Sinh học - Chapter 1: Biology: exploring life
Organism—an individual living thing,
Organ system—several organs that cooperate in a specific function,
Organ—a structure that is composed of tissues and that provides a specific function for the organism,
Tissues—a group of similar cells that perform a specific function,
Cells—the fundamental unit of life,
49 trang |
Chia sẻ: huyhoang44 | Lượt xem: 1379 | Lượt tải: 0Free
Bạn đang xem trước 20 trang tài liệu Sinh học - Chapter 1: Biology: exploring life, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
Chapter 1Biology: Exploring Life0Figure 1.0_1Chapter 1: Big IdeasThemes in the Studyof BiologyThe Processof ScienceBiology andEveryday LifeEvolution, the CoreTheme of BiologyTHEMES IN THE STUDY OF BIOLOGY© 2012 Pearson Education, Inc.1.1 All forms of life share common propertiesBiology is the scientific study of life.Properties of life includeOrder—the highly ordered structure that typifies life,Reproduction—the ability of organisms to reproduce their own kind,Growth and development—consistent growth and development controlled by inherited DNA,Energy processing—the use of chemical energy to power an organism’s activities and chemical reactions,© 2012 Pearson Education, Inc.1.1 All forms of life share common propertiesResponse to the environment—an ability to respond to environmental stimuli,Regulation—an ability to control an organism’s internal environment within limits that sustain life, andEvolutionary adaptation—adaptations evolve over many generations as individuals with traits best suited to their environments have greater reproductive success and pass their traits to offspring.© 2012 Pearson Education, Inc.Figure 1.1(1) Order(2) Reproduction(3) Growth and development(4) Energy processing(7) Evolutionary adaptation(6) Regulation(5) Response to the environment1.2 In life’s hierarchy of organization, new properties emerge at each levelBiological organization unfolds as follows:Biosphere—all of the environments on Earth that support life,Ecosystem—all the organisms living in a particular area and the physical components with which the organisms interact,Community—the entire array of organisms living in a particular ecosystem,Population—all the individuals of a species living in a specific area,© 2012 Pearson Education, Inc.1.2 In life’s hierarchy of organization, new properties emerge at each levelOrganism—an individual living thing,Organ system—several organs that cooperate in a specific function,Organ—a structure that is composed of tissues and that provides a specific function for the organism,Tissues—a group of similar cells that perform a specific function,Cells—the fundamental unit of life,© 2012 Pearson Education, Inc.1.2 In life’s hierarchy of organization, new properties emerge at each levelOrganelle—a membrane-bound structure that performs a specific function in a cell, andMolecule—a cluster of small chemical units called atoms held together by chemical bonds.© 2012 Pearson Education, Inc.Figure 1.2BiosphereMadagascarEcosystem:Forest inMadagascarCommunity:All organisms inthe forestPopulation:Group of ring-tailedlemursOrganism:Ring-tailed lemurOrgan system:Nervous systemOrgan:BrainTissue:Nervous tissueNerveSpinal cordBrainOrganelle:NucleusCell:Nerve cellNucleusAtomMolecule:DNA1.2 In life’s hierarchy of organization, new properties emerge at each levelEmergent properties are new properties that arise in each step upward in the hierarchy of life,from the arrangement and interactions among component parts.0© 2012 Pearson Education, Inc.1.3 Cells are the structural and functional units of lifeCells are the level at which the properties of life emerge.A cell canregulate its internal environment,take in and use energy,respond to its environment, develop and maintain its complex organization, andgive rise to new cells.© 2012 Pearson Education, Inc.1.3 Cells are the structural and functional units of lifeAll cellsare enclosed by a membrane that regulates the passage of materials between the cell and its surroundings anduse DNA as their genetic information.© 2012 Pearson Education, Inc.1.3 Cells are the structural and functional units of lifeThere are two basic types of cells.Prokaryotic cellswere the first to evolve,are simpler, andare usually smaller than eukaryotic cells.Eukaryotic cellscontain membrane-enclosed organelles, including a nucleus containing DNA, andare found in plants, animals, and fungi.© 2012 Pearson Education, Inc.Figure 1.3Eukaryotic cellMembraneProkaryoticcellDNA(no nucleus)OrganellesNucleus(membrane-enclosed)DNA (throughoutnucleus)1.3 Cells are the structural and functional units of lifeSystems biology models the complex interactions of biological systems, rangingfrom the functioning of the biosphereto the complex molecular machinery of a cell.