In 1952, Alfred Hershey and Martha Chase used bacteriophages to show that DNA is the genetic material of T2, a virus that infects the bacterium Escherichia coli (E. coli).
Bacteriophages (or phages for short) are viruses that infect bacterial cells.
Phages were labeled with radioactive sulfur to detect proteins or radioactive phosphorus to detect DNA.
Bacteria were infected with either type of labeled phage to determine which substance was injected into cells and which remained outside the infected cell.
113 trang |
Chia sẻ: huyhoang44 | Lượt xem: 1278 | Lượt tải: 0Free
Bạn đang xem trước 20 trang tài liệu Sinh học - Chapter 10: Molecular biology of the gene, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
Chapter 10Molecular Biology of the Gene0Viruses infect organisms bybinding to receptors on a host’s target cell,injecting viral genetic material into the cell, andhijacking the cell’s own molecules and organelles to produce new copies of the virus.The host cell is destroyed, and newly replicated viruses are released to continue the infection.0Introduction© 2012 Pearson Education, Inc.Viruses are not generally considered alive because theyare not cellular andcannot reproduce on their own.Because viruses have much less complex structures than cells, they are relatively easy to study at the molecular level.For this reason, viruses are used to study the functions of DNA.0Introduction© 2012 Pearson Education, Inc.Figure 10.0_1Chapter 10: Big IdeasThe Structure of theGenetic MaterialDNA ReplicationThe Genetics of Virusesand BacteriaThe Flow of GeneticInformation from DNA toRNA to ProteinFigure 10.0_2THE STRUCTURE OF THE GENETIC MATERIAL© 2012 Pearson Education, Inc.10.1 SCIENTIFIC DISCOVERY: Experiments showed that DNA is the genetic materialUntil the 1940s, the case for proteins serving as the genetic material was stronger than the case for DNA.Proteins are made from 20 different amino acids.DNA was known to be made from just four kinds of nucleotides.Studies of bacteria and virusesushered in the field of molecular biology, the study of heredity at the molecular level, andrevealed the role of DNA in heredity.0© 2012 Pearson Education, Inc.10.1 SCIENTIFIC DISCOVERY: Experiments showed that DNA is the genetic materialIn 1928, Frederick Griffith discovered that a “transforming factor” could be transferred into a bacterial cell. He found thatwhen he exposed heat-killed pathogenic bacteria to harmless bacteria, some harmless bacteria were converted to disease-causing bacteria andthe disease-causing characteristic was inherited by descendants of the transformed cells.0© 2012 Pearson Education, Inc.10.1 SCIENTIFIC DISCOVERY: Experiments showed that DNA is the genetic materialIn 1952, Alfred Hershey and Martha Chase used bacteriophages to show that DNA is the genetic material of T2, a virus that infects the bacterium Escherichia coli (E. coli).Bacteriophages (or phages for short) are viruses that infect bacterial cells.Phages were labeled with radioactive sulfur to detect proteins or radioactive phosphorus to detect DNA.Bacteria were infected with either type of labeled phage to determine which substance was injected into cells and which remained outside the infected cell.0© 2012 Pearson Education, Inc.10.1 SCIENTIFIC DISCOVERY: Experiments showed that DNA is the genetic materialThe sulfur-labeled protein stayed with the phages outside the bacterial cell, while the phosphorus-labeled DNA was detected inside cells.Cells with phosphorus-labeled DNA produced new bacteriophages with radioactivity in DNA but not in protein.0© 2012 Pearson Education, Inc.Figure 10.1AHeadTailTail fiberDNAFigure 10.1BPhageBacteriumBatch 2:RadioactiveDNA labeledin greenDNARadioactiveproteinCentrifugePhageDNAEmptyprotein shellPelletThe radioactivityis in the liquid.RadioactiveDNACentrifugePelletThe radioactivityis in the pellet.4321Batch 1:Radioactiveproteinlabeled inyellowFigure 10.1CA phage attachesitself to a bacterialcell.The phage injectsits DNA into thebacterium.The phage DNA directsthe host cell to makemore phage DNA and proteins; new phagesassemble.The cell lysesand releasesthe new phages.134210.2 DNA and RNA are polymers of nucleotidesDNA and RNA are nucleic acids.One of the two strands of DNA is a DNA polynucleotide, a nucleotide polymer (chain).A nucleotide is composed of a nitrogenous base,five-carbon sugar, andphosphate group.The nucleotides are joined to one another by a sugar-phosphate backbone.0© 2012 Pearson Education, Inc.Each type of DNA nucleotide has a different nitrogen-containing base:adenine (A),cytosine (C),thymine (T), andguanine (G).010.2 DNA and RNA are polymers of nucleotides© 2012 Pearson Education, Inc.Figure 10.2AAAAAAAACTTTTTTCCCCGGGGGCCGATA DNAdouble helixTDNAnucleotideCovalentbondjoiningnucleotidesACTTwo