Phân tích trình tự gen 16S rRNA từ các chủng leptospira gây bệnh của Việt Nam và dự đoán in-silico các epitope tiềm năng trên hai Lipoprotein màng ngoài LIPL21, LIPL32

Bệnh xoắn khuẩn (Leptospirosis) được xác định là một bệnh truyền nhiễm mới nổi, có khả năng gây bệnh trên động vật và lây lan sang người. Bệnh do Leptospira gây ra. Mặc dù đã có một số loại vacxin phòng bệnh do Leptospira nhưng đáp ứng miễn dịch không cao, thời gian bảo hộ không dài. Trong thí nghiệm này, một đoạn 550 bp của gen RNA ribosome (16S rRNA) của 6 chủng Leptospira gây bệnh xoắn khuẩn và đang được sử dụng làm chủng chế vacxin vô hoạt ở Việt Nam (bao gồm: Pomona, Canicola, Mitis, Ictero haemohagiae, Bataviae, và Grippotyphosa) đã được giải trình tự. Kết quả cho thấy một mối quan hệ di truyền gần gũi của chủng L.Pomona_VN với L.Hardjo (bootstrap: 99%). Ngược lại, L.Canicola_VN và L.Ictero haemohagiae_VN dường như có mối quan hệ di truyền yếu với các chủng cổ điển L.Canicola, L. Grippotyphosa (bootstrap: 62%). Các chủng khác như L.Mitis_VN và L.Grippotyphosa_VN xuất hiện cùng nhánh, nhưng lại có mối quan hệ di truyền yếu với nhóm chị em của chúng là chủng L.Bataviae_VN (bootstrap: 62%). Chúng tôi cũng lựa chọn 6 gen, gồm: các globulin miễn dịch như protein A và B (gen LigA và LigB), protein màng ngoài (gen OmpL1), và lipopolysaccharide (gen LipL32, LipL41 và LipL21) để kiểm tra sự xuất hiện của các gen này ở các chủng Leptospira trên bằng phương pháp phản ứng chuỗi polymerase (PCR). Có 3 gen (gen LipL32, LipL21 và LigA) xuất hiện trong tất cả các chủng, riêng gen OmpL1 chỉ có ở 4 chủng (Bataviae, Canicola, Grypothyphosa và Mitis), trong khi đó gen LipL41 và LigB đã không xuất hiện trong bất kỳ chủng Leptospira nào. Một tập hợp các epitope tiềm năng trong cả tế bào lympho T và B của protein LipL21 và LipL32 đã được tìm kiếm bằng các công cụ tin sinh. Kết quả chỉ ra, có 3 vùng đa epitope (1 vùng và 95 epitope kháng nguyên cho cả hai tế bào B và T của LipL21; 2 vùng và 124 epitope kháng nguyên cho cả hai tế bào B và T của LipL32). Cần nghiên cứu sâu hơn về sinh học phân tử để tạo ra được một loại vac xin tái tổ hợp mới ứng dụng trong phòng và điều trị bệnh leptospirosis cho động vật và người ở Việt Nam.

pdf12 trang | Chia sẻ: hachi492 | Lượt xem: 125 | Lượt tải: 0Freedownload
Bạn đang xem nội dung tài liệu Phân tích trình tự gen 16S rRNA từ các chủng leptospira gây bệnh của Việt Nam và dự đoán in-silico các epitope tiềm năng trên hai Lipoprotein màng ngoài LIPL21, LIPL32, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Journal of Biotechnology 16(4): 745-756, 2018 745 ANALYZING 16S rRNA SEQUENCES FROM VIETNAMESE PATHOGENIC LEPTOSPIRA STRAINS AND IN-SILICO PREDICTION OF POTENTIAL ANTIGENIC EPITOPES ON LIPL21, LIPL32 OUTER MEMBRANE LIPOPROTEINS Vo Thi Bich Thuy1,2, *, Nguyen Tuan Hung2,3, Nghiem Ngoc Minh1,2 1Institute of Genome Research, Vietnam Academy of Science and Technology 2Graduate University of Science and Technology, Vietnam Academy of Science and Technology 3VETVACO National Veterinary Joint Stock Company, Duc Thuong, Hoai Duc, Hanoi * To whom correspondence should be addressed. E-mail: [email protected] Received: 16.11.2018 Accepted: 20.12.2018 SUMMARY Leptospirosis, a zoonosis caused by Leptospira, is recognized as an emergent infectious disease. In currently, the lack of adequate diagnostic tools, vaccines are an attractive intervention strategy. In this experiment, a 550 bp fragment of large ribosomal RNA gene (16S rRNA) was sequenced and constructed phylogenetic tree from a panel of six Vietnamese pathogenic strains of Leptospira spirochetes (e.g., Pomona, Canicola, Mitis, Ictero haemohagiae, Bataviae, and Grippotyphosa). The results showed a close relationship of L.Pomona_VN and L.Hardjo (bootstrap: 99%). L.Canicola_VN and L.Ictero haemohagiae_VN appeared to be weak related to the classic L.Canicola, L. Grippotyphosa, these assemblage have a bootstrap support of 62%. The other strains (L.Mitis_VN and L.Grippotyphosa_VN) were appeared monophyletic, while their sister group (L.Bataviae_VN) relationship found only weak support (bootstrap: 62%). We also selected six genes [e.g. the immunoglobulin like proteins A and B (LigA and LigB genes), outer membrane protein (OmpL1 gene), and lipopolysaccharide (LipL32, LipL41, and LipL21 genes)] and checked gene expression in these Leptospira strains by polymerase chain reaction (PCR) method. There were three genes (e.g., LipL32, LipL21, and LigA genes) expressed in all strains, OmpL1 gene occured in 4 strains (L.Bataviae_VN, L.Canicola_VN, L.Grippotyphosa_VN and L.Mitis_VN), whereas LipL41 and LigB genes did not appear in any Leptospira strains. A multi-antigenic epitope potential of two gene (Lip L21 and Lip L32) was predicted by bioinformatic tools for designing a recombinant vaccine against leptospirosis. There were 3 multi-epitope regions (1 region and 95 antigenic epitope for B and T cells of LipL21 peptide; 2 regions and 124 antigenic epitope for both B and T cells of LipL32 peptide). It should be more of the deeply molecular biology studies to confirm the level agglutinating, antigen cleavage, peptide specificity matrices as well as neutralizing antibodies in the immune responses of DNA vaccine of these genes. Keywords: Antigenic genes, Leptospiraceac, Leptospirosis recombinant vaccine, 16S rRNA gene sequencing INTRODUCTION Leptospirosis constitutes an important public health problem in developing countries particularly those that are impoverished. The disease is responsible for economic losses in animal production as well as exerts a burden on human health. The World