Successful expression of the DsRed fluorescent
reporter gene in P. digitatum using the phleomycin
resistance marker
We cultivated all five transgenic strains together with
the wild strain PdVN1 directly on the sterile microscopic
slides containing droplets of the PDA medium. After 3
days of incubation at 25oC, the slides were checked under
the fluorescence microscope using the filter set with the
excitation/emission of 558/583 nm for detection of the
DsRed signal. The results showed that the expression of
the DsRed reporter gene in all five strains was very strong
and the red fluorescent signal was observed in both fungal
hyphae and spores (Fig. 4).
The random integration of T-DNA from a binary vector
into fungal genome could create insertion mutants, which
resulted in a large collection of the mutants for further
identifications of potential genes involved in metabolism,
differentiation and pathogenicity in fungi [9, 10, 14].
Therefore, the transfer of the T-DNA structure containing
the phleomycin resistance marker from the binary vector
pPK2-Red2 into the citrus postharvest pathogen P. digitatum
PdVN1 may be a good approach for the construction of
insertion mutant libraries. Furthermore, the DsRed reporter
gene in the binary vector can also be replaced with a gene of
interest for overexpression in this pathogenic fungus.
Conclusions
In this study, we have successfully employed the
phleomycin resistance gene as a reliable selection marker for
the genetic transformation of the citrus postharvest pathogen
P. digitatum using the bacterium A. tumefaciens. The
transformation efficiency of P. digitatum PdVN1 under the
optimized conditions could reach over 1000 transformants
per 106 spores. The transformants could maintain the ability
for phleomycin resistance after several mitotic generations.
We further succeeded in heterologous expression of the
DsRed reporter gene in P. digitatum using a binary vector
carrying the phleomycin resistance marker. This selection
marker in combination with the optimized ATMT method
for P. digitatum can be exploited for gene targeting or for
the generation of insertion mutants by T-DNA integration
events for screening the potential genes required for fungal
pathogenicity on citrus.
6 trang |
Chia sẻ: hachi492 | Lượt xem: 49 | Lượt tải: 0Free
Bạn đang xem nội dung tài liệu Phleomycin resistance gene as a reliable selection marker for Agrobacterium tumefaciens-Mediated transformation of the citrus postharvest pathogen Penicillium digitatum, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Life ScienceS | Biotechnology
Vietnam Journal of Science,
Technology and Engineering 83june 2020 • Volume 62 number 2
Introduction
Penicillium digitatum causes green mould disease on
citrus fruits and has been reported to be the most destructive
pathogen during the postharvest stages. This pathogen can
infect fruits through wounded points on the citrus peel prior
to the colonization of the whole fruits for severe decay. P.
digitatum grows on an infected citrus peel and can be seen
as white mycelium, which later turns olive colour due to
fungal sporulation [1-3]. The molecular mechanism of citrus
infection by P. digitatum is still unclarified. Up to date, only
a few genes required for pathogenicity of P. digitatum have
been characterized [4-6]. The development of new genetic
tools with reliable selection markers is essential and can
help to dissect more about the infection process of this
pathogenic fungus.
Agrobacterium tumefaciens is a soil-borne bacterium,
which has the capability of transferring the T-DNA from
the tumour-inducing (Ti) plasmid into plants and fungi [7].
The Agrobacterium tumefaciens-mediated transformation
(ATMT) was reported for the first time in filamentous
fungi by de Groot, et al. in 1998 [8]. At the time, this
transformation method became popular and useful for
fungal research community. Currently, the ATMT methods
have been demonstrated to be highly efficient for genetic
transformation of a large number of filamentous fungi
[8-10]. ATMT represents a simple method for genetic
Phleomycin resistance gene as a reliable selection marker
for Agrobacterium tumefaciens-mediated transformation
of the citrus postharvest pathogen Penicillium digitatum
Van-Tuan Tran1, 2*, Tao Xuan Vu2, 3
1Faculty of Biology, University of Science, Vietnam National University, Hanoi
2National Key Laboratory of Enzyme and Protein Technology, University of Science, Vietnam National University
3Center of Experimental Biology, National Center for Technological Progress, Ministry of Science and Technology of Vietnam
Received 15 April 2020; accepted 2 June 2020
*Corresponding author: Email: tuantran@vnu.edu.vn
Abstract:
Penicillium digitatum exists in nature as a causative agent of green mould disease in citrus fruits at the postharvest
stages. Inspections of the molecular mechanism of the host invasion by P. digitatum usually require suitable
selection markers for genetic manipulation. In this study, we recruited the phleomycin resistance gene as a
selection marker for the genetic transformation of P. digitatum using Agrobacterium tumefaciens. The results
showed that the growth of the wild strain P. digitatum PdVN1 from fungal spores is quite sensitive to phleomycin
and is inhibited at a concentration of 50 µg/ml, whereas growth from fungal mycelium is more tolerant and
completely suppressed at a concentration of 200 µg/ml. Under optimised conditions, the A. tumefaciens-mediated
transformation (ATMT) efficiency of P. digitatum with the phleomycin resistance marker could reach over 1000
transformants per 106 spores. All the tested transformants presented the integration of T-DNA in their genomes
and were mitotically stable for the phleomycin resistance. Furthermore, the results also revealed the success for
heterologous expression of the DsRed fluorescent gene in the fungus, in which the strong red fluorescent signal
could be observed over the whole fungal mycelium and spores. Our work demonstrates for the first time that the
phleomycin resistance gene can serve as a reliable selection marker for A. tumefaciens-mediated transformation of
the postharvest pathogen P. digitatum. This selection marker can be exploited for T-DNA insertional mutagenesis
and for functional investigations of target genes involved in citrus decay by P. digitatum.
