Journal of Biotechnology 16(4): 745-756, 2018
745
ANALYZING 16S rRNA SEQUENCES FROM VIETNAMESE PATHOGENIC
LEPTOSPIRA STRAINS AND IN-SILICO PREDICTION OF POTENTIAL ANTIGENIC
EPITOPES ON LIPL21, LIPL32 OUTER MEMBRANE LIPOPROTEINS
Vo Thi Bich Thuy1,2, *, Nguyen Tuan Hung2,3, Nghiem Ngoc Minh1,2
1Institute of Genome Research, Vietnam Academy of Science and Technology
2Graduate University of Science and Technology, Vietnam Academy of Science and Technology
3VETVACO National Veterinary Joint Stock Company, Duc Thuong, Hoai Duc, Hanoi
* To whom correspondence should be addressed. E-mail:
[email protected]
Received: 16.11.2018
Accepted: 20.12.2018
SUMMARY
Leptospirosis, a zoonosis caused by Leptospira, is recognized as an emergent infectious disease. In
currently, the lack of adequate diagnostic tools, vaccines are an attractive intervention strategy. In this
experiment, a 550 bp fragment of large ribosomal RNA gene (16S rRNA) was sequenced and constructed
phylogenetic tree from a panel of six Vietnamese pathogenic strains of Leptospira spirochetes (e.g., Pomona,
Canicola, Mitis, Ictero haemohagiae, Bataviae, and Grippotyphosa). The results showed a close relationship of
L.Pomona_VN and L.Hardjo (bootstrap: 99%). L.Canicola_VN and L.Ictero haemohagiae_VN appeared to be
weak related to the classic L.Canicola, L. Grippotyphosa, these assemblage have a bootstrap support of 62%.
The other strains (L.Mitis_VN and L.Grippotyphosa_VN) were appeared monophyletic, while their sister
group (L.Bataviae_VN) relationship found only weak support (bootstrap: 62%). We also selected six genes
[e.g. the immunoglobulin like proteins A and B (LigA and LigB genes), outer membrane protein (OmpL1 gene),
and lipopolysaccharide (LipL32, LipL41, and LipL21 genes)] and checked gene expression in these Leptospira
strains by polymerase chain reaction (PCR) method. There were three genes (e.g., LipL32, LipL21, and LigA
genes) expressed in all strains, OmpL1 gene occured in 4 strains (L.Bataviae_VN, L.Canicola_VN,
L.Grippotyphosa_VN and L.Mitis_VN), whereas LipL41 and LigB genes did not appear in any Leptospira
strains. A multi-antigenic epitope potential of two gene (Lip L21 and Lip L32) was predicted by bioinformatic
tools for designing a recombinant vaccine against leptospirosis. There were 3 multi-epitope regions (1 region
and 95 antigenic epitope for B and T cells of LipL21 peptide; 2 regions and 124 antigenic epitope for both B
and T cells of LipL32 peptide). It should be more of the deeply molecular biology studies to confirm the level
agglutinating, antigen cleavage, peptide specificity matrices as well as neutralizing antibodies in the immune
responses of DNA vaccine of these genes.
Keywords: Antigenic genes, Leptospiraceac, Leptospirosis recombinant vaccine, 16S rRNA gene sequencing
INTRODUCTION
Leptospirosis constitutes an important public
health problem in developing countries particularly
those that are impoverished. The disease is
responsible for economic losses in animal production
as well as exerts a burden on human health. The
World Organisation for Animal Health (OIE)
manages leptospirosis in 2nd group of the most
dangerous diseases (OIE, 2008) and currently it adds
to the group of occupational diseases in Vietnam
(TLĐLĐVN, 1991). Leptospirosis commons
everywhere in the world, mostly in Africa, South
America, and Asia regions, causing considerable
damage to livestock and human health in many
countries, especially the tropics (Vanasco et al.,
2008). According to the World Health Organization
(WHO) estimates that there are annually from 7 to
10 million people in the worldwide infected with the
Leptospira interrogans (NHS, 2014). In developing
countries, the disease is mainly farmers and poor
people in the city, especially, people often working
outdoors in warm and humid places have the risk of
infection. The disease transmits to humans through
mucous, skin, and eyes, which exposure to infected
animal urine (Slack, 2010). Currently, pathogenic
Vo Thi Bich Thuy et al.
746
leptospires are classified into nine pathogenic and
four intermediate species, containing more than 260
serovars, and six saprophytic species, including over
60 serovars (Adler, de la Pena Moctezuma, 2010;
Levett, 2001). The worldwide leptospirosis disease
burden estimates are hampered by the lack of
scientifically data from countries with probable high
endemicity and limited diagnostic capacities. In Sri
Lanka (2008) 404 possible cases were defined, in
which 155 were confirmed to have leptospirosis with
serovars Pyrogenes, Hardjo, Javanica, and
Hebdomadis (Agampodi et al., 2011). Leptospirosis
has been prevalent sporadically in China in recent
years, and Leptospira interrogans
Icterohaemorrhagiae serovar Lai is the most
common pathogen in Chinese leptospirosis patients
and Apodemus agrarius is its major animal host (Hu
et al., 2014). Nowaday, there are several highlight
reviews in the leptospirosis, e.g. susceptible
population, disease transmission and epidemiology,
treatment, trends and advances in diagnosis, vaccines
and vaccination strategies in humans and animals.
Many molecular tools like PCR-RFLP, real-time
PCR, multiplex PCR, qPCR and immunocapture
PCR have been found useful for rapid and
confirmatory detection and differentiation of
pathogenic and non-pathogenic leptospires to against
all emerging pathogens with success stories.