Organisation for Animal Health (OIE) manages leptospirosis in 2nd group of the most dangerous diseases (OIE, 2008) and currently it adds to the group of occupational diseases in Vietnam (TLĐLĐVN, 1991). Leptospirosis commons everywhere in the world, mostly in Africa, South America, and Asia regions, causing considerable damage to livestock and human health in many countries, especially the tropics (Vanasco et al., 2008). According to the World Health Organization (WHO) estimates that there are annually from 7 to 10 million people in the worldwide infected with the Leptospira interrogans (NHS, 2014). In developing countries, the disease is mainly farmers and poor people in the city, especially, people often working outdoors in warm and humid places have the risk of infection. The disease transmits to humans through mucous, skin, and eyes, which exposure to infected animal urine (Slack, 2010). Currently, pathogenic Vo Thi Bich Thuy et al. 746 leptospires are classified into nine pathogenic and four intermediate species, containing more than 260 serovars, and six saprophytic species, including over 60 serovars (Adler, de la Pena Moctezuma, 2010; Levett, 2001). The worldwide leptospirosis disease burden estimates are hampered by the lack of scientifically data from countries with probable high endemicity and limited diagnostic capacities. In Sri Lanka (2008) 404 possible cases were defined, in which 155 were confirmed to have leptospirosis with serovars Pyrogenes, Hardjo, Javanica, and Hebdomadis (Agampodi et al., 2011). Leptospirosis has been prevalent sporadically in China in recent years, and Leptospira interrogans Icterohaemorrhagiae serovar Lai is the most common pathogen in Chinese leptospirosis patients and Apodemus agrarius is its major animal host (Hu et al., 2014). Nowaday, there are several highlight reviews in the leptospirosis, e.g. susceptible population, disease transmission and epidemiology, treatment, trends and advances in diagnosis, vaccines and vaccination strategies in humans and animals. Many molecular tools like PCR-RFLP, real-time PCR, multiplex PCR, qPCR and immunocapture PCR have been found useful for rapid and confirmatory detection and differentiation of pathogenic and non-pathogenic leptospires to against all emerging pathogens with success stories. Available vaccines can only provide limited protection, which is short lived. The most commonly used leptospiral vaccines are based on inactivated whole-cell bacterins or leptospiral cell membrane components. These preparations although effective, are associated with several side-effects like pain, irritation and discomfort in addition to limited protection. In addition, the vast majority of the vaccines are for animal use, albeit for few countries that have licensed bacterins for human use (Silveira et al., 2017). As a result, the last few decades have seen research efforts shifting focus to the classical identification of antigens for the development of recombinant vaccines against leptospira. While significant progress have been recorded, the development of a broad-range leptospiral vaccine still remains elusive (Dellagostin et al., 2017). The advanced techniques like recombinant DNA technology, reverse genetics, DNA vaccination, molecular genetics and proteomics approaches are being explored for search of novel antigens, proteins and genes as potential candidates to discover safer, efficient and better vaccines for leptospirosis (Verma et al., 2012). The recent advancements of recombinant outer membrane protein (OMP) vaccines, lipopolysaccharide (LPS) vaccines and DNA vaccines against leptospirosis are also reviewed (Dellagostin et al., 2011). Moreover, a vaccine ontology database was built for the scientists working on the leptospirosis vaccines as a starting tool (Wang et al., 2007). DNA vaccines containing multi-epitope encoded gene have been reported to confer protection against many infectious diseases (Ding et al., 2012; Sela-Culang et al., 2015; Sette, Fikes, 2003). DNA vaccine stimulates antibody production in a similar way as foreign antigens are processed and presented during natural infection. Similarly, multi-epitope DNA vaccines were reported to induce more potent immunoreactions than whole protein vaccines (Zhao et al., 2012). Such vaccines are also able to induce powerful cross-reactive immunological response due to the fact they are derived from multiple antigens packaged into a relatively small chimeric molecule. Moreover, immunity induced by multi-epitope DNA vaccine includes both the humoral and cellular immune component. Hence, they are considered suitable for protection against a wide range of serovars, especially in endemic regions. The construction of such highly complex synthetic vaccine may potentially have higher efficacy than assembly of naturally occurring sequences (Yu et al., 2015). Chemically synthesized genes could produce a significant impact on the immuno-reactivity against diverse leptospiral outer membrane proteins (Rollauer et al., 2015; Wang et al., 2002). Overall, recognition of special clinical symptoms of leptospirosis and determination exactly the target immune factors are important not only to have rapid diagnosis and treating in time but also to reduce risks of fatality by vaccination. MATERIALS AND METHODS Leptospira strains, cultivation, and serogroup identification Among twelve epidemiologically related Leptospira strains collected from human or rats in Leptospira outbreaks in Vietnam, we selected six Leptospira strains that were used to make the inactivated vaccine currently in Vietnam, including L.Pomona_VN, L.Canicola_VN, L.Mitis_VN, L.Ictero haemohagiae_VN, L.Bataviae_VN, and L.Grippotyphosa_VN. Serogroup identification of these leptospiral Journal of Biotechnology 16(4): 745-756, 2018 747 strains was carried out by Microscopic agglutination test (MAT) with 12 international standard serogroup-specific rabbit antisera from the National Center for Veterinary Diagnosis (NCDV), Vietnam. All of the 6 strains were maintained by the NCDV. Leptospires were stored long-term at −70°C and have been passaged every six months. When needed, they were subcultured in 10ml Ellinghausen- McCullough-Johnson- Harris (EMJH) liquid medium at 30oC for 7-10 days to stationary phase and checked for the presence of contaminating aerobic bacteria by overnight culture on 8% (w/v) horse-blood agar at 30 and 37oC (Ellinghausen, McCullough, 1965). Total DNA extraction Genomic DNA was extracted using Phenol:Chlorofrom:Isoamyl (25:24:1) (Sambrook, Russell, 2001) and was diluted to a final concentration of 20 ng/ml. All total DNA samples were quality and quantity checks by electrophoresis of 3µl of each reaction on 1% agarose gel for 30 min at 100V and Nanodrop. Sequence assembly and alignment using 16S rRNA gene sequencing 16S rRNA PCR products (Table 1) were purified with mini spin columns provided in GeneJET™ PCR Purification Kit (Thermo Fisher Scientific) according to the manufacturer’s protocol. The PCR products were sequenced according to dideoxynucleotide chain termination method (Sanger et al., 1977). Sequencing PCR reactions were performed on each template on the automated ABI PRISM 3500 DNA Sequencer (Applied Biosystems) at Institute of Genome Research, Vietnam Academy of Science and Technology, Vietnam. Amplified fragments were set up in 10 µl reaction volumes (2 µl BigDye Terminator v3.1, 1µl BigDye Sequencing buffer, 1 µl primer (10 µM), 2 µl DNA, and 4 µl water). Sequencing was carried out according to the following procedure: denaturation at 96oC for 1 min, and 25 cycles of denaturation at 96oC for 10 s, annealing at 50oC for 5 s, elongation at 60oC for 4 min. Then the samples were purified and incubated with 20 µl Hi-Di, and denatured at 98°C for 2 min. Finally, these samples transferred to plate and sequenced with the sequencer using POP6 and a 36 cm capillary array. The run module conditions were as follows: 22 s for injection time, 1 kV for injection voltage, 15 kV for run voltage, 10 Amps for run current, and 55oC for run temperature. Table 1. Primer pairs used for successful amplification of 16S rRNA sequencing and gene expressions. Gene name Sequences Size (bp) Tm 16S rRNA F GCCTACGGGAGGCAGCAG 550 50oC for 30s R CCGTCAATTCMTTTGAGTTT OmpL1 F TTGATTGAATTCTTAGAGTTCGTGTTTATA 960 56oC for 50s R AAGGAGAAGCTTATGATCCGTAACATAAGT LipL32 F TTACCGCTCGAGGTGCTTTCGGTGGTCTGC 782 50oC for 30s R TGTTAACCCGGGTTACTTAGTCGCGTCAGA LipL41 F AGAGAAGATAATTTTCTCCCCATGGGTAACA 1065 50oC for 50s R GAAAGCAACGCAAAGTAACTCGAGTCCTTT LipL21 F ATGATCAATAGACTTATAGCTC 560 50oC for 60s R TTATTGTTTGGAAACCTCTTGA LigA F CGGTCGACTATCGTTACTCCAGCA 991 50oC for 50s R CGGCGGCCGCAATATCCGTATTAGA LigB F CCGCTCGAGGTGTTTATGAAGAAA 620 50oC for 50s R ACTCTCGAGCGTATTAGAGGAAT Sequencing analysis To explore the genetic diversity and evolutionary relationship between the isolates in Vietnam and other countries, twenty-four accessible Leptospira species reference sequences obtained from GenBank database were added into our analysis (Table 2). The sequences of all the Leptospira strains in this study and the twenty-four representative sequences from GenBank were compared using CLUSTALW multiple alignments and Phylogenetic analysis was conducted with MEGA 6.0. The Vo Thi Bich Thuy et al. 748 Maximum Likelihood method based on Kimura 2- parameter model was constructed using bootstrapping at 1,000 bootstrap replications (Kim et al., 2002). Table 2. Other Leptospira species references from GenBank database. Strains Serovar Accession number (NCBI GenBank) Leptospira interrogans Hardjo-prajitno JQ765630.1 Leptospira interrogans Hardjo-prajitno CP013147.1 Leptospira interrogans Hardjo CP012603.1 Leptospira interrogans Kennewicki FJ154571.1 Leptospira interrogans Pyrogenes DB60 JQ988842.1 Leptospira interrogans Pomona DB37 JQ988858.1 Leptospira interrogans Pomona KR091971.1 Leptospira interrogans Copenhageni NR 074524.1 Leptospira interrogans Copenhageni KR091970.1 Leptospira interrogans Linhai CP006723.1 Leptospira interrogans Grippotyphosa JQ906628.1 Leptospira interrogans Grippotyphosa JQ906625.1 Leptospira interrogans Saxkoebing KR107202.1 Leptospira interrogans Manilae CP011931.1 Leptospira interrogans Canicola KU053945.1 Leptospira interrogans Canicola KR080516.1 Leptospira interrogans Bratislava CP011410.1 Leptospira interrogans Bratislava-DB38 JQ988859.1 Leptospira interrogans Lai NR 074481.1 Leptospira interrogans Australis-DB42 JQ988863.1 Leptospira interrogans Icterohaemorrhagiae -DB69 JQ988845.1 Leptospira interrogans Icterohaemorrhagiae FJ154563.1 Leptospira interrogans Bataviae-DB59 JQ988841.1 Leptospira interrogans Muenchen FJ154565.1 Gene expression Gene expressions were performed based on six genes including the immunoglobulin like proteins A and B (LigA and LigB genes), outer membrane protein (OmpL1 gene), and lipopolysaccharide (LipL32, LipL41, and LipL21 genes). The genes were amplified in PCR fragments generated with specific primer pairs (Table 1). PCR was conducted using the following parameters: an initial denature step at 94°C for 3 min, followed by 30 cycles of 94°C for 30 - 50 s, 50°C - 56°C for 30 - 50 s, 72°C for 40 - 60 s, then 72°C for 7 - 10 min. The PCR products were visualized on 1% TBE agarose gel electrophoresis and ethidium bromide stained to check the gene expressions. In-silico prediction and selection of vaccine epitopes This study used DNA were sequencing from six strains of Leptospira by 454 sequencing system. ExPASy tool (https://web.expasy.org/translate/) was used to translate DNA sequence to protein sequence. Protein sequences suitable to predict epitope were selected by aligning protein sequences on BioEdit software (version 7.2.5) (Hall et al., 2011). Multiple sequence alignment was done for all retrieved sequences using Bioedit software to determine the conserved region so as to predict the only conserved epitopes that might act as a peptide vaccine. In addition, to avoid the epitopes located in the signal peptide region, SignalP 3.0 Server ( was used to predict the signal peptides. The detection of T and B cell epitopes were predicted based on the amino acid sequences of LipL21 and LipL32. Journal of Biotechnology 16(4): 745-756, 2018 749 3D structure prediction I-TASSER Server was used to predict protein 3D structures (Zhang, 2008). The best results were analyzed by ElliPro with default threshold values. ElliPro predicts linear and discontinuous antibody epitopes based on a protein antigen's 3D structure (Ponomarenko et al., 2008). B-cell epitope prediction B-cell epitopes were predicted base on sequence and structure of LipL21 and LipL32 protein. Protein sequence were analyzed by some B-cell prediction methods from IEDB including Bepipred Linear Epitope Prediction 1.0 & 2.0 (Jespersen et al., 2017; Larsen et al., 2006), Chou and Fasman beta turn prediction (Chou, Fasman, 2009), Emini Surface Accessibility Prediction (Emini et al., 1985), Karplus & Schulz Flexibility Prediction (Karplus, Schulz, 1985), Kolaskar & Tongaonkar Antigenicity (Kolaskar, Tongaonkar, 1990) and Parker Hydrophilicity Prediction (Parker et al., 1986) with default window and threshold values. T-cell epitope prediction To predict T-cell epitope linked to mayor histocompatibility complex (MHC) I or MHC II, the IEDB prediction tools were used. This study used MHC I Binding tool with all alleles of human, cow, mouse and pig ( other options set default. For MHC II Binding tool, all alleles of human and mouse were selected ( other options set default. Analyzing distribution of epitopes Predicted epitopes were aligned with protein sequence by Clustal Omega (Sievers et al., 2011). Microsoft Excel base on position of epitopes on protein sequences to analyze distribution of epitopes. RESULTS AND DISCUSSION Phylogenetic relationship between Vietnamese Leptospira strains and other Leptospira strains using 16S rRNA gene sequencing Phylogenetic tree was constructed for the six leptospiral isolates in this study and the twenty-four international pathogenic L. interrogans representative strains obtained from GenBank database (Figure 1). Sequences 16S rRNA gene of Leptospira spp. strains were used for phylogenetic analysis. 16S rRNA sequencing used as a tool for phylogenetic analysis has led to a better understanding of evolution of Leptospira. To investigate the genetic diversity of leptospirosis, a total of six Vietnamese strains and twenty-four international reference strains belonging to serogroup L. interrogans were analyzed using 16S rRNA gene sequencing. The Maximum Likelihood data revealed the phylogenetic relationship between these different pathogenic species in this study and other international pathogenic species. The findings from the phylogenetic tree reveal the relationship and genetic diversity of various serovars of Leptospira interrogans, with their nearest phylogenetic relatives. The results showed that two pathogenic species of L.Pomona_VN and L.Hardjo seem to be more closely (bootstrap: 99%). A weak close genetic relationship of L. Canicola_VN or L. Ictero haemohagiae_VN and the classic L.Canicola, L.Grippotyphosa was also confirmed by using 16S rRNA sequencing in this study (bootstrap: 62%). From the phylogenetic analysis, L.Mitis_VN and L.Grippotyphosa_VN were clustered together and L.Bataviae_VN strain, their sister group, appeared a weak phylogenetic relationship (bootstrap: 62%). The phylogenetic analysis revealed that the genetically diverse strains of serogroup L. interrogans isolates from Vietnam were generally different with those isolated in other countries. The bootstrap percentages quoted are the percentage times a taxa at that node occurred, the percentages are ranging from 62% to 99%, which may indicate that Leptospira may evolve according to different locations and the epidemiology of leptospirosis in Vietnam relative independent from other countries. The genetic relationship of Leptospira species were also confirmed by several previous studies. Rettinger (2012) compared phylogenetic trees through 16S rRNA gene sequences of twenty-eight leptospiral strains, including pathogenic, non-pathogenic and intermediate strains. Statistical analysis of three pathogenic genomospecies revealed peak differences at the species level in this study (Rettinger et al., 2012). Zhang (2015) used the 16S rRNA sequencing and MLST genotyping methods to investigate the genetic diversity of pathogenic Leptospira and understand the changing epidemiological and evolutionary trends of this serogroup in Mainland China. Their data revealed that the major Leptospira species from different countries were distinct and Vo Thi Bich Thuy et al. 750 had great genetic diversity in geographic epidemiology (Wang et al., 2006). Bourhy (2014) was inferred from sequence analysis of the 16S rRNA gene and analyzed the phylogenetic of the genus Leptospira in Mayotte (Indian Ocean). These data were phylogenetically consistent and reflected genetic relatedness among species of these genus Leptospira (Bourhy et al., 2014). Our present study also indicated that 16S rRNA gene sequencing is a useful technique to explore the genetic diversity and molecular epidemiology of leptospirosis on a global and/or historical scale. Moreover, these results provide a blueprint for further phylogenetic research in pathogenic Leptospira strains. Checking for some antigenic genes in Vietnamese pathogenic Leptospira serovars In an effort to find the promising antigenic genes for launching a kind of recombination leptospirosis vaccines in Vietnam, we selected six genes (e.g. LigA, LigB, OmpL1, LipL32, LipL41 and LipL21 genes) and checked gene expression in these Leptospira strains by PCR method. Only three genes (e.g., LipL32, LipL21, and LigA genes) were expressed in all strains and OmpL1 gene occured in four strains (L.Bataviae_VN, L.Canicola_VN, L.Grypothyphosa_VN and L.Mitis_VN), whereas LipL41 and LigB genes did not appear in any Leptospira strains (data not shown) (Figure 2). It has long been expected to find an effective vaccine to prevent leptospirosis through Figure 1. Phylogenetic analysis based on based on 16S rRNA gene for the thirty pathogenic Leptospira strains (twenty-four sequences obtained from the NCBI database). Phylogenetic trees were constructed by Maximum likelihood and Neighbour- joining method. The bootstrap percentages quoted are the percentage times a taxa at that node occurred. The scale bar represents the number of base pairs differences. The arrows (à) indicate Leptospira strains in Vietnam. Journal of Biotechnology 16(4): 745-756, 2018 751 immunization of high risk humans or animals. Although some leptospirosis vaccines have been obtained, the vaccination is relatively unsuccessful and millions of dollars spent (Wang et al., 2007). In Vietnam, mainly using inactivated vaccine in preventing and controlling leptospirosis. However, vaccination with inactivated whole-cell preparations (bacterins) has limited efficacy due to the wide antigenic variation of the pathogen. A intensive efforts towards developing improved recombinant vaccines are ongoing. During the last decade, many reports on the evaluation of recombinant vaccines have been published. Partial success has been obtained with some surface exposed protein antigens. Raja (2013) was surveyed the different types of OMPs of Leptospira and combines all the novel features of OMPs and put forth some views for future research (Raja, Natarajaseenivasan, 2015). Forster (2015) evaluated the N-terminal region of the leptospiral immunoglobulin-like B protein (LigBrep) as a candidate antigen for an effective vaccine against leptospirosis and emphasised the use of the DNA prime protein boost as an important strategy for vaccine development (Forster et al., 2015). Hu (2014) reported several outer membrane protein antigens exist in all the L. interrogans prevailing in China and suggested that predominant T- and B-cell combined epitopes in the outer membrane protein antigens can be used for developing novel universal leptospirosis vaccines (Hu et al., 2014). The research results of Dezhbord (2014) in cloning gene for expression and recombinant OmpL1 as an efficient and conserved antigen were suggested that OmpL1 gene may be a useful vaccine candidate against leptospirosis in Iran region (Dezhbord et al., 2014). Several researchers suggested the purified recombinant LigA protein is the most promising subunit vaccine candidate against leptospirosis reported to date, however, as purified proteins are weak immunogens the use of a potent adjuvant is essential for the success of LigA as a subunit vaccine (Bacelo et al., 2014; Kanagavel et al., 2014). In 2014, Maneewatch and Adisakwattana studied two LipL32-specific mouse monoclonal antibodies (mAbLPF1 and mAbLPF2) and suggested LipL32 recombinant protein as diagnostic and vaccine targets for leptospirosis (Maneewatch et al., 2014). In addition, Ye (2014) was tested and developed four recombinant proteins of Leptospira interrogans, namely, rLipL21, rLoa22, rLipL32, and rLigACon4-8 as antigens for the diagnosis of equine leptospirosis (Ye et al., 2014). Although were not commercialization, the first vaccines were put foundation for efficacy of new generations, which have outstanding developments to coincide the present needs. However, a crucial work on effective recombinant vaccine development and engineered antibodies will hopefully meet to solve the therapeutic challenges (Vedhagiri et al., 2009). Figure 2. Gene expression products of Leptospira strains. Each species labeled as follow: Ba: L.Bataviae_VN; Ca: L. Canicola_VN; Ic: L.Ictero haemohagiae_VN; Gr: L.Grippotyphosa_VN; Mitis: L.Mitis_VN; Pm: L.Pomona_VN; M: Marker DNA 1 Kb (10,000 bp; Thermo) or Marker DNA 100 bp (1,000 bp, Thermo). Vo Thi Bich Thuy et al. 752 Epitope candidates The potential B cell and T cell epitopes were found to be distributed throughout the whole sequence, numerous fragments could be selected as candidates for the design of a vaccine. Nevertheless, it is necessary to define both B cell and T cell epitopes as candidates, to thereby generate a vaccine inducing both humoral and cellular response. Therefore, a more exhaustive analysis was performed to identify regions comprising both types of epitopes. The combined T and B cell epitopes were predicted based on the amino acid sequences of LipL21 and LipL32. The LipL21 and LipL32 translated sequences had 163 and 215 amino acids (aa), respectively. Six sequences for each gene were aligned by multiple sequence alignment using BioEdit software, to obtain the conserved regions. The only one different amino acid at amino acid 114th of LipL32 sequences was detected. Thus one conserved regions for the LipL21 and two conserved regions for 1-113 aa residues (LipL321-113) and 115- 215 aa residues (LipL32115-215) of LipL32 were chosen to predict protein 3D structure and potential epitopes (Figure 3). The results of mapping showed that, all of three conserved peptides had two high levels of mapped epitopes regions. Because, these regions had many candidate epitopes positions, they may show the higher antigenicity than other regions. They were LipL21 residues 2-70 (LipL212-70), LipL2171-119, LipL324-61, LipL3281-133, LipL32115-158, and LipL32164-210. The six peptide has length in range 45 - 69 aa (Figure 4). Previous studies recommended that the application of only one protein as a subunit recombinant vaccine could not successfully prevent leptospirosis since it is not antigenic enough to stimulate the immune system. While, the applying multi-epitope vaccines, which use epitopes of several proteins, were the solution to vaccine antigenicity (Branger et al., 2001; Haake et al., 1999). Several researchers had used in silico approach for identifying and designing of vaccine candidates (Branger et al., 2001; Hasan et al., 2015; Khatoon et al., 2017) and some of them achieved promising clinical trial results (Groot, Rappuoli, 2004). Multi- epitope peptide DNA vaccines are effective against some viruses and they have recently been shown to have potential efficacy against some bacterial diseases including leptospires. Similarly, the fact that the DNA was expressed efficiently invitro is indicative of the fact that the DNA is correspondingly expressed after immunization as observed from the protection rendered. However, incorporating T-cell epitopes may likely improve the potency of the vaccine as Th-1 type immune response has previously been demonstrated in cattle vaccinated with killed L. Hardjo vaccine (Naiman et al., 2001). Overall, the present novel immunogenic multi-epitope DNA vaccine developed by chemical gene synthesis and delivered as a plasmid DNA vaccine may serve as a new candidate target for leptospiral vaccine development. In the present study, we also used bioinformatic Figure 3. 3D structure of the conservative regions in outer membrane lipoproteins LipL21 and LipL32. Using seven different algorithms for B cell and two algorithms for T cell, 95 epitopes from LipL21 peptide, 46 epitopes from LipL321-113 peptide, and 78 epitopes from LipL32115-215 peptide were predicted (Table 3). Candidate peptides were mapped to reference to determine the epitope density per base of each peptide. Journal of Biotechnology 16(4): 745-756, 2018 753 tools to predict candidate epitopes. To stimulate antigen specific B cell and T cell immune response, epitopes were predicted for both B-cell antibody and T-cell MHC (I and II class) (Forouharmehr, Nassiry, 2015; Yousefi et al., 2015). The six peptide LipL212- 70, LipL2171-119, LipL324-61, LipL3281-133, LipL32115- 158, and LipL32164-210 did not only have the high antigenicity but also short enough for recombination. Therefore, with further test, these peptides can be candidates for a new recombinant vaccine for designing a recombinant multi-epitope vaccine against leptospirosis in Vietnam. Figure 4. Antigenic epitope prediction showing potential B and T cell epitopes for LipL21 (A), LipL321-113 (B), and LipL32115- 215 (C). Vo Thi Bich Thuy et al. 754 Table 3. Number of antigenic epitopes in the conservative regions of outer membrane lipoproteins LipL21 and LipL32. Number of epitope LipL21 LipL321-113 LipL32115-215 Tc cell (Cytotoxic T cell) 53 18 45 Th cell (T helper cells) 19 10 19 B cell 23 14 14 CONCLUSION From the initial research results, we suggested that the six Vietnamese L. interrogan strains were differentiated effectively in genetical distance by phylogenetic analysis. Moreover, three genes (LipL32, LipL21, and LigA genes) were expressed in six Vietnamese pathogenic strains of Leptospira. This work identified combined T and B cell immunodominant epitopes in LipL32 and LipL21 of L. interrogans. The identification of these immune dominant epitopes may greatly facilitate the development of novel leptospiral vaccines which may provide protections across different serogroups or serovars. The findings could also contribute to the development of effective cross-protective vaccine strategies for againsting leptospirosis in Vietnam. Acknowledgments: We thank the Institute of Genome Research, Vietnam Academy of Science and Technology for the financial support. REFERENCES Adler B, de la Pena Moctezuma A (2010) Leptospira and leptospirosis. Vet Microbiol 140: 287-96. Agampodi SB, Peacock SJ, Thevanesam V, Nugegoda DB, Smythe L, Thaipadungpanit J, Craig SB, Burns MA, Dohnt M, Boonsilp S, Senaratne T, Kumara A, Palihawadana P, Perera S, Vinetz JM (2011) Leptospirosis outbreak in Sri Lanka in 2008: lessons for assessing the global burden of disease. Am J Trop Med Hyg 85: 471-8. Bacelo KL, Hartwig DD, Seixas FK, Schuch R, Moreira Ada S, Amaral M, Collares T, Vendrusculo CT, McBride AJ, Dellagostin OA (2014) Xanthan gum as an adjuvant in a subunit vaccine preparation against leptospirosis. Biomed Res Int 2014: 636491. Bourhy P, Collet L, Brisse S, Picardeau M (2014) Leptospira mayottensis sp. nov., a pathogenic species of the genus Leptospira isolated from humans. Int J Syst Evol Microbiol 64: 4061-7. Branger C, Sonrier C, Chatrenet B, Klonjkowski B, Ruvoen-Clouet N, Aubert A, Andre-Fontaine G, Eloit M (2001) Identification of the hemolysis-associated protein 1 as a cross-protective immunogen of Leptospira interrogans by adenovirus-mediated vaccination. Infection and immunity 69: 6831-6838. Chou P, Fasman GD (2009) Amino acid sequence. Adv. Enzymol. Relat. Areas molec. Biol 47: 45. Dellagostin OA, Grassmann AA, Hartwig DD, Felix SR, da Silva EF, McBride AJ (2011) Recombinant vaccines against leptospirosis. Hum Vaccin 7: 1215-24. Dellagostin OA, Grassmann AA, Rizzi C, Schuch RA, Jorge S, Oliveira TL, McBride AJ, Hartwig DD (2017) Reverse Vaccinology: An Approach for Identifying Leptospiral Vaccine Candidates. Int J Mol Sci 18: ??? Dezhbord M, Esmaelizad M, Khaki P, Fotohi F, Zarehparvar Moghaddam A (2014) Molecular identification of the ompL1 gene within Leptospira interrogans standard serovars. J Infect Dev Ctries 8: 688-93. Ding J, Qian W, Liu Q, Q. L (2012) Multi-epitope recombinant vaccine induces immunoprotection against mixed infection of Eimeria spp. Parasitology Research 110: 2297-2306. Ellinghausen HC, Jr., McCullough WG (1965) Nutrition of Leptospira Pomona and growth of 13 other Serotypes: A serum-free medium employing oleic albumin complex. Am J Vet Res 26: 39-44. Emini EA, Hughes JV, Perlow D, Boger J (1985) Induction of hepatitis A virus-neutralizing antibody by a virus-specific synthetic peptide. Journal of virology 55: 836-839. Forouharmehr A, Nassiry MR (2015) B and T-cell epitopes prediction of the P40 antigen for developing mycoplasma agalactiae vaccine using Bioinformatic Tools. Genet. Millennium 13: 3954-3961. Forster KM, Hartwig DD, Oliveira TL, Bacelo KL, Schuch R, Amaral MG, Dellagostin OA (2015) DNA prime- protein boost based vaccination with a conserved region of leptospiral immunoglobulin-like A and B proteins enhances protection against leptospirosis. Mem Inst Oswaldo Cruz 110: 989-95. Groot ASD, Rappuoli R (2004) Genome-derived vaccines. Expert review of vaccines 3: 59-76. Journal of Biotechnology 16(4): 745-756, 2018 755 Haake DA, Mazel MK, McCoy AM, Milward F, Chao G, Matsunaga J, Wagar EA (1999) Leptospiral outer membrane proteins OmpL1 and LipL41 exhibit synergistic immunoprotection. Infection and immunity 67: 6572-6582. Hall T, Biosciences I, Carlsbad C (2011) BioEdit: an important software for molecular biology. GERF Bull Biosci 2: 60-61. Hasan MA, Khan MA, Datta A, Mazumder MHH, Hossain MU (2015) A comprehensive immunoinformatics and target site study revealed the corner-stone toward Chikungunya virus treatment. Molecular immunology 65: 189-204. Hu W, Lin X, Yan J (2014) Leptospira and leptospirosis in China. Curr Opin Infect Dis 27: 432-6. Jespersen MC, Peters B, Nielsen M, Marcatili P (2017) BepiPred-2.0: improving sequence-based B-cell epitope prediction using conformational epitopes. Nucleic acids research 45: W24-W29. Kanagavel M, Shanmughapriya S, Anbarasu K, Natarajaseenivasan K (2014) B-cell-specific peptides of leptospira interrogans LigA for diagnosis of patients with acute leptospirosis. Clin Vaccine Immunol 21: 354-9. Karplus P, Schulz G (1985) Prediction of chain flexibility in proteins. Naturwissenschaften 72: 212-213. Khatoon N, Pandey RK, Prajapati VK (2017) Exploring Leishmania secretory proteins to design B and T cell multi-epitope subunit vaccine using immunoinformatics approach. Scientific Reports 7: 8285. Kim KI, Lee JH, Li K, Zhang YP, Lee SS, Gongora J, Moran C (2002) Phylogenetic relationships of Asian and European pig breeds determined by mitochondrial DNA D-loop sequence polymorphism. Anim. Genet. 33: 19-25. Kolaskar A, Tongaonkar PC (1990) A semi-empirical method for prediction of antigenic determinants on protein antigens. FEBS letters 276: 172-174. Larsen JEP, Lund O, Nielsen M (2006) Improved method for predicting linear B-cell epitopes. Immunome research 2: 2. Levett PN (2001) Leptospirosis. Clin Microbiol Rev 14: 296-326. Maneewatch S, Adisakwattana P, Chaisri U, Saengjaruk P, Srimanote P, Thanongsaksrikul J, Sakolvaree Y, Poungpan P, Chaicumpa W (2014) Therapeutic epitopes of Leptospira LipL32 protein and their characteristics. Protein Eng Des Sel 27: 135-44. Naiman BM, Alt D, Bolin CA, Zuerner R, Baldwin CL (2001) Protective killed Leptospira borgpetersenii vaccine induces potent Th1 immunity comprising responses by CD4 and gammadelta T lymphocytes. Infect Immun 69: 7550-8. Parker J, Guo D, Hodges R (1986) New hydrophilicity scale derived from high-performance liquid chromatography peptide retention data: correlation of predicted surface residues with antigenicity and X-ray- derived accessible sites. Biochemistry 25: 5425-5432. Ponomarenko J, Bui H-H, Li W, Fusseder N, Bourne PE, Sette A, Peters B (2008) ElliPro: a new structure-based tool for the prediction of antibody epitopes. BMC bioinformatics 9: 514. Raja V, Natarajaseenivasan K (2015) Pathogenic, diagnostic and vaccine potential of leptospiral outer membrane proteins (OMPs). Crit Rev Microbiol 41: 1-17. Rettinger A, Krupka I, Grunwald K, Dyachenko V, Fingerle V, Konrad R, Raschel H, Busch U, Sing A, Straubinger RK, Huber I (2012) Leptospira spp. strain identification by MALDI TOF MS is an equivalent tool to 16S rRNA gene sequencing and multi locus sequence typing (MLST). BMC Microbiol 12: 185. Rollauer SE, Sooreshjani MA, Noinaj N, Buchanan SK (2015) Outer membrane protein biogenesis in Gram- negative bacteria. Philos Trans R Soc Lond B Biol Sci 370: Sambrook J, Russell DW (2001) Molecular Cloning: A Laboratory Manual. 