Keywords: Agrobacterium-mediated transformation, citrus postharvest pathogen, DsRed fluorescent reporter gene,
Penicillium digitatum, phleomycin resistance marker.
Classification number: 3.5
DoI: 10.31276/VJSTE.62(2).83-88
Life ScienceS | Biotechnology
Vietnam Journal of Science,
Technology and Engineering84 june 2020 • Volume 62 number 2
transformation with high efficiency and fungal spores can
be used directly as the transformation material [10, 11].
The common antifungal agents, including hygromycin,
nourseothricin, and phleomycin, have been broadly
exploited for genetic transformation of filamentous fungi
[3, 8, 10-12]. Although phleomycin was employed for the
transformation of different fungi and plants [13-16], so far
it has not been tested on the citrus postharvest pathogen P.
digitatum. Recently, ATMT has been demonstrated to be
an effective transformation method in P. digitatum using
two dominant selection markers conferring the resistance
to hygromycin and nourseothricin. The ATMT efficiencies
with these two selection markers reached the yields of
60-1240 transformants for 106 spores depending on the
examined strains of P. digitatum [3, 17]. In addition, the
DsRed fluorescent gene originated from the reef coral
Discosoma sp. has been commonly used as a model reporter
gene for genetic transformation of numerous filamentous
fungi including P. digitatum [3, 11, 18-21]. In this study,
we report for the first time that the phleomycin resistance
gene can be employed as a selectable marker for genetic
transformation of P. digitatum using A. tumefaciens. our
work shows that the transformation efficiency with the
phleomycin resistance marker could achieve over 1000
transformants for 106 spores.
Materials and methods
Microbial strains and cultivation media
Escherichia coli DH5α and Agrobacterium tumefaciens
AGL1 were used for plasmid propagation and fungal
transformation, respectively. These bacteria were grown
in Luria-Bertani medium. The fungal strain P. digitatum
PdVN1, isolated in Vietnam [3], was grown on the potato
dextrose agar (PDA) medium.
Preparation of fungal spore suspensions
The wild strain P. digitatum PdVN1 and transgenic
strains were grown on the PDA plates at 25°C for 4-5 days.
Fungal spores were collected as mentioned earlier [3]. The
spore suspensions were adjusted to the concentration of
106 spores/ml for later use. The spore concentration was
monitored with a hemocytometer under microscopy.
Extraction of fungal genomic DNA
Fungal strains were grown in the potato dextrose broth
(PDB) medium at the temperature of 25°C at 200 rpm for
3 days and fungal mycelia from the cultures were collected
by filtration through Miracloth (Calbiochem, Darmstadt,
Germany). Genomic DNA was extracted from the fungal
biomass as previously described [22].
Examination of the susceptibility of P. digitatum to
phleomycin
A PDA agar plug with the diameter of 4 mm
containing fungal mycelium or 10 μl of spore suspension
(106 spores/ml) of the wild strain PdVN1 was placed on the
PDA medium supplemented with phleomycin (50-200 μg/ml).
The plates were incubated at a temperature of 25°C for 3-4
days to examine growth of the fungus.
PCR amplification
PCR amplifications of the phleomycin resistance
marker and the DsRed reporter gene were performed with
specific primer pairs (Table 1). GoTaq® Green Master Mix
(Promega, Madison, USA) was used for PCR screening.