representationsof a DNA polynucleotideGGGGCTPhosphategroupSugar(deoxyribose)DNA nucleotideThymine (T)Nitrogenous base(can be A, G, C, or T)SugarNitrogenousbasePhosphategroupSugar-phosphatebackboneFigure 10.2BThymine (T)Cytosine (C)PyrimidinesPurinesAdenine (A)Guanine (G)10.2 DNA and RNA are Polymers of NucleotidesRNA (ribonucleic acid) is unlike DNA in that ituses the sugar ribose (instead of deoxyribose in DNA) and RNA has the nitrogenous base uracil (U) instead of thymine.0© 2012 Pearson Education, Inc.Figure 10.2CPhosphategroupSugar(ribose)Uracil (U)Nitrogenous base(can be A, G, C, or U)Figure 10.2DUracilAdenineCytosineGuanineRibosePhosphate10.3 SCIENTIFIC DISCOVERY: DNA is a double-stranded helixIn 1952, after the Hershey-Chase experiment demonstrated that the genetic material was most likely DNA, a race was on todescribe the structure of DNA andexplain how the structure and properties of DNA can account for its role in heredity.0© 2012 Pearson Education, Inc.Figure 10.3A10.3 SCIENTIFIC DISCOVERY: DNA is a double-stranded helixIn 1953, James D. Watson and Francis Crick deduced the secondary structure of DNA, usingX-ray crystallography data of DNA from the work of Rosalind Franklin and Maurice Wilkins andChargaff’s observation that in DNA,the amount of adenine was equal to the amount of thymine and the amount of guanine was equal to that of cytosine.0© 2012 Pearson Education, Inc.Watson and Crick reported that DNA consisted of two polynucleotide strands wrapped into a double helix.The sugar-phosphate backbone is on the outside.The nitrogenous bases are perpendicular to the backbone in the interior.Specific pairs of bases give the helix a uniform shape.A pairs with T, forming two hydrogen bonds, andG pairs with C, forming three hydrogen bonds.010.3 SCIENTIFIC DISCOVERY: DNA is a double-stranded helix© 2012 Pearson Education, Inc.Figure 10.3CTwistFigure 10.3DBase pairHydrogen bondPartial chemicalstructureComputermodelRibbonmodel10.3 SCIENTIFIC DISCOVERY: DNA is a double-stranded helixIn 1962, the Nobel Prize was awarded toJames D. Watson, Francis Crick, and Maurice Wilkins.Rosalind Franklin probably would have received the prize as well but for her death from cancer in 1958. Nobel Prizes are never awarded posthumously.The Watson-Crick model gave new meaning to the words genes and chromosomes. The genetic information in a chromosome is encoded in the nucleotide sequence of DNA.0© 2012 Pearson Education, Inc.DNA REPLICATION© 2012 Pearson Education, Inc.10.4 DNA replication depends on specific base pairingIn their description of the structure of DNA, Watson and Crick noted that the structure of DNA suggests a possible copying mechanism.DNA replication follows a semiconservative model.The two DNA strands separate.Each strand is used as a pattern to produce a complementary strand, using specific base pairing.Each new DNA helix has one old strand with one new strand.0© 2012 Pearson Education, Inc.Figure 10.4A_s1A parentalmoleculeof DNAG CA TT AA TC GFigure 10.4A_s2A parentalmoleculeof DNAACG CA TT AThe parental strandsseparate and serveas templatesFreenucleotidesTATTAATAGGGCCA TC GCFigure 10.4A_s3A parentalmoleculeof DNAACG CA TT AThe parental strandsseparate and serveas templatesFreenucleotidesTATTAATAGGGCCA TC GCTwo identicaldaughter moleculesof DNA are formedA TA TA TA TT AT AC GC GG CG CFigure 10.4BParental DNAmoleculeDaughterstrandParentalstrandDaughter DNAmoleculesA TG CA TA TT AT T AC GC GC GA TA TG CTC GTC GC GACGCA TA TG CA TGAADNA replication begins at the origins of replication whereDNA unwinds at the origin to produce a “bubble,”replication proceeds in both directions from the origin, andreplication ends when products from the bubbles merge with each other.10.5 DNA replication proceeds in two directions at many sites simultaneously0© 2012 Pearson Education, Inc.DNA replication occurs in the 5 to 3 direction.Replication is continuous on the 3 to 5 template.Replication is discontinuous on the 5 to 3 template, forming short segments.10.5 DNA replication proceeds in two directions at many sites simultaneously0© 2012 Pearson Education, Inc.10.5 DNA replication proceeds in two directions at many sites simultaneouslyTwo key proteins are involved in DNA replication.DNA ligase joins small fragments into a continuous chain.DNA polymeraseadds nucleotides to a growing chain andproofreads and corrects improper base pairings.0© 2012 Pearson Education, Inc.DNA polymerases and DNA ligase also repair DNA damaged by harmful radiation and toxic chemicals.DNA replication ensures that all the somatic cells in a multicellular organism carry the same genetic information.10.5 DNA replication proceeds in two directions at many sites simultaneously0© 2012 Pearson Education, Inc.Figure 10.5AParentalDNAmoleculeOrigin of