Available vaccines can only provide limited
protection, which is short lived. The most commonly
used leptospiral vaccines are based on inactivated
whole-cell bacterins or leptospiral cell membrane
components. These preparations although effective,
are associated with several side-effects like pain,
irritation and discomfort in addition to limited
protection. In addition, the vast majority of the
vaccines are for animal use, albeit for few countries
that have licensed bacterins for human use (Silveira
et al., 2017). As a result, the last few decades have
seen research efforts shifting focus to the classical
identification of antigens for the development of
recombinant vaccines against leptospira. While
significant progress have been recorded, the
development of a broad-range leptospiral vaccine
still remains elusive (Dellagostin et al., 2017).
The advanced techniques like recombinant DNA
technology, reverse genetics, DNA vaccination,
molecular genetics and proteomics approaches are
being explored for search of novel antigens, proteins
and genes as potential candidates to discover safer,
efficient and better vaccines for leptospirosis (Verma
et al., 2012). The recent advancements of
recombinant outer membrane protein (OMP)
vaccines, lipopolysaccharide (LPS) vaccines and
DNA vaccines against leptospirosis are also
reviewed (Dellagostin et al., 2011). Moreover, a
vaccine ontology database was built for the scientists
working on the leptospirosis vaccines as a starting
tool (Wang et al., 2007). DNA vaccines containing
multi-epitope encoded gene have been reported to
confer protection against many infectious diseases
(Ding et al., 2012; Sela-Culang et al., 2015; Sette,
Fikes, 2003). DNA vaccine stimulates antibody
production in a similar way as foreign antigens are
processed and presented during natural infection.
Similarly, multi-epitope DNA vaccines were
reported to induce more potent immunoreactions
than whole protein vaccines (Zhao et al., 2012).
Such vaccines are also able to induce powerful
cross-reactive immunological response due to the
fact they are derived from multiple antigens
packaged into a relatively small chimeric molecule.
Moreover, immunity induced by multi-epitope DNA
vaccine includes both the humoral and cellular
immune component. Hence, they are considered
suitable for protection against a wide range of
serovars, especially in endemic regions. The
construction of such highly complex synthetic
vaccine may potentially have higher efficacy than
assembly of naturally occurring sequences (Yu et al.,
2015). Chemically synthesized genes could produce
a significant impact on the immuno-reactivity
against diverse leptospiral outer membrane proteins
(Rollauer et al., 2015; Wang et al., 2002). Overall,
recognition of special clinical symptoms of
leptospirosis and determination exactly the target
immune factors are important not only to have rapid
diagnosis and treating in time but also to reduce risks
of fatality by vaccination.
MATERIALS AND METHODS
Leptospira strains, cultivation, and serogroup
identification
Among twelve epidemiologically related
Leptospira strains collected from human or rats in
Leptospira outbreaks in Vietnam, we selected six
Leptospira strains that were used to make the
inactivated vaccine currently in Vietnam,
including L.Pomona_VN, L.Canicola_VN,
L.Mitis_VN, L.Ictero haemohagiae_VN,
L.Bataviae_VN, and L.Grippotyphosa_VN.
Serogroup identification of these leptospiral
Journal of Biotechnology 16(4): 745-756, 2018
747
strains was carried out by Microscopic
agglutination test (MAT) with 12 international
standard serogroup-specific rabbit antisera from
the National Center for Veterinary Diagnosis
(NCDV), Vietnam. All of the 6 strains were
maintained by the NCDV. Leptospires were stored
long-term at −70°C and have been passaged every
six months. When needed, they were subcultured
in 10ml Ellinghausen- McCullough-Johnson-
Harris (EMJH) liquid medium at 30oC for 7-10
days to stationary phase and checked for the
presence of contaminating aerobic bacteria by
overnight culture on 8% (w/v) horse-blood agar at
30 and 37oC (Ellinghausen, McCullough, 1965).
Total DNA extraction
Genomic DNA was extracted using
Phenol:Chlorofrom:Isoamyl (25:24:1) (Sambrook,
Russell, 2001) and was diluted to a final
concentration of 20 ng/ml. All total DNA samples
were quality and quantity checks by electrophoresis
of 3µl of each reaction on 1% agarose gel for 30 min
at 100V and Nanodrop.
Sequence assembly and alignment using 16S
rRNA gene sequencing
16S rRNA PCR products (Table 1) were purified
with mini spin columns provided in GeneJET™ PCR
Purification Kit (Thermo Fisher Scientific) according
to the manufacturer’s protocol. The PCR products
were sequenced according to dideoxynucleotide
chain termination method (Sanger et al., 1977).
Sequencing PCR reactions were performed on each
template on the automated ABI PRISM 3500 DNA
Sequencer (Applied Biosystems) at Institute of
Genome Research, Vietnam Academy of Science
and Technology, Vietnam. Amplified fragments
were set up in 10 µl reaction volumes (2 µl BigDye
Terminator v3.1, 1µl BigDye Sequencing buffer, 1
µl primer (10 µM), 2 µl DNA, and 4 µl water).
Sequencing was carried out according to the
following procedure: denaturation at 96oC for 1 min,
and 25 cycles of denaturation at 96oC for 10 s,
annealing at 50oC for 5 s, elongation at 60oC for 4
min. Then the samples were purified and incubated
with 20 µl Hi-Di, and denatured at 98°C for 2 min.
Finally, these samples transferred to plate and
sequenced with the sequencer using POP6 and a 36
cm capillary array. The run module conditions were
as follows: 22 s for injection time, 1 kV for injection
voltage, 15 kV for run voltage, 10 Amps for run
current, and 55oC for run temperature.
Table 1. Primer pairs used for successful amplification of 16S rRNA sequencing and gene expressions.
Gene name Sequences Size (bp) Tm
16S rRNA F GCCTACGGGAGGCAGCAG 550 50oC for 30s
R CCGTCAATTCMTTTGAGTTT
OmpL1 F TTGATTGAATTCTTAGAGTTCGTGTTTATA 960 56oC for 50s
R AAGGAGAAGCTTATGATCCGTAACATAAGT
LipL32 F TTACCGCTCGAGGTGCTTTCGGTGGTCTGC 782 50oC for 30s
R TGTTAACCCGGGTTACTTAGTCGCGTCAGA
LipL41 F AGAGAAGATAATTTTCTCCCCATGGGTAACA 1065 50oC for 50s
R GAAAGCAACGCAAAGTAACTCGAGTCCTTT
LipL21 F ATGATCAATAGACTTATAGCTC 560 50oC for 60s
R TTATTGTTTGGAAACCTCTTGA
LigA F CGGTCGACTATCGTTACTCCAGCA 991 50oC for 50s
R CGGCGGCCGCAATATCCGTATTAGA
LigB F CCGCTCGAGGTGTTTATGAAGAAA 620 50oC for 50s
R ACTCTCGAGCGTATTAGAGGAAT
Sequencing analysis
To explore the genetic diversity and
evolutionary relationship between the isolates in
Vietnam and other countries, twenty-four accessible
Leptospira species reference sequences obtained
from GenBank database were added into our analysis
(Table 2). The sequences of all the Leptospira strains
in this study and the twenty-four representative
sequences from GenBank were compared using
CLUSTALW multiple alignments and Phylogenetic
analysis was conducted with MEGA 6.0. The
Vo Thi Bich Thuy et al.
748
Maximum Likelihood method based on Kimura 2-
parameter model was constructed using
bootstrapping at 1,000 bootstrap replications (Kim et
al., 2002).
Table 2. Other Leptospira species references from GenBank database.
Strains Serovar Accession number (NCBI GenBank)
Leptospira interrogans Hardjo-prajitno JQ765630.1
Leptospira interrogans Hardjo-prajitno CP013147.1
Leptospira interrogans Hardjo CP012603.1
Leptospira interrogans Kennewicki FJ154571.1
Leptospira interrogans Pyrogenes DB60 JQ988842.1
Leptospira interrogans Pomona DB37 JQ988858.1
Leptospira interrogans Pomona KR091971.1
Leptospira interrogans Copenhageni NR 074524.1
Leptospira interrogans Copenhageni KR091970.1
Leptospira interrogans Linhai CP006723.1
Leptospira interrogans Grippotyphosa JQ906628.1
Leptospira interrogans Grippotyphosa JQ906625.1
Leptospira interrogans Saxkoebing KR107202.1
Leptospira interrogans Manilae CP011931.1
Leptospira interrogans Canicola KU053945.1
Leptospira interrogans Canicola KR080516.1
Leptospira interrogans Bratislava CP011410.1
Leptospira interrogans Bratislava-DB38 JQ988859.1
Leptospira interrogans Lai NR 074481.1
Leptospira interrogans Australis-DB42 JQ988863.1
Leptospira interrogans Icterohaemorrhagiae -DB69 JQ988845.1
Leptospira interrogans Icterohaemorrhagiae FJ154563.1
Leptospira interrogans Bataviae-DB59 JQ988841.1
Leptospira interrogans Muenchen FJ154565.1
Gene expression
Gene expressions were performed based on six
genes including the immunoglobulin like proteins A
and B (LigA and LigB genes), outer membrane
protein (OmpL1 gene), and lipopolysaccharide
(LipL32, LipL41, and LipL21 genes). The genes were
amplified in PCR fragments generated with specific
primer pairs (Table 1). PCR was conducted using the
following parameters: an initial denature step at
94°C for 3 min, followed by 30 cycles of 94°C for
30 - 50 s, 50°C - 56°C for 30 - 50 s, 72°C for 40 - 60
s, then 72°C for 7 - 10 min. The PCR products were
visualized on 1% TBE agarose gel electrophoresis
and ethidium bromide stained to check the gene
expressions.
In-silico prediction and selection of vaccine
epitopes
This study used DNA were sequencing from
six strains of Leptospira by 454 sequencing
system. ExPASy tool
(https://web.expasy.org/translate/) was used to
translate DNA sequence to protein sequence.
Protein sequences suitable to predict epitope were
selected by aligning protein sequences on BioEdit
software (version 7.2.5) (Hall et al., 2011).
Multiple sequence alignment was done for all
retrieved sequences using Bioedit software to
determine the conserved region so as to predict the
only conserved epitopes that might act as a peptide
vaccine. In addition, to avoid the epitopes located
in the signal peptide region, SignalP 3.0 Server
( was
used to predict the signal peptides. The detection
of T and B cell epitopes were predicted based on
the amino acid sequences of LipL21 and LipL32.
Journal of Biotechnology 16(4): 745-756, 2018
749
3D structure prediction
I-TASSER Server was used to predict protein
3D structures (Zhang, 2008). The best results were
analyzed by ElliPro with default threshold values.
ElliPro predicts linear and discontinuous antibody
epitopes based on a protein antigen's 3D structure
(Ponomarenko et al., 2008).
B-cell epitope prediction
B-cell epitopes were predicted base on sequence
and structure of LipL21 and LipL32 protein. Protein
sequence were analyzed by some B-cell prediction
methods from IEDB including Bepipred Linear
Epitope Prediction 1.0 & 2.0 (Jespersen et al., 2017;
Larsen et al., 2006), Chou and Fasman beta turn
prediction (Chou, Fasman, 2009), Emini Surface
Accessibility Prediction (Emini et al., 1985), Karplus
& Schulz Flexibility Prediction (Karplus, Schulz,
1985), Kolaskar & Tongaonkar Antigenicity
(Kolaskar, Tongaonkar, 1990) and Parker
Hydrophilicity Prediction (Parker et al., 1986) with
default window and threshold values.
T-cell epitope prediction
To predict T-cell epitope linked to mayor
histocompatibility complex (MHC) I or MHC II, the
IEDB prediction tools were used. This study used
MHC I Binding tool with all alleles of human, cow,
mouse and pig ( other
options set default. For MHC II Binding tool, all
alleles of human and mouse were selected
( other options set
default.
Analyzing distribution of epitopes
Predicted epitopes were aligned with protein
sequence by Clustal Omega (Sievers et al., 2011).
Microsoft Excel base on position of epitopes on
protein sequences to analyze distribution of epitopes.
RESULTS AND DISCUSSION
Phylogenetic relationship between Vietnamese
Leptospira strains and other Leptospira strains
using 16S rRNA gene sequencing
Phylogenetic tree was constructed for the six
leptospiral isolates in this study and the twenty-four
international pathogenic L. interrogans
representative strains obtained from GenBank
database (Figure 1). Sequences 16S rRNA gene of
Leptospira spp. strains were used for phylogenetic
analysis.
16S rRNA sequencing used as a tool for
phylogenetic analysis has led to a better
understanding of evolution of Leptospira. To
investigate the genetic diversity of leptospirosis, a
total of six Vietnamese strains and twenty-four
international reference strains belonging to
serogroup L. interrogans were analyzed using 16S
rRNA gene sequencing. The Maximum Likelihood
data revealed the phylogenetic relationship between
these different pathogenic species in this study and
other international pathogenic species. The findings
from the phylogenetic tree reveal the relationship
and genetic diversity of various serovars of
Leptospira interrogans, with their nearest
phylogenetic relatives. The results showed that two
pathogenic species of L.Pomona_VN and L.Hardjo
seem to be more closely (bootstrap: 99%). A weak
close genetic relationship of L. Canicola_VN or L.
Ictero haemohagiae_VN and the classic L.Canicola,
L.Grippotyphosa was also confirmed by using 16S
rRNA sequencing in this study (bootstrap: 62%).
From the phylogenetic analysis, L.Mitis_VN and
L.Grippotyphosa_VN were clustered together and
L.Bataviae_VN strain, their sister group, appeared a
weak phylogenetic relationship (bootstrap: 62%).
The phylogenetic analysis revealed that the
genetically diverse strains of serogroup L.
interrogans isolates from Vietnam were generally
different with those isolated in other countries. The
bootstrap percentages quoted are the percentage
times a taxa at that node occurred, the percentages
are ranging from 62% to 99%, which may indicate
that Leptospira may evolve according to different
locations and the epidemiology of leptospirosis in
Vietnam relative independent from other countries.
The genetic relationship of Leptospira species were
also confirmed by several previous studies. Rettinger
(2012) compared phylogenetic trees through 16S
rRNA gene sequences of twenty-eight leptospiral
strains, including pathogenic, non-pathogenic and
intermediate strains. Statistical analysis of three
pathogenic genomospecies revealed peak differences
at the species level in this study (Rettinger et al.,
2012). Zhang (2015) used the 16S rRNA sequencing
and MLST genotyping methods to investigate the
genetic diversity of pathogenic Leptospira and
understand the changing epidemiological and
evolutionary trends of this serogroup in Mainland
China. Their data revealed that the major Leptospira
species from different countries were distinct and
Vo Thi Bich Thuy et al.
750
had great genetic diversity in geographic
epidemiology (Wang et al., 2006). Bourhy (2014)
was inferred from sequence analysis of the 16S
rRNA gene and analyzed the phylogenetic of the
genus Leptospira in Mayotte (Indian Ocean). These
data were phylogenetically consistent and reflected
genetic relatedness among species of these genus
Leptospira (Bourhy et al., 2014). Our present study
also indicated that 16S rRNA gene sequencing is a
useful technique to explore the genetic diversity and
molecular epidemiology of leptospirosis on a global
and/or historical scale. Moreover, these results
provide a blueprint for further phylogenetic research
in pathogenic Leptospira strains.
Checking for some antigenic genes in Vietnamese
pathogenic Leptospira serovars
In an effort to find the promising antigenic genes
for launching a kind of recombination leptospirosis
vaccines in Vietnam, we selected six genes (e.g.
LigA, LigB, OmpL1, LipL32, LipL41 and LipL21
genes) and checked gene expression in these
Leptospira strains by PCR method. Only three genes
(e.g., LipL32, LipL21, and LigA genes) were
expressed in all strains and OmpL1 gene occured in
four strains (L.Bataviae_VN, L.Canicola_VN,
L.Grypothyphosa_VN and L.Mitis_VN), whereas
LipL41 and LigB genes did not appear in any
Leptospira strains (data not shown) (Figure 2).
It has long been expected to find an effective
vaccine to prevent leptospirosis through
Figure 1. Phylogenetic analysis based on based on 16S rRNA gene for the thirty pathogenic Leptospira strains (twenty-four
sequences obtained from the NCBI database). Phylogenetic trees were constructed by Maximum likelihood and Neighbour-
joining method. The bootstrap percentages quoted are the percentage times a taxa at that node occurred. The scale bar
represents the number of base pairs differences. The arrows (à) indicate Leptospira strains in Vietnam.
Journal of Biotechnology 16(4): 745-756, 2018
751
immunization of high risk humans or animals.
Although some leptospirosis vaccines have been
obtained, the vaccination is relatively unsuccessful
and millions of dollars spent (Wang et al., 2007). In
Vietnam, mainly using inactivated vaccine in
preventing and controlling leptospirosis. However,
vaccination with inactivated whole-cell preparations
(bacterins) has limited efficacy due to the wide
antigenic variation of the pathogen. A intensive
efforts towards developing improved recombinant
vaccines are ongoing. During the last decade, many
reports on the evaluation of recombinant vaccines
have been published. Partial success has been
obtained with some surface exposed protein
antigens. Raja (2013) was surveyed the different
types of OMPs of Leptospira and combines all the
novel features of OMPs and put forth some views for
future research (Raja, Natarajaseenivasan, 2015).
Forster (2015) evaluated the N-terminal region of the
leptospiral immunoglobulin-like B protein (LigBrep)
as a candidate antigen for an effective vaccine
against leptospirosis and emphasised the use of the
DNA prime protein boost as an important strategy
for vaccine development (Forster et al., 2015). Hu
(2014) reported several outer membrane protein
antigens exist in all the L. interrogans prevailing in
China and suggested that predominant T- and B-cell
combined epitopes in the outer membrane protein
antigens can be used for developing novel universal
leptospirosis vaccines (Hu et al., 2014). The research
results of Dezhbord (2014) in cloning gene for
expression and recombinant OmpL1 as an efficient
and conserved antigen were suggested that OmpL1
gene may be a useful vaccine candidate against
leptospirosis in Iran region (Dezhbord et al., 2014).
Several researchers suggested the purified
recombinant LigA protein is the most promising
subunit vaccine candidate against leptospirosis
reported to date, however, as purified proteins are
weak immunogens the use of a potent adjuvant is
essential for the success of LigA as a subunit
vaccine (Bacelo et al., 2014; Kanagavel et al.,
2014). In 2014, Maneewatch and Adisakwattana
studied two LipL32-specific mouse monoclonal
antibodies (mAbLPF1 and mAbLPF2) and
suggested LipL32 recombinant protein as
diagnostic and vaccine targets for leptospirosis
(Maneewatch et al., 2014). In addition, Ye (2014)
was tested and developed four recombinant
proteins of Leptospira interrogans, namely,
rLipL21, rLoa22, rLipL32, and rLigACon4-8 as
antigens for the diagnosis of equine leptospirosis
(Ye et al., 2014). Although were not
commercialization, the first vaccines were put
foundation for efficacy of new generations, which
have outstanding developments to coincide the
present needs. However, a crucial work on
effective recombinant vaccine development and
engineered antibodies will hopefully meet to solve
the therapeutic challenges (Vedhagiri et al., 2009).
Figure 2. Gene expression products of Leptospira strains. Each species labeled as follow: Ba: L.Bataviae_VN; Ca: L.
Canicola_VN; Ic: L.Ictero haemohagiae_VN; Gr: L.Grippotyphosa_VN; Mitis: L.Mitis_VN; Pm: L.Pomona_VN; M: Marker
DNA 1 Kb (10,000 bp; Thermo) or Marker DNA 100 bp (1,000 bp, Thermo).
Vo Thi Bich Thuy et al.
752
Epitope candidates
The potential B cell and T cell epitopes were
found to be distributed throughout the whole
sequence, numerous fragments could be selected as
candidates for the design of a vaccine. Nevertheless,
it is necessary to define both B cell and T cell
epitopes as candidates, to thereby generate a vaccine
inducing both humoral and cellular response.
Therefore, a more exhaustive analysis was
performed to identify regions comprising both types
of epitopes.
The combined T and B cell epitopes were
predicted based on the amino acid sequences of
LipL21 and LipL32. The LipL21 and LipL32
translated sequences had 163 and 215 amino acids
(aa), respectively. Six sequences for each gene were
aligned by multiple sequence alignment using
BioEdit software, to obtain the conserved regions.
The only one different amino acid at amino acid
114th of LipL32 sequences was detected. Thus one
conserved regions for the LipL21 and two conserved
regions for 1-113 aa residues (LipL321-113) and 115-
215 aa residues (LipL32115-215) of LipL32 were
chosen to predict protein 3D structure and potential
epitopes (Figure 3).
The results of mapping showed that, all of three
conserved peptides had two high levels of mapped
epitopes regions. Because, these regions had many
candidate epitopes positions, they may show the
higher antigenicity than other regions. They were
LipL21 residues 2-70 (LipL212-70), LipL2171-119,
LipL324-61, LipL3281-133, LipL32115-158, and
LipL32164-210. The six peptide has length in range 45
- 69 aa (Figure 4).
Previous studies recommended that the
application of only one protein as a subunit
recombinant vaccine could not successfully prevent
leptospirosis since it is not antigenic enough to
stimulate the immune system. While, the applying
multi-epitope vaccines, which use epitopes of several
proteins, were the solution to vaccine antigenicity
(Branger et al., 2001; Haake et al., 1999). Several
researchers had used in silico approach for
identifying and designing of vaccine candidates
(Branger et al., 2001; Hasan et al., 2015; Khatoon et
al., 2017) and some of them achieved promising
clinical trial results (Groot, Rappuoli, 2004). Multi-
epitope peptide DNA vaccines are effective against
some viruses and they have recently been shown to
have potential efficacy against some bacterial
diseases including leptospires. Similarly, the fact that
the DNA was expressed efficiently invitro is
indicative of the fact that the DNA is
correspondingly expressed after immunization as
observed from the protection rendered. However,
incorporating T-cell epitopes may likely improve the
potency of the vaccine as Th-1 type immune
response has previously been demonstrated in cattle
vaccinated with killed L. Hardjo vaccine (Naiman et
al., 2001). Overall, the present novel immunogenic
multi-epitope DNA vaccine developed by chemical
gene synthesis and delivered as a plasmid DNA
vaccine may serve as a new candidate target for
leptospiral vaccine development.
In the present study, we also used bioinformatic
Figure 3. 3D structure of the conservative regions in outer membrane lipoproteins LipL21 and LipL32. Using seven different
algorithms for B cell and two algorithms for T cell, 95 epitopes from LipL21 peptide, 46 epitopes from LipL321-113 peptide,
and 78 epitopes from LipL32115-215 peptide were predicted (Table 3). Candidate peptides were mapped to reference to
determine the epitope density per base of each peptide.
Journal of Biotechnology 16(4): 745-756, 2018
753
tools to predict candidate epitopes. To stimulate
antigen specific B cell and T cell immune response,
epitopes were predicted for both B-cell antibody and
T-cell MHC (I and II class) (Forouharmehr, Nassiry,
2015; Yousefi et al., 2015). The six peptide LipL212-
70, LipL2171-119, LipL324-61, LipL3281-133, LipL32115-
158, and LipL32164-210 did not only have the high
antigenicity but also short enough for recombination.
Therefore, with further test, these peptides can be
candidates for a new recombinant vaccine for
designing a recombinant multi-epitope vaccine
against leptospirosis in Vietnam.
Figure 4. Antigenic epitope prediction showing potential B and T cell epitopes for LipL21 (A), LipL321-113 (B), and LipL32115-
215 (C).
Vo Thi Bich Thuy et al.
754
Table 3. Number of antigenic epitopes in the conservative regions of outer membrane lipoproteins LipL21 and LipL32.
Number of epitope
LipL21 LipL321-113 LipL32115-215
Tc cell (Cytotoxic T cell) 53 18 45
Th cell (T helper cells) 19 10 19
B cell 23 14 14
CONCLUSION
From the initial research results, we suggested
that the six Vietnamese L. interrogan strains were
differentiated effectively in genetical distance by
phylogenetic analysis. Moreover, three genes
(LipL32, LipL21, and LigA genes) were expressed in
six Vietnamese pathogenic strains of Leptospira.
This work identified combined T and B cell
immunodominant epitopes in LipL32 and LipL21 of
L. interrogans. The identification of these immune
dominant epitopes may greatly facilitate the
development of novel leptospiral vaccines which
may provide protections across different serogroups
or serovars. The findings could also contribute to the
development of effective cross-protective vaccine
strategies for againsting leptospirosis in Vietnam.
Acknowledgments: We thank the Institute of
Genome Research, Vietnam Academy of Science and
Technology for the financial support.
REFERENCES
Adler B, de la Pena Moctezuma A (2010) Leptospira and
leptospirosis. Vet Microbiol 140: 287-96.
Agampodi SB, Peacock SJ, Thevanesam V, Nugegoda
DB, Smythe L, Thaipadungpanit J, Craig SB, Burns MA,
Dohnt M, Boonsilp S, Senaratne T, Kumara A,
Palihawadana P, Perera S, Vinetz JM (2011) Leptospirosis
outbreak in Sri Lanka in 2008: lessons for assessing the
global burden of disease. Am J Trop Med Hyg 85: 471-8.
Bacelo KL, Hartwig DD, Seixas FK, Schuch R, Moreira
Ada S, Amaral M, Collares T, Vendrusculo CT, McBride
AJ, Dellagostin OA (2014) Xanthan gum as an adjuvant in
a subunit vaccine preparation against leptospirosis. Biomed
Res Int 2014: 636491.
Bourhy P, Collet L, Brisse S, Picardeau M (2014)
Leptospira mayottensis sp. nov., a pathogenic species of
the genus Leptospira isolated from humans. Int J Syst Evol
Microbiol 64: 4061-7.
Branger C, Sonrier C, Chatrenet B, Klonjkowski B,
Ruvoen-Clouet N, Aubert A, Andre-Fontaine G, Eloit M
(2001) Identification of the hemolysis-associated protein 1
as a cross-protective immunogen of Leptospira interrogans
by adenovirus-mediated vaccination. Infection and
immunity 69: 6831-6838.
Chou P, Fasman GD (2009) Amino acid sequence. Adv.
Enzymol. Relat. Areas molec. Biol 47: 45.
Dellagostin OA, Grassmann AA, Hartwig DD, Felix SR,
da Silva EF, McBride AJ (2011) Recombinant vaccines
against leptospirosis. Hum Vaccin 7: 1215-24.
Dellagostin OA, Grassmann AA, Rizzi C, Schuch RA,
Jorge S, Oliveira TL, McBride AJ, Hartwig DD (2017)
Reverse Vaccinology: An Approach for Identifying
Leptospiral Vaccine Candidates. Int J Mol Sci 18: ???
Dezhbord M, Esmaelizad M, Khaki P, Fotohi F,
Zarehparvar Moghaddam A (2014) Molecular
identification of the ompL1 gene within Leptospira
interrogans standard serovars. J Infect Dev Ctries 8:
688-93.
Ding J, Qian W, Liu Q, Q. L (2012) Multi-epitope
recombinant vaccine induces immunoprotection against
mixed infection of Eimeria spp. Parasitology Research
110: 2297-2306.
Ellinghausen HC, Jr., McCullough WG (1965) Nutrition of
Leptospira Pomona and growth of 13 other Serotypes: A
serum-free medium employing oleic albumin complex. Am
J Vet Res 26: 39-44.
Emini EA, Hughes JV, Perlow D, Boger J (1985)
Induction of hepatitis A virus-neutralizing antibody by a
virus-specific synthetic peptide. Journal of virology 55:
836-839.
Forouharmehr A, Nassiry MR (2015) B and T-cell
epitopes prediction of the P40 antigen for developing
mycoplasma agalactiae vaccine using Bioinformatic Tools.
Genet. Millennium 13: 3954-3961.
Forster KM, Hartwig DD, Oliveira TL, Bacelo KL, Schuch
R, Amaral MG, Dellagostin OA (2015) DNA prime-
protein boost based vaccination with a conserved region of
leptospiral immunoglobulin-like A and B proteins
enhances protection against leptospirosis. Mem Inst
Oswaldo Cruz 110: 989-95.
Groot ASD, Rappuoli R (2004) Genome-derived vaccines.
Expert review of vaccines 3: 59-76.
Journal of Biotechnology 16(4): 745-756, 2018
755
Haake DA, Mazel MK, McCoy AM, Milward F, Chao G,
Matsunaga J, Wagar EA (1999) Leptospiral outer
membrane proteins OmpL1 and LipL41 exhibit synergistic
immunoprotection. Infection and immunity 67: 6572-6582.
Hall T, Biosciences I, Carlsbad C (2011) BioEdit: an
important software for molecular biology. GERF Bull
Biosci 2: 60-61.
Hasan MA, Khan MA, Datta A, Mazumder MHH, Hossain
MU (2015) A comprehensive immunoinformatics and
target site study revealed the corner-stone toward
Chikungunya virus treatment. Molecular immunology 65:
189-204.
Hu W, Lin X, Yan J (2014) Leptospira and leptospirosis in
China. Curr Opin Infect Dis 27: 432-6.
Jespersen MC, Peters B, Nielsen M, Marcatili P (2017)
BepiPred-2.0: improving sequence-based B-cell epitope
prediction using conformational epitopes. Nucleic acids
research 45: W24-W29.
Kanagavel M, Shanmughapriya S, Anbarasu K,
Natarajaseenivasan K (2014) B-cell-specific peptides of
leptospira interrogans LigA for diagnosis of patients with
acute leptospirosis. Clin Vaccine Immunol 21: 354-9.
Karplus P, Schulz G (1985) Prediction of chain flexibility
in proteins. Naturwissenschaften 72: 212-213.
Khatoon N, Pandey RK, Prajapati VK (2017) Exploring
Leishmania secretory proteins to design B and T cell
multi-epitope subunit vaccine using immunoinformatics
approach. Scientific Reports 7: 8285.
Kim KI, Lee JH, Li K, Zhang YP, Lee SS, Gongora J,
Moran C (2002) Phylogenetic relationships of Asian and
European pig breeds determined by mitochondrial DNA
D-loop sequence polymorphism. Anim. Genet. 33: 19-25.
Kolaskar A, Tongaonkar PC (1990) A semi-empirical
method for prediction of antigenic determinants on protein
antigens. FEBS letters 276: 172-174.
Larsen JEP, Lund O, Nielsen M (2006) Improved method
for predicting linear B-cell epitopes. Immunome research
2: 2.
Levett PN (2001) Leptospirosis. Clin Microbiol Rev 14:
296-326.
Maneewatch S, Adisakwattana P, Chaisri U, Saengjaruk P,
Srimanote P, Thanongsaksrikul J, Sakolvaree Y, Poungpan
P, Chaicumpa W (2014) Therapeutic epitopes of
Leptospira LipL32 protein and their characteristics.
Protein Eng Des Sel 27: 135-44.
Naiman BM, Alt D, Bolin CA, Zuerner R, Baldwin CL
(2001) Protective killed Leptospira borgpetersenii vaccine
induces potent Th1 immunity comprising responses by
CD4 and gammadelta T lymphocytes. Infect Immun 69:
7550-8.
Parker J, Guo D, Hodges R (1986) New hydrophilicity
scale derived from high-performance liquid
chromatography peptide retention data: correlation of
predicted surface residues with antigenicity and X-ray-
derived accessible sites. Biochemistry 25: 5425-5432.
Ponomarenko J, Bui H-H, Li W, Fusseder N, Bourne PE,
Sette A, Peters B (2008) ElliPro: a new structure-based
tool for the prediction of antibody epitopes. BMC
bioinformatics 9: 514.
Raja V, Natarajaseenivasan K (2015) Pathogenic,
diagnostic and vaccine potential of leptospiral outer
membrane proteins (OMPs). Crit Rev Microbiol 41: 1-17.
Rettinger A, Krupka I, Grunwald K, Dyachenko V,
Fingerle V, Konrad R, Raschel H, Busch U, Sing A,
Straubinger RK, Huber I (2012) Leptospira spp. strain
identification by MALDI TOF MS is an equivalent tool to
16S rRNA gene sequencing and multi locus sequence
typing (MLST). BMC Microbiol 12: 185.
Rollauer SE, Sooreshjani MA, Noinaj N, Buchanan SK
(2015) Outer membrane protein biogenesis in Gram-
negative bacteria. Philos Trans R Soc Lond B Biol Sci 370:
Sambrook J, Russell DW (2001) Molecular Cloning: A
Laboratory Manual. 3rd Ed., UK: Coldspring-Harbour
Laboratory Press;
Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing
with chain-terminating inhibitors. Proc. Natl. Acad. Sci.
U.S.A. 74: 5463-5467.
Sela-Culang I, Ashkenazi S, Peters B, Ofran Y (2015)
PEASE: predicting B-cell epitopes utilizing antibody
sequence. Bioinformatics 31: 1313-5.
Sette A, Fikes J (2003) Epitope-based vaccines: an update
on epitope identification, vaccine design and delivery.
Current Opinion in Immunology 15: 461-470.
Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li
W, Lopez R, McWilliam H, Remmert M, Söding J (2011)
Fast, scalable generation of high-quality protein multiple
sequence alignments using Clustal Omega. Molecular
systems biology 7: 539.
Silveira MM, Oliveira TL, Schuch RA, McBride AJA,
Dellagostin OA, Hartwig DD (2017) DNA vaccines
against leptospirosis: A literature review. Vaccine 35:
5559-5567.
Slack A (2010) Leptospirosis. Aust Fam Physician 39:
495-8.
Vanasco NB, Schmeling MF, Lottersberger J, Costa F, Ko
AI, Tarabla HD (2008) Clinical characteristics and risk
factors of human leptospirosis in Argentina (1999-2005).
Acta Trop 107: 255-8.
Vedhagiri K, Natarajaseenivasan K, Chellapandi P,
Prabhakaran SG, Selvin J, Sharma S, Vijayachari P (2009)
Evolutionary implication of outer membrane lipoprotein-
Vo Thi Bich Thuy et al.
756
encoding genes ompL1, UpL32 and lipL41 of pathogenic
Leptospira species. Genomics Proteomics Bioinformatics
7: 96-106.
Verma AK, Kumar A, Dhama K, Deb R, Rahal A,
Mahima, Chakraborty S (2012) Leptospirosis-persistence
of a dilemma: an overview with particular emphasis on
trends and recent advances in vaccines and vaccination
strategies. Pak J Biol Sci 15: 954-63.
Wang M, Dai B, You Z, Fang Z, Wang Y (2002)
Construction of DNA vaccine including a chimeric gene
encoding flagellin and outer membrane protein antigen
from Leptospira interrogons serovar lai. Hua Xi Yi Ke Da
Xue Xue Bao 33: 169-71.
Wang Z, Jin L, Wegrzyn A (2007) Leptospirosis vaccines.
Microb Cell Fact 6: 39.
Wang Z, Yuan Z, Xiang L, Shao J, Wegrzyn G (2006)
tRNA-dependent cleavage of the ColE1 plasmid-encoded
RNA I. Microbiology 152: 3467-76.
Ye C, Yan W, McDonough PL, McDonough SP,
Mohamed H, Divers TJ, Chang YF, Yang Z (2014)
Serodiagnosis of equine leptospirosis by enzyme-linked
immunosorbent assay using four recombinant protein
markers. Clin Vaccine Immunol 21: 478-83.
Yousefi S, Tahmoorespur M, Sekhavati MH (2015) B and
T-cell epitope prediction of the OMP25 antigen for
developing Brucella melitensis vaccines for sheep. Iranian
Journal of Applied Animal Science 5:
Yu K, Liu C, Kim BG, Lee DY (2015) Synthetic fusion
protein design and applications. Biotechnol Adv 33: 155-
164.
Zhang Y (2008) I-TASSER server for protein 3D structure
prediction. BMC bioinformatics 9: 40.
Zhao C, Sun Y, Zhao Y, Wang S, Yu T, Du F, Yang XF,
Luo E (2012) Immunogenicity of a multi-epitope DNA
vaccine against hantavirus. Hum Vaccin Immunother 8:
208-15.
PHÂN TÍCH TRÌNH TỰ GEN 16S rRNA TỪ CÁC CHỦNG LEPTOSPIRA GÂY BỆNH
CỦA VIỆT NAM VÀ DỰ ĐOÁN IN-SILICO CÁC EPITOPE TIỀM NĂNG TRÊN HAI
LIPOPROTEIN MÀNG NGOÀI LIPL21, LIPL32
Võ Thị Bích Thuỷ1,2, Nguyễn Tuấn Hùng2,3, Nghiêm Ngọc Minh2
1Viện Nghiên cứu hệ gen, Viện Hàn lâm Khoa học và Công nghệ Việt Nam
2Học viện Khoa học và Công nghệ, Viện Hàn lâm Khoa học và Công nghệ Việt Nam
3Công ty Cổ phần Thuốc Thú y Trung ương VETVACO, Đức Thượng, Hoài Đức, Hà Nội
TÓM TẮT
Bệnh xoắn khuẩn (Leptospirosis) được xác định là một bệnh truyền nhiễm mới nổi, có khả năng gây bệnh
trên động vật và lây lan sang người. Bệnh do Leptospira gây ra. Mặc dù đã có một số loại vacxin phòng bệnh
do Leptospira nhưng đáp ứng miễn dịch không cao, thời gian bảo hộ không dài. Trong thí nghiệm này, một
đoạn 550 bp của gen RNA ribosome (16S rRNA) của 6 chủng Leptospira gây bệnh xoắn khuẩn và đang được
sử dụng làm chủng chế vacxin vô hoạt ở Việt Nam (bao gồm: Pomona, Canicola, Mitis, Ictero haemohagiae,
Bataviae, và Grippotyphosa) đã được giải trình tự. Kết quả cho thấy một mối quan hệ di truyền gần gũi của
chủng L.Pomona_VN với L.Hardjo (bootstrap: 99%). Ngược lại, L.Canicola_VN và L.Ictero haemohagiae_VN
dường như có mối quan hệ di truyền yếu với các chủng cổ điển L.Canicola, L. Grippotyphosa (bootstrap: 62%).
Các chủng khác như L.Mitis_VN và L.Grippotyphosa_VN xuất hiện cùng nhánh, nhưng lại có mối quan hệ di
truyền yếu với nhóm chị em của chúng là chủng L.Bataviae_VN (bootstrap: 62%). Chúng tôi cũng lựa chọn 6
gen, gồm: các globulin miễn dịch như protein A và B (gen LigA và LigB), protein màng ngoài (gen OmpL1), và
lipopolysaccharide (gen LipL32, LipL41 và LipL21) để kiểm tra sự xuất hiện của các gen này ở các chủng
Leptospira trên bằng phương pháp phản ứng chuỗi polymerase (PCR). Có 3 gen (gen LipL32, LipL21 và LigA)
xuất hiện trong tất cả các chủng, riêng gen OmpL1 chỉ có ở 4 chủng (Bataviae, Canicola, Grypothyphosa và
Mitis), trong khi đó gen LipL41 và LigB đã không xuất hiện trong bất kỳ chủng Leptospira nào. Một tập hợp
các epitope tiềm năng trong cả tế bào lympho T và B của protein LipL21 và LipL32 đã được tìm kiếm bằng
các công cụ tin sinh. Kết quả chỉ ra, có 3 vùng đa epitope (1 vùng và 95 epitope kháng nguyên cho cả hai tế
bào B và T của LipL21; 2 vùng và 124 epitope kháng nguyên cho cả hai tế bào B và T của LipL32). Cần
nghiên cứu sâu hơn về sinh học phân tử để tạo ra được một loại vac xin tái tổ hợp mới ứng dụng trong phòng
và điều trị bệnh leptospirosis cho động vật và người ở Việt Nam.
Từ khóa: Gen quyết định kháng nguyên, Loài Leptospira, Vacxin tái tổ hợp leptospirosis, Trình tự gen 16S rRNA