PCR procedure includes 94°C (3 min); 30 cycles of 94°C
(30 s), 58-60°C (30 s), 72°C (1-2 min); 72°C (7 min). PCR
products were analysed on 0.7% agarose gels.
Table 1. The primers used in this study.
Primer name Sequence (5’-3’) Product
size (bp)
Source
DsRed-F AACTCGAGCACGTGCTTA
AGGATATCATGGCCTCCT
CCGAGG
729 [19]
DsRed-R AAGGATCCCCGCGGGAG
CTCGATATCCTACAGGAACA
GGTGGTGGC
Phleo-F GGGCTCGAGAGGCCTCCG
GTGACTCTTTCTGGC
1250 [11]
Phleo-R TCGGTCAGTCCTGCTCCT
Agrobacterium tumefaciens-mediated transformation
of P. digitatum
The binary vector pPK2-Red2 was transformed into the
bacterium A. tumefaciens AGL1 by electroporation using
the Gene Pulse Xcell™ Electroporation System (Bio-Rad,
California, USA). A. tumefaciens AGL1 carrying the binary
vector was used for genetic transformation of P. digitatum
as previously described [3]. PDA plates supplemented
with phleomycin (200 μg/ml) and cefotaxime (300 μg/ml)
were used for selection of fungal transformants and for
suppression of the A. tumefaciens cells, respectively. The
plates were kept at the temperature of 25°C for 4-5 days to
collect transformants.
Life ScienceS | Biotechnology
Vietnam Journal of Science,
Technology and Engineering 85june 2020 • Volume 62 number 2
Examination of transgenic strains
Fungal transformants as transgenic strains were cultivated
on PDA containing phleomycin at the concentration of
200 µg/ml to confirm the ability of phleomycin resistance.
Afterwards, these transformants were examined for mitotic
stability with several mitotic generations on PDA. The
transformants were then grown in PDB for 3 days at 25oC and
their mycelia were collected for genomic DNA extraction.
T-DNA integrations into the genome of the pathogenic
fungus were verified by PCR with two independent primer
pairs listed in Table 1. The selected transformants were
grown directly on microscopic slides containing droplets of
PDA as reported by Vu, et al. (2018) [3] and the expression
of the DsRed fluorescent gene in these transformants was
analysed under Axioplan fluorescence microscope (Carl
Zeiss, Jena, Germany).
Results and discussion
Penicillium digitatum PdVN1 is highly susceptible to
phleomycin
We examined the susceptibility of the wild strain P.
digitatum PdVN1 to phleomycin by growing the fungus
on the medium containing this antifungal agent at different
concentrations. The results showed that fungal spores were
more susceptible and totally suppressed by phleomycin at a
concentration of 200 µg/ml. In contrast, fungal mycelium
was more resistant to low concentrations of this agent. At a
concentration of 200 µg/ml, phleomycin could completely
inhibit growth of the fungus with both the inoculation
materials as spores and mycelium (Fig. 1A). Therefore, this
concentration of phleomycin was used for transformation
of P. digitatum PdVN1 in order to inhibit the growth
of untransformed fungal cells. For transformation of P.
digitatum, the binary vector pPK2-Red2 was employed.
This vector contains a transfer DNA (T-DNA) region,
which harbours two different cassettes for expression of
the phleomycin resistance gene and the DsRed gene under
the regulation of the constitutive gpdA promoter from the
model filamentous fungus Aspergillus nidulans (Fig. 1B).
Recently, pPK2-Red2 has also been successfully exploited
for genetic transformation of the penicillin-producing
fungus Penicillium chrysogenum using phleomycin as the
selection agent [11].
Fig. 1. The susceptibility of P. digitatum PdVN1 to phleomycin
and the map of the binary vector pPK2-Red2. (A) The wild
strain PdVn1 (mycelium, spores) was grown on the PDA medium
supplemented with different concentrations of phleomycin (50-
200 µg/ml). (B) The map of the binary vector pPK2-red2 showing
the T-DnA structure containing the expression cassettes for the
phleomycin resistance gene (phleoR) and the DsRed fluorescent
reporter gene. This T-DnA region is restricted by the left border
(lb) and right border (rb).