replication“Bubble”Parental strandDaughter strandTwodaughterDNAmoleculesFigure 10.5B5 end3 end5432112345PPPPPHOATCGGCPPPATOH5 end3 endFigure 10.5COverall direction of replicationDNA ligaseReplication forkParental DNADNA polymerasemoleculeThis daughterstrand is synthesizedcontinuouslyThis daughterstrand is synthesizedin pieces35353535THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN© 2012 Pearson Education, Inc.10.6 The DNA genotype is expressed as proteins, which provide the molecular basis for phenotypic traitsDNA specifies traits by dictating protein synthesis.The molecular chain of command is fromDNA in the nucleus to RNA andRNA in the cytoplasm to protein.Transcription is the synthesis of RNA under the direction of DNA.Translation is the synthesis of proteins under the direction of RNA.0© 2012 Pearson Education, Inc.Figure 10.6A_s1DNANUCLEUSCYTOPLASMFigure 10.6A_s2DNANUCLEUSCYTOPLASMRNATranscriptionFigure 10.6A_s3DNANUCLEUSCYTOPLASMRNATranscriptionTranslationProtein10.6 The DNA genotype is expressed as proteins, which provide the molecular basis for phenotypic traitsThe connections between genes and proteinsThe initial one gene–one enzyme hypothesis was based on studies of inherited metabolic diseases.The one gene–one enzyme hypothesis was expanded to include all proteins.Most recently, the one gene–one polypeptide hypothesis recognizes that some proteins are composed of multiple polypeptides.0© 2012 Pearson Education, Inc.10.7 Genetic information written in codons is translated into amino acid sequencesThe sequence of nucleotides in DNA provides a code for constructing a protein.Protein construction requires a conversion of a nucleotide sequence to an amino acid sequence.Transcription rewrites the DNA code into RNA, using the same nucleotide “language.”0© 2012 Pearson Education, Inc.10.7 Genetic information written in codons is translated into amino acid sequencesThe flow of information from gene to protein is based on a triplet code: the genetic instructions for the amino acid sequence of a polypeptide chain are written in DNA and RNA as a series of nonoverlapping three-base “words” called codons.Translation involves switching from the nucleotide “language” to the amino acid “language.”Each amino acid is specified by a codon.64 codons are possible.Some amino acids have more than one possible codon.0© 2012 Pearson Education, Inc.Figure 10.7DNAmoleculeGene 1Gene 2Gene 3ATranscriptionRNATranslationCodonPolypeptideAminoacidAACCGGCAAAAUUGGCCGUUUUDNAUFigure 10.7_1ATranscriptionRNATranslationCodonPolypeptideAminoacidAACCGGCAAAAUUGGCCGUUUUDNAU10.8 The genetic code dictates how codons are translated into amino acidsCharacteristics of the genetic codeThree nucleotides specify one amino acid.61 codons correspond to amino acids.AUG codes for methionine and signals the start of transcription.3 “stop” codons signal the end of translation.0© 2012 Pearson Education, Inc.10.8 The genetic code dictates how codons are translated into amino acidsThe genetic code isredundant, with more than one codon for some amino acids,unambiguous in that any codon for one amino acid does not code for any other amino acid, nearly universal—the genetic code is shared by organisms from the simplest bacteria to the most complex plants and animals, andwithout punctuation in that codons are adjacent to each other with no gaps in between.0© 2012 Pearson Education, Inc.Figure 10.8ASecond baseThird baseFirst baseFigure 10.8B_s1T Strand to be transcribedA C T T C AAA A A T DNAAAT C T T T T G A G G Figure 10.8B_s2T Strand to be transcribedA C T T C AAA A A T DNAAAT C T T T T G A G G RNATranscriptionA A A A U U U U U G G G Figure 10.8B_s3T Strand to be transcribedA C T T C AAA A A T DNAAAT C T T T T G A G G RNATranscriptionA A A A U U U U U G G G TranslationPolypeptideMetLysPheStopcodonStartcodonFigure 10.8C10.9 Transcription produces genetic messages in the form of RNAOverview of transcriptionAn RNA molecule is transcribed from a DNA template by a process that resembles the synthesis of a DNA strand during DNA replication.RNA nucleotides are linked by the transcription enzyme RNA polymerase.Specific sequences of nucleotides along the DNA mark where transcription begins and ends.The “start transcribing” signal is a nucleotide sequence called a promoter.0© 2012 Pearson Education, Inc.10.9 Transcription produces genetic messages in the form of RNATranscription begins with initiation, as the RNA polymerase attaches to the promoter.During the second phase, elongation, the RNA grows longer.As the RNA peels away, the DNA strands rejoin.Finally, in the third phase, termination, the RNA polymerase reaches a sequence of bases in the DNA template called a terminator, which signals the end of the gene.The polymerase molecule now detaches from the RNA molