronTranscriptionRNA processingTranslationDomain 3Domain 2Domain 1PolypeptideFigure 17.13Concept 17.4: Translation is the RNA-directed synthesis of a polypeptide: a closer lookGenetic information flows from mRNA to protein through the process of translation© 2011 Pearson Education, Inc.Molecular Components of TranslationA cell translates an mRNA message into protein with the help of transfer RNA (tRNA)tRNAs transfer amino acids to the growing polypeptide in a ribosomeTranslation is a complex process in terms of its biochemistry and mechanics© 2011 Pearson Education, Inc.Figure 17.14PolypeptideRibosomeTrpPheGlytRNA withamino acidattachedAminoacidstRNAAnticodonCodonsUUUUGGGGCACCCCGAAACGCG53mRNAThe Structure and Function of Transfer RNAMolecules of tRNA are not identicalEach carries a specific amino acid on one endEach has an anticodon on the other end; the anticodon base-pairs with a complementary codon on mRNA© 2011 Pearson Education, Inc.A tRNA molecule consists of a single RNA strand that is only about 80 nucleotides longFlattened into one plane to reveal its base pairing, a tRNA molecule looks like a cloverleaf© 2011 Pearson Education, Inc.Figure 17.15Amino acidattachmentsite35HydrogenbondsAnticodon(a) Two-dimensional structure(b) Three-dimensional structure(c) Symbol used in this bookAnticodonAnticodon35HydrogenbondsAmino acidattachmentsite53AAGBecause of hydrogen bonds, tRNA actually twists and folds into a three-dimensional moleculetRNA is roughly L-shaped© 2011 Pearson Education, Inc.Accurate translation requires two stepsFirst: a correct match between a tRNA and an amino acid, done by the enzyme aminoacyl-tRNA synthetaseSecond: a correct match between the tRNA anticodon and an mRNA codonFlexible pairing at the third base of a codon is called wobble and allows some tRNAs to bind to more than one codon© 2011 Pearson Education, Inc.Aminoacyl-tRNAsynthetase (enzyme)Amino acidPPPAdenosineATPPPPPPiiiAdenosinetRNAAdenosinePtRNAAMPComputer modelAminoacidAminoacyl-tRNAsynthetaseAminoacyl tRNA(“charged tRNA”)Figure 17.16-4RibosomesRibosomes facilitate specific coupling of tRNA anticodons with mRNA codons in protein synthesisThe two ribosomal subunits (large and small) are made of proteins and ribosomal RNA (rRNA)Bacterial and eukaryotic ribosomes are somewhat similar but have significant differences: some antibiotic drugs specifically target bacterial ribosomes without harming eukaryotic ribosomes © 2011 Pearson Education, Inc.Figure 17.17atRNAmoleculesGrowingpolypeptideExit tunnelEPALargesubunitSmallsubunitmRNA53(a) Computer model of functioning ribosomeFigure 17.17bExit tunnelA site (Aminoacyl-tRNA binding site)SmallsubunitLargesubunitPAP site (Peptidyl-tRNAbinding site)mRNAbinding site(b) Schematic model showing binding sitesE site (Exit site)EFigure 17.17cAmino endmRNAE(c) Schematic model with mRNA and tRNA5Codons3tRNAGrowing polypeptideNext aminoacid to beadded topolypeptidechainA ribosome has three binding sites for tRNAThe P site holds the tRNA that carries the growing polypeptide chainThe A site holds the tRNA that carries the next amino acid to be added to the chainThe E site is the exit site, where discharged tRNAs leave the ribosome© 2011 Pearson Education, Inc.Building a PolypeptideThe three stages of translationInitiationElongationTerminationAll three stages require protein “factors” that aid in the translation process© 2011 Pearson Education, Inc.Ribosome Association and Initiation of TranslationThe initiation stage of translation brings together mRNA, a tRNA with the first amino acid, and the two ribosomal subunitsFirst, a small ribosomal subunit binds with mRNA and a special initiator tRNAThen the small subunit moves along the mRNA until it reaches the start codon (AUG)Proteins called initiation factors bring in the large subunit that completes the translation initiation complex© 2011 Pearson Education, Inc.Figure 17.18InitiatortRNAmRNA553Start codonSmallribosomalsubunitmRNA binding site3Translation initiation complex533UUAAGCPP siteiGTPGDPMetMetLargeribosomalsubunitEA5Elongation of the Polypeptide ChainDuring the elongation stage, amino acids are added one by one to the preceding amino acid at the C-terminus of the growing chainEach addition involves proteins called elongation factors and occurs in three steps: codon recognition, peptide bond formation, and translocationTranslation proceeds along the mRNA in a 5′ to 3′ direction© 2011 Pearson Education, Inc.Amino end ofpolypeptidemRNA5EAsite3EGTPGDPPiPAEPAGTPGDPPiPAERibosome ready fornext aminoacyl tRNAPsiteFigure 17.19-4Termination of TranslationTermination occurs when a stop codon in the mRNA reaches the A site of the ribosomeThe A site accepts a protein called a release factorThe release factor causes the addition of a water molecule instead of an amino acidThis reaction releases the polypeptide, and the translation assembly then comes apart© 2011 Pearson Education, Inc.Figure 17.20-3ReleasefactorStop codon(UAG, UAA, or UGA)3535Freepolypeptide2GTP532GDP2iPPolyribosomesA number of ribosomes can translate a single mRNA simultaneously, forming a polyribosome (or polysome)Polyribosomes enable a cell to make many copies of a polypeptide very quickly© 2011 Pearson Education, Inc.Figure 17.21CompletedpolypeptideIncomingribosomalsubunitsStart ofmRNA(5 end)End ofmRNA(3 end)(a)PolyribosomeRibosomesmRNA(b)0.1 mGrowingpolypeptidesCompleting and Targeting the Functional ProteinOften translation is not sufficient to make a functional proteinPolypeptide chains are modified after translation or targeted to specific sites in the cell© 2011 Pearson Education, Inc.Protein Folding and Post-Translational ModificationsDuring and after synthesis, a polypeptide chain spontaneously coils and folds into its three-dimensional shapeProteins may also require post-translational modifications before doing their jobSome polypeptides are activated by enzymes that cleave themOther polypeptides come together to form the subunits of a protein© 2011 Pearson Education, Inc.Targeting Polypeptides to Specific LocationsTwo populations of ribosomes are evident in cells: free ribsomes (in the cytosol) and bound ribosomes (attached to the ER)Free ribosomes mostly synthesize proteins that function in the cytosol Bound ribosomes make proteins of the endomembrane system and proteins that are secreted from the cellRibosomes are identical and can switch from free to bound© 2011 Pearson Education, Inc.Polypeptide synthesis always begins in the cytosolSynthesis finishes in the cytosol unless the polypeptide signals the ribosome to attach to the ERPolypeptides destined for the ER or for secretion are marked by a signal peptide © 2011 Pearson Education, Inc.A signal-recognition particle (SRP) binds to the signal peptideThe SRP brings the signal peptide and its ribosome to the ER© 2011 Pearson Education, Inc.Figure 17.22RibosomemRNASignalpeptideSRP1SRPreceptorproteinTranslocationcomplexERLUMEN23456SignalpeptideremovedCYTOSOLProteinERmembraneConcept 17.5: Mutations of one or a few nucleotides can affect protein structure and functionMutations are changes in the genetic material of a cell or virusPoint mutations are chemical changes in just one base pair of a geneThe change of a single nucleotide in a DNA template strand can lead to the production of an abnormal protein© 2011 Pearson Education, Inc.Figure 17.23Wild-type hemoglobinWild-type hemoglobin DNA333553355553mRNAAAGCTTAAGmRNANormal hemoglobinGluSickle-cell hemoglobinValAAAUGGTTSickle-cell hemoglobinMutant hemoglobin DNACTypes of Small-Scale MutationsPoint mutations within a gene can be divided into two general categoriesNucleotide-pair substitutionsOne or more nucleotide-pair insertions or deletions© 2011 Pearson Education, Inc.SubstitutionsA nucleotide-pair substitution replaces one nucleotide and its partner with another pair of nucleotidesSilent mutations have no effect on the amino acid produced by a codon because of redundancy in the genetic codeMissense mutations still code for an amino acid, but not the correct amino acidNonsense mutations change an amino acid codon into a stop codon, nearly always leading to a nonfunctional protein© 2011 Pearson Education, Inc.Figure 17.24aWild typeDNA template strandmRNA55ProteinAmino endStopCarboxyl end3335MetLysPheGlyA instead of G(a) Nucleotide-pair substitution: silentStopMetLysPheGlyU instead of CAAAAAAAAAATTTTTTTTTTCCCCCCGGGGGGAAAAAGGGUUUUU5335AAAAAAAAATTTTTTTTTTCCCCGGGGAAAGAAAAGGGUUUUUTU35Figure 17.24bWild typeDNA template strandmRNA55ProteinAmino endStopCarboxyl end3335MetLysPheGlyT instead of C(a) Nucleotide-pair substitution: missenseStopMetLysPheSerA instead of GAAAAAAAAAATTTTTTTTTTCCCCCCGGGGGGAAAAAGGGUUUUU5335AAAAAAAAATTTTTTTTTTCCTCGGGAAGAAAAAGGUUUUU35ACCGFigure 17.24cWild typeDNA template strandmRNA55ProteinAmino endStopCarboxyl end3335MetLysPheGlyA instead of T(a) Nucleotide-pair substitution: nonsenseMetAAAAAAAAAATTTTTTTTTTCCCCCCGGGGGGAAAAAGGGUUUUU5335AAAAAAAATTATTTTTTTCCCGGGAAGUAAAGGUUUUU35CCGT instead of CCGTU instead of AGStopInsertions and DeletionsInsertions and deletions are additions or losses of nucleotide pairs in a geneThese mutations have a disastrous effect on the resulting protein more often than substitutions do Insertion or deletion of nucleotides may alter the reading frame, producing a frameshift mutation© 2011 Pearson Education, Inc.Figure 17.24dWild typeDNA template strandmRNA55ProteinAmino endStopCarboxyl end3335MetLysPheGlyAAAAAAAAAATTTTTTTTTTCCCCCCGGGGGGAAAAAGGGUUUUU(b) Nucleotide-pair insertion or deletion: frameshift causingimmediate nonsenseExtra AExtra U535335Met1 nucleotide-pair insertionStopACAAGTTATCTACGTATATGTCTGGATGAAGUAUAUGAUGUUCATAAGFigure 17.24eDNA template strandmRNA55ProteinAmino endStopCarboxyl end3335MetLysPheGlyAAAAAAAAAATTTTTTTTTTCCCCCCGGGGGGAAAAAGGGUUUUU(b) Nucleotide-pair insertion or deletion: frameshift causingextensive missense Wild typemissingmissingAUAAATTTCCATTCCGAATTTGGAAATCGGAGAAGUUUCAAGGU35335MetLysLeuAla1 nucleotide-pair deletion5Figure 17.24fDNA template strandmRNA55ProteinAmino endStopCarboxyl end3335MetLysPheGlyAAAAAAAAAATTTTTTTTTTCCCCCCGGGGGGAAAAAGGGUUUUU(b) Nucleotide-pair insertion or deletion: no frameshift, but oneamino acid missingWild typeATCAAAATTCCGTTCmissingmissingStop533535MetPheGly3 nucleotide-pair deletionAGUCAAGGUUUUTGAAATTTTCGGAAGMutagensSpontaneous mutations can occur during DNA replication, recombination, or repairMutagens are physical or chemical agents that can cause mutations© 2011 Pearson Education, Inc.Concept 17.6: While gene expression differs among the domains of life, the concept of a gene is universalArchaea are prokaryotes, but share many features of gene expression with eukaryotes© 2011 Pearson Education, Inc.Comparing Gene Expression in Bacteria, Archaea, and EukaryaBacteria and eukarya differ in their RNA polymerases, termination of transcription, and ribosomes; archaea tend to resemble eukarya in these respectsBacteria can simultaneously transcribe and translate the same geneIn eukarya, transcription and translation are separated by the nuclear envelopeIn archaea, transcription and translation are likely coupled© 2011 Pearson Education, Inc.Figure 17.25RNA polymeraseDNAmRNAPolyribosomeRNA polymeraseDNAPolyribosomePolypeptide(amino end)mRNA(5 end)Ribosome0.25 mDirection oftranscriptionFigure 17.25aRNA polymeraseDNAmRNAPolyribosome0.25 mWhat Is a Gene? Revisiting the QuestionThe idea of the gene has evolved through the history of geneticsWe have considered a gene asA discrete unit of inheritance A region of specific nucleotide sequence in a chromosomeA DNA sequence that codes for a specific polypeptide chain© 2011 Pearson Education, Inc.Figure 17.26TRANSCRIPTIONDNARNApolymeraseExonRNAtranscriptRNAPROCESSINGNUCLEUSIntronRNA transcript(pre-mRNA)Poly-APoly-AAminoacyl-tRNA synthetaseAMINO ACIDACTIVATIONAminoacidtRNA5 CapPoly-A3GrowingpolypeptidemRNAAminoacyl(charged)tRNAAnticodonRibosomalsubunitsAAETRANSLATION5 CapCYTOPLASMPECodonRibosome53In summary, a gene can be defined as a region of DNA that can be expressed to produce a final functional product, either a polypeptide or an RNA molecule© 2011 Pearson Education, Inc.© 2011 Pearson Education, Inc.Figure 17.UN02Transcription unitRNA polymerasePromoterRNA transcript553335Template strandof DNAFigure 17.UN03Pre-mRNAmRNAPoly-A tail5 CapFigure 17.UN04tRNAPolypeptideAminoacidEAAnti-codonRibosomemRNACodonFigure 17.UN05Type of RNAFunctionsMessenger RNA (mRNA)Transfer RNA (tRNA)Primary transcriptSmall nuclear RNA (snRNA)Plays catalytic (ribozyme) roles andstructural roles in ribosomesFigure 17.UN06aFigure 17.UN06bFigure 17.UN06cFigure 17.UN06dFigure 17.UN10
Các file đính kèm theo tài liệu này:
biol_1406_ch_17_2176.ppt