Phleomycin resistance gene represents a reliable
selection marker for transformation of the citrus
postharvest pathogen P. digitatum
In this study, we employed the binary vector pPK2-Red2
[11] for evaluating the genetic transformation of P. digitatum
PdVN1. This vector harbours the phleomycin resistance
marker, in which the Sh ble gene conferring phleomycin
resistance is regulated by the constitutive gpdA promoter
from the filamentous fungus A. nidulans (Fig. 1B). The Sh ble
gene isolated from Streptoalloteichus hindustanus encodes
a protein binding to phleomycin and subsequently inhibits
its DNA cleavage activity [14, 16]. our results showed
that the ATMT method using the phleomycin resistance
marker is efficient for genetic transformation of P. digitatum
PdVN1. With the transformation conditions optimized for
the ATMT including a temperature of 25oC, time of 72 h for
the co-cultivation step, acetosyringone (AS) concentration
of 200 µM for induction, and spore concentration of 106
spores/ml, the efficiency for transformation of P. digitatum
PdVN1 could reach over 1000 transformants per 106 spores
(Fig. 2). The transformation efficiency with the phleomycin
resistance marker in this study is similar to the ones with
two other selection markers conferring the resistance to
hygromycin and nourseothricin (approximately 1240
transformants per 106 spores) that we previously reported
for the ATMT method in P. digitatum [3].
Life ScienceS | Biotechnology
Vietnam Journal of Science,
Technology and Engineering86 june 2020 • Volume 62 number 2
The transgenic strains are mitotically stable for
maintaining the T-DNA structure
Five transformants as transgenic strains named Pd-R1,
Pd-R2, Pd-R3, Pd-R4, and Pd-R5 were randomly selected
and cultivated on the PDA medium containing phleomycin.
The young mycelia of these strains were cut and transferred
to new plates containing the PDA medium without
phleomycin for three successive mitotic generations prior
to re-growing on the PDA medium supplemented with the
selection agent as phleomycin. our results indicated that
all five tested transformants still grew well on the selection
medium supplemented with phleomycin in comparison to
the wild strain PdVN1 (WT), which was not able to survive
on this medium (Fig. 3A). These transgenic strains were
then analysed by PCR with two different primer pairs, which
amplify specifically the phleomycin resistance cassette
and the DsRed fluorescent gene (Table 1). The results
showed that the T-DNA structure carrying the cassettes
for expression of the Sh ble gene conferring phleomycin
resistance and the DsRed reporter gene was integrated in
the genomes of all five strains (Fig. 3B). Interestingly, these
results were also similar to the transformation data obtained
from P. chrysogenum when the binary vector pPK2-Red2
and phleomycin as the selection agent were used for genetic
transformation of this penicillin-producing fungus [11].
In fact, the mitotic stability of T-DNA structures in fungal
genomes had been reported in several filamentous fungi [7-
9, 19].
Fig. 2. The optimized procedure for A. tumefaciens-mediated transformation of P. digitatum PdVN1 using the phleomycin
resistance marker. The induced Agrobacterium cells containing the binary vector pPK2-red2 were mixed with fungal spores for co-
cultivation on the cellulose membrane covered on the induction medium (Im). This step promoted the transfer of T-DnA fragment
from Agrobacterium into the fungal genome. The membrane was then shifted to the PDA medium supplemented with a suitable
concentration of phleomycin for selection of transformants.
Life ScienceS | Biotechnology
Vietnam Journal of Science,
Technology and Engineering 87june 2020 • Volume 62 number 2
Fig. 3. Confirmation of the phleomycin resistant transformants.
(A) Five randomly selected transformants (Pd-r1, Pd-r2, Pd-
r3, Pd-r4, Pd-r5) were grown simultaneously on PDA and
PDA containing 200 µg/ml of phleomycin (PDA+phleo). The
P. digitatum PdVn1 strain (WT) was used as reference control.
(B) The examined transformants were verified by PCr using the
primer pair amplifying the phleomycin resistance marker or
the DsRed fluorescent reporter gene. Total DnA isolated from
P. digitatum PdVn1 (WT) and the purified plasmid pPK2-red2
were used as DnA templates for controls, respectively.
Successful expression of the DsRed fluorescent
reporter gene in P. digitatum using the phleomycin
resistance marker
We cultivated all five transgenic strains together with
the wild strain PdVN1 directly on the sterile microscopic
slides containing droplets of the PDA medium. After 3
days of incubation at 25oC, the slides were checked under
the fluorescence microscope using the filter set with the
excitation/emission of 558/583 nm for detection of the
DsRed signal. The results showed that the expression of
the DsRed reporter gene in all five strains was very strong
and the red fluorescent signal was observed in both fungal
hyphae and spores (Fig. 4).