3rd Ed., UK: Coldspring-Harbour Laboratory Press; Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. U.S.A. 74: 5463-5467. Sela-Culang I, Ashkenazi S, Peters B, Ofran Y (2015) PEASE: predicting B-cell epitopes utilizing antibody sequence. Bioinformatics 31: 1313-5. Sette A, Fikes J (2003) Epitope-based vaccines: an update on epitope identification, vaccine design and delivery. Current Opinion in Immunology 15: 461-470. Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H, Remmert M, Söding J (2011) Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Molecular systems biology 7: 539. Silveira MM, Oliveira TL, Schuch RA, McBride AJA, Dellagostin OA, Hartwig DD (2017) DNA vaccines against leptospirosis: A literature review. Vaccine 35: 5559-5567. Slack A (2010) Leptospirosis. Aust Fam Physician 39: 495-8. Vanasco NB, Schmeling MF, Lottersberger J, Costa F, Ko AI, Tarabla HD (2008) Clinical characteristics and risk factors of human leptospirosis in Argentina (1999-2005). Acta Trop 107: 255-8. Vedhagiri K, Natarajaseenivasan K, Chellapandi P, Prabhakaran SG, Selvin J, Sharma S, Vijayachari P (2009) Evolutionary implication of outer membrane lipoprotein- Vo Thi Bich Thuy et al. 756 encoding genes ompL1, UpL32 and lipL41 of pathogenic Leptospira species. Genomics Proteomics Bioinformatics 7: 96-106. Verma AK, Kumar A, Dhama K, Deb R, Rahal A, Mahima, Chakraborty S (2012) Leptospirosis-persistence of a dilemma: an overview with particular emphasis on trends and recent advances in vaccines and vaccination strategies. Pak J Biol Sci 15: 954-63. Wang M, Dai B, You Z, Fang Z, Wang Y (2002) Construction of DNA vaccine including a chimeric gene encoding flagellin and outer membrane protein antigen from Leptospira interrogons serovar lai. Hua Xi Yi Ke Da Xue Xue Bao 33: 169-71. Wang Z, Jin L, Wegrzyn A (2007) Leptospirosis vaccines. Microb Cell Fact 6: 39. Wang Z, Yuan Z, Xiang L, Shao J, Wegrzyn G (2006) tRNA-dependent cleavage of the ColE1 plasmid-encoded RNA I. Microbiology 152: 3467-76. Ye C, Yan W, McDonough PL, McDonough SP, Mohamed H, Divers TJ, Chang YF, Yang Z (2014) Serodiagnosis of equine leptospirosis by enzyme-linked immunosorbent assay using four recombinant protein markers. Clin Vaccine Immunol 21: 478-83. Yousefi S, Tahmoorespur M, Sekhavati MH (2015) B and T-cell epitope prediction of the OMP25 antigen for developing Brucella melitensis vaccines for sheep. Iranian Journal of Applied Animal Science 5: Yu K, Liu C, Kim BG, Lee DY (2015) Synthetic fusion protein design and applications. Biotechnol Adv 33: 155- 164. Zhang Y (2008) I-TASSER server for protein 3D structure prediction. BMC bioinformatics 9: 40. Zhao C, Sun Y, Zhao Y, Wang S, Yu T, Du F, Yang XF, Luo E (2012) Immunogenicity of a multi-epitope DNA vaccine against hantavirus. Hum Vaccin Immunother 8: 208-15. PHÂN TÍCH TRÌNH TỰ GEN 16S rRNA TỪ CÁC CHỦNG LEPTOSPIRA GÂY BỆNH CỦA VIỆT NAM VÀ DỰ ĐOÁN IN-SILICO CÁC EPITOPE TIỀM NĂNG TRÊN HAI LIPOPROTEIN MÀNG NGOÀI LIPL21, LIPL32 Võ Thị Bích Thuỷ1,2, Nguyễn Tuấn Hùng2,3, Nghiêm Ngọc Minh2 1Viện Nghiên cứu hệ gen, Viện Hàn lâm Khoa học và Công nghệ Việt Nam 2Học viện Khoa học và Công nghệ, Viện Hàn lâm Khoa học và Công nghệ Việt Nam 3Công ty Cổ phần Thuốc Thú y Trung ương VETVACO, Đức Thượng, Hoài Đức, Hà Nội TÓM TẮT Bệnh xoắn khuẩn (Leptospirosis) được xác định là một bệnh truyền nhiễm mới nổi, có khả năng gây bệnh trên động vật và lây lan sang người. Bệnh do Leptospira gây ra. Mặc dù đã có một số loại vacxin phòng bệnh do Leptospira nhưng đáp ứng miễn dịch không cao, thời gian bảo hộ không dài. Trong thí nghiệm này, một đoạn 550 bp của gen RNA ribosome (16S rRNA) của 6 chủng Leptospira gây bệnh xoắn khuẩn và đang được sử dụng làm chủng chế vacxin vô hoạt ở Việt Nam (bao gồm: Pomona, Canicola, Mitis, Ictero haemohagiae, Bataviae, và Grippotyphosa) đã được giải trình tự. Kết quả cho thấy một mối quan hệ di truyền gần gũi của chủng L.Pomona_VN với L.Hardjo (bootstrap: 99%). Ngược lại, L.Canicola_VN và L.Ictero haemohagiae_VN dường như có mối quan hệ di truyền yếu với các chủng cổ điển L.Canicola, L. Grippotyphosa (bootstrap: 62%). Các chủng khác như L.Mitis_VN và L.Grippotyphosa_VN xuất hiện cùng nhánh, nhưng lại có mối quan hệ di truyền yếu với nhóm chị em của chúng là chủng L.Bataviae_VN (bootstrap: 62%). Chúng tôi cũng lựa chọn 6 gen, gồm: các globulin miễn dịch như protein A và B (gen LigA và LigB), protein màng ngoài (gen OmpL1), và lipopolysaccharide (gen LipL32, LipL41 và LipL21) để kiểm tra sự xuất hiện của các gen này ở các chủng Leptospira trên bằng phương pháp phản ứng chuỗi polymerase (PCR). Có 3 gen (gen LipL32, LipL21 và LigA) xuất hiện trong tất cả các chủng, riêng gen OmpL1 chỉ có ở 4 chủng (Bataviae, Canicola, Grypothyphosa và Mitis), trong khi đó gen LipL41 và LigB đã không xuất hiện trong bất kỳ chủng Leptospira nào. Một tập hợp các epitope tiềm năng trong cả tế bào lympho T và B của protein LipL21 và LipL32 đã được tìm kiếm bằng các công cụ tin sinh. Kết quả chỉ ra, có 3 vùng đa epitope (1 vùng và 95 epitope kháng nguyên cho cả hai tế bào B và T của LipL21; 2 vùng và 124 epitope kháng nguyên cho cả hai tế bào B và T của LipL32). Cần nghiên cứu sâu hơn về sinh học phân tử để tạo ra được một loại vac xin tái tổ hợp mới ứng dụng trong phòng và điều trị bệnh leptospirosis cho động vật và người ở Việt Nam. Từ khóa: Gen quyết định kháng nguyên, Loài Leptospira, Vacxin tái tổ hợp leptospirosis, Trình tự gen 16S rRNA

Các file đính kèm theo tài liệu này:

  • pdfphan_tich_trinh_tu_gen_16s_rrna_tu_cac_chung_leptospira_gay.pdf
Tài liệu liên quan