© 2012 Pearson Education, Inc.1.3 Cells are the structural and functional units of lifeCells illustrate another theme in biology: the correlation of structure and function.Structure is related to function at all levels of biological organization.© 2012 Pearson Education, Inc.1.4 Living organisms interact with their environment, exchanging matter and energyLiving organisms interact with their environments, which includeother organisms andphysical factors.In most ecosystemsplants are the producers that provide the food,consumers eat plants and other animals, anddecomposers act as recyclers, changing complex matter into simpler mineral nutrients.© 2012 Pearson Education, Inc.1.4 Living organisms interact with their environment, exchanging matter and energyThe dynamics of ecosystems include two major processes:The recycling of chemical nutrients from the atmosphere and soil through producers, consumers, and decomposers back to the environment.The one-way flow of energy through an ecosystem, entering as sunlight, converted to chemical energy by producers, passed on to consumers, and exiting as heat. © 2012 Pearson Education, Inc.Figure 1.4EcosystemSunlightCO2HeatChemical energy(food)Producers(such asplants)Water and mineralstaken up by tree rootsCycling ofchemical nutrientsDecomposers(in soil)Consumers(such asanimals)CO2O2O2Figure 1.4_1EcosystemSunlightProducers(such asplants)Consumers(such asanimals)HeatO2O2CO2Chemical energy(food)CO2Water and mineralstaken up by tree rootsCycling ofchemical nutrientsDecomposers(in soil)EVOLUTION, THE CORE THEME OF BIOLOGY© 2012 Pearson Education, Inc.1.5 The unity of life is based on DNA and a common genetic codeAll cells have DNA, the chemical substance of genes.Genesare the unit of inheritance that transmits information from parents to offspring,are grouped into very long DNA molecules called chromosomes, andcontrol the activities of a cell.© 2012 Pearson Education, Inc.1.5 The unity of life is based on DNA and a common genetic codeA species’ genes are coded in the sequences of the four building blocks making up DNA’s double helix.All forms of life use essentially the same code to translate the information stored in DNA into proteins.The diversity of life arises from differences in DNA sequences.© 2012 Pearson Education, Inc.Figure 1.5ATTCCGGCTAATGCAGCGCAT1.6 The diversity of life can be arranged into three domainsWe can think of biology’s enormous scope as having two dimensions.The “vertical” dimension is the size scale that stretches from molecules to the biosphere.The “horizontal” dimension spans across the great diversity of organisms existing now and over the long history of life on Earth.© 2012 Pearson Education, Inc.1.6 The diversity of life can be arranged into three domainsDiversity is the hallmark of life.Biologists have identified about 1.8 million species.Estimates of the actual number of species ranges from 10 to 100 million.Taxonomy names species and classifies them into a system of broader groups.© 2012 Pearson Education, Inc.1.6 The diversity of life can be arranged into three domainsThe diversity of life can be arranged into three domains.Bacteria are the most diverse and widespread prokaryotes.Archaea are prokaryotes that often live in Earth’s extreme environments.Eukarya have eukaryotic cells and includesingle-celled protists andmulticellular fungi, animals, and plants.© 2012 Pearson Education, Inc.Figure 1.6Domain BacteriaDomain ArchaeaDomain EukaryaBacteriaArchaeaProtists(multiple kingdoms)Kingdom FungiKingdom AnimaliaKingdom Plantae1.7 Evolution explains the unity and diversity of lifeThe history of life, as documented by fossils, is a saga of a changing Earth billions of years old andinhabited by an evolving cast of life forms.Evolution accounts for life’s dual nature ofkinship anddiversity.© 2012 Pearson Education, Inc.1.7 Evolution explains the unity and diversity of lifeIn 1859, Charles Darwin published the book On the Origin of Species by Means of Natural Selection, which articulated two main points.1. A large amount of evidence supports the idea of evolution, that species living today are descendants of ancestral species in what Darwin called “descent with modification.”2. Natural selection is a mechanism for evolution.© 2012 Pearson Education, Inc.1.7 Evolution explains the unity and diversity of lifeNatural selection was inferred by connecting two observations.Individuals in a population vary in their traits, many of which are passed on from parents to offspring.A population can produce far more offspring than the environment can support.© 2012 Pearson Education, Inc.Figure 1.7CElimination of individuals with certain traitsReproduction of survivorsPopulation with varied inherited traits1321.7 Evolution explains the unity and diversity of lifeFrom these observations, Darwin inferred that those individuals with heritable traits best suited to the environment are more likely to survive and reproduce than less well-suited individuals,as a result of this unequal reproductive success over many generations, an increasing proportion of individuals will have the advantageous traits, andthe result will be evolutionary adaptation, the accumulation of favorable traits in a population over time.© 2012 Pearson Education, Inc.THE PROCESS OF SCIENCE© 2012 Pearson Education, Inc.1.8 Scientific inquiry is used to ask and answer questions about natureThe word science is derived from a Latin verb meaning “to know.” Science is a way of knowing.Scientistsuse inductive reasoning to draw general conclusions from many observations anddeductive reasoning to come up with ways to test a hypothesis, a proposed explanation for a set of observations.The logic flows from general premises to the specific results we should expect if the premises are true.© 2012 Pearson Education, Inc.1.8 Scientific inquiry is used to ask and answer questions about natureHow is a theory different from a hypothesis? A scientific theory ismuch broader in scope than a hypothesis,usually general enough to generate many new, specific hypotheses, which can then be tested, andsupported by a large and usually growing body of evidence.© 2012 Pearson Education, Inc.1.9 Scientists form and test hypotheses and share their resultsWe solve everyday problems by using hypotheses.A common example would be the reasoning we use to answer the question, “Why doesn’t a flashlight work?”Using deductive reasoning we realize that the problem is either (1) the bulb or (2) the batteries.Further, a hypothesis must betestable andfalsifiable.In this example, two hypotheses are tested.© 2012 Pearson Education, Inc.Figure 1.9A_s1ObservationQuestionHypothesis 1:Dead batteriesHypothesis 2:Burned-out bulbFigure 1.9A_s2ObservationQuestionHypothesis 1:Dead batteriesHypothesis 2:Burned-out bulbPrediction:Prediction:Replacing batterieswill fix problem.Replacing bulbwill fix problem.Experiment:Experiment:Test prediction byreplacing batteries.Test prediction byreplacing bulb.Figure 1.9A_s3Test falsifieshypothesis. Revisehypothesis orpose new one.ObservationQuestionHypothesis 1:Dead batteriesHypothesis 2:Burned-out bulbPrediction:Prediction:Replacing batterieswill fix problem.Replacing bulbwill fix problem.Experiment:Experiment:Test prediction byreplacing batteries.Test prediction byreplacing bulb.Test does notfalsify hypothesis.Make additionalpredictions andtest them.1.9 Scientists form and test hypotheses and share their resultsAn actual research project demonstrates the process of science.Scientists began with a set of observations and generalizations thatpoisonous animals are brightly colored andimposters resemble poisonous species but are actually harmless.They then tested the hypothesis that mimics benefit because predators confuse them with the harmful species.© 2012 Pearson Education, Inc.1.9 Scientists form and test hypotheses and share their resultsThe scientists conducted a controlled experiment, comparingan experimental group consisting of artificial king snakes anda control group consisting of artificial brown snakes.The groups differed only by one factor, the coloration of the artificial snakes.The data fit the key prediction of the mimicry hypothesis.© 2012 Pearson Education, Inc.Figure 1.9BFigure 1.9CFigure 1.9DFigure 1.9ECoral snakespresentArtificialking snakesArtificialbrown snakes84%020406080100Coral snakesabsent17%16%Percent of total attackson artificial snakes83%1.9 Scientists form and test hypotheses and share their resultsScience is a social activity with most scientists working in teams.Scientists share information in many ways.Science seeks natural causes for natural phenomena.The scope of science is limited to the study of structures and processes that we can directly observe and measure.Hypotheses about supernatural forces or explanations are outside the bounds of science, because they generate hypotheses that cannot be tested by science.© 2012 Pearson Education, Inc.1.11 EVOLUTION CONNECTION: Evolution is connected to our everyday livesEvolution is a core theme of biology.Evolutionary theory is useful inmedicine,agriculture,forensics, andconservation.© 2012 Pearson Education, Inc.
Các file đính kèm theo tài liệu này:
biol_1408_ch_1_824.ppt