The random integration of T-DNA from a binary vector
into fungal genome could create insertion mutants, which
resulted in a large collection of the mutants for further
identifications of potential genes involved in metabolism,
differentiation and pathogenicity in fungi [9, 10, 14].
Therefore, the transfer of the T-DNA structure containing
the phleomycin resistance marker from the binary vector
pPK2-Red2 into the citrus postharvest pathogen P. digitatum
PdVN1 may be a good approach for the construction of
insertion mutant libraries. Furthermore, the DsRed reporter
gene in the binary vector can also be replaced with a gene of
interest for overexpression in this pathogenic fungus.
Fig. 4. Examination of the DsRed expression in the transgenic
strains. All five transgenic strains (Pd-r1 to Pd-r5) generated
from the wild strain Penicillium digitatum PdVn1 were grown
directly on microscopic slides containing the PDA medium.
Fungal mycelia were observed under the Axioplan fluorescence
microscope. The scale bars indicate the same sizes of the images.
Conclusions
In this study, we have successfully employed the
phleomycin resistance gene as a reliable selection marker for
the genetic transformation of the citrus postharvest pathogen
P. digitatum using the bacterium A. tumefaciens. The
transformation efficiency of P. digitatum PdVN1 under the
optimized conditions could reach over 1000 transformants
per 106 spores. The transformants could maintain the ability
for phleomycin resistance after several mitotic generations.
We further succeeded in heterologous expression of the
DsRed reporter gene in P. digitatum using a binary vector
carrying the phleomycin resistance marker. This selection
marker in combination with the optimized ATMT method
for P. digitatum can be exploited for gene targeting or for
the generation of insertion mutants by T-DNA integration
events for screening the potential genes required for fungal
pathogenicity on citrus.
Life ScienceS | Biotechnology
Vietnam Journal of Science,
Technology and Engineering88 june 2020 • Volume 62 number 2
ACKNOWLEDGEMENTS
This research is funded by Vietnam National Foundation
for Science and Technology Development (NAFoSTED)
under grant number 106.04-2018.36.
The authors declare that there is no conflict of interest
regarding the publication of this article.
REFERENCES
[1] M. Lopez-Perez, A.R. Ballester, L. Gonzalez-Candelas (2015),
“Identification and functional analysis of Penicillium digitatum genes
putatively involved in virulence towards citrus fruit”, Mol. Plant
Pathol., 16(3), pp.262-275.
[2] M. Marcet-Houben, A.R. Ballester, B. de la Fuente, E. Harries,
J.F. Marcos, L. Gonzalez-Candelas, T. Gabaldon (2012), “Genome
sequence of the necrotrophic fungus Penicillium digitatum, the main
postharvest pathogen of citrus”, BMC Genomics, 13(1), pp.646-662.
[3] T.X. Vu, T.T. Ngo, L.T.D. Mai, T.T. Bui, D.H. Le, H.T.V.
Bui, H.Q. Nguyen, B.X. Ngo, V.T. Tran (2018), “A highly efficient
Agrobacterium tumefaciens-mediated transformation system for the
postharvest pathogen Penicillium digitatum using DsRed and GFP
to visualize citrus host colonization”, J. Microbiol. Methods, 144,
pp.134-144.
[4] J.H. Costa, J.M. Bazioli, J.G. de Moraes Pontes, T.P. Fill
(2019), “Penicillium digitatum infection mechanisms in citrus: What
do we know so far?”, Fungal Biol., 123(8), pp.584-593.
[5] M. Wang, X. Sun, C. Zhu, Q. Xu, R. Ruan, D. Yu, H. Li (2015),
“PdbrlA, PdabaA and PdwetA control distinct stages of conidiogenesis
in Penicillium digitatum”, Res. Microbiol., 166(1), pp.56-65.
[6] L. Vilanova, N. Teixido, R. Torres, J. Usall, I. Vinas, P.
Sanchez-Torres (2016), “Relevance of the transcription factor PdSte12
in Penicillium digitatum conidiation and virulence during citrus fruit
infection”, Int. J. Food Microbiol., 235, pp.93-102.
[7] D. Li, Y. Tang, J. Lin, W. Cai (2017), “Methods for genetic
transformation of filamentous fungi”, Microb. Cell Fact., 16(1),
pp.168-180.
[8] M.J. de Groot, P. Bundock, P.J. Hooykaas, A.G. Beijersbergen
(1998), “Agrobacterium tumefaciens-mediated transformation of
filamentous fungi”, Nat. Biotechnol., 16(9), pp.839-842.
[9] A. Idnurm, A.M. Bailey, T.C. Cairns, C.E. Elliott, G.D. Foster,
G. Ianiri, J. Jeon (2017), “A silver bullet in a golden age of functional
genomics: the impact of Agrobacterium-mediated transformation of
fungi”, Fungal Biol. Biotechnol., 4(1), pp.6-33.
[10] C.B. Michielse, P.J. Hooykaas, C.A. van den Hondel, A.F.
Ram (2005), “Agrobacterium-mediated transformation as a tool for
functional genomics in fungi”, Curr. Genet., 48(1), pp.1-17.
[11] T.X. Vu, H.H. Vu, G.T. Nguyen, H.T. Vu, L.T.D. Mai,
D.N. Pham, D.H. Le, H.Q. Nguyen, V.T. Tran (2019), “A newly
constructed Agrobacterium-mediated transformation system revealed
the influence of nitrogen sources on the function of the LaeA regulator
in Penicillium chrysogenum”, Fungal Biol., 123(11), pp.830-842.
[12] E.D. Mullins, X. Chen, P. Romaine, R. Raina, D.M. Geiser, S.
Kang (2001), “Agrobacterium-mediated transformation of Fusarium
oxysporum: an efficient tool for insertional mutagenesis and gene
transfer”, Phytopathology, 91(2), pp.173-180.
[13] Z.-M. He, M.S. Price, G.R. obrian, D.R. Georgianna, G.A.
Payne (2007), “Improved protocols for functional analysis in the
pathogenic fungus Aspergillus flavus”, BMC Microbiol., 7(1), pp.104-
114.
[14] A. Gatignol, M. Baron, G. Tiraby (1987), “Phleomycin
resistance encoded by the ble gene from transposon Tn 5 as a
dominant selectable marker in Saccharomyces cerevisiae”, Mol. Gen.
Genet., 207(2-3), pp.342-348.
[15] I.E. Mattern, P.J. Punt, C.A.M.J.J. Van den Hondel (1988),
“A vector for Aspergillus transformation conferring phleomycin
resistance”, Fungal Genet. Rep., 35(1), pp.25-27.
[16] P. Perez, G. Tiraby, J. Kallerhoff, J. Perret (1989),
“Phleomycin resistance as a dominant selectable marker for plant cell
transformation”, Plant Mol. Biol., 13(4), pp.365-373.
[17] J.-y. Wang, H.-y. Li (2008), “Agrobacterium tumefaciens-
mediated genetic transformation of the phytopathogenic fungus
Penicillium digitatum”, J. Zhejiang Univ. Sci. B, 9(10), pp.823-828.
[18] L. Mikkelsen, S. Sarrocco, M. Lubeck, D.F. Jensen
(2003), “Expression of the red fluorescent protein DsRed-Express
in filamentous ascomycete fungi”, FEMS Microbiol. Lett., 223(1),
pp.135-139.
[19] K.T. Nguyen, Q.N. Ho, T.H. Pham, T.-N. Phan, V.-T.
Tran (2016), “The construction and use of versatile binary vectors
carrying pyrG auxotrophic marker and fluorescent reporter genes
for Agrobacterium-mediated transformation of Aspergillus oryzae”,
World J. Microbiol. Biotechnol., 32(12), pp.204-212.
[20] M.N. Islam, S. Nizam, P.K. Verma (2012), “A highly efficient
Agrobacterium mediated transformation system for chickpea wilt
pathogen Fusarium oxysporum f. sp. ciceri using DsRed-Express to
follow root colonisation”, Microbiol. Res., 167(6), pp.332-338.
[21] M. Eckert, K. Maguire, M. Urban, S. Foster, B. Fitt, J. Lucas,
K. Hammond-Kosack (2005), “Agrobacterium tumefaciens-mediated
transformation of Leptosphaeria spp. and Oculimacula spp. with the
reef coral gene DsRed and the jellyfish gene GFP”, FEMS Microbiol.
Lett., 253(1), pp.67-74.
[22] V.T. Tran, T.B.X.L. Do, T.K. Nguyen, X.T. Vu, B.N. Dao,
H.H. Nguyen (2017), “A simple, efficient and universal method for
the extraction of genomic DNA from bacteria, yeasts, molds and
microalgae suitable for PCR-based applications”, Vietnam Journal of
Science, Technology and Engineering, 59(4), pp.66-74.
Các file đính kèm theo tài liệu này:
phleomycin_resistance_gene_as_a_reliable_selection_marker_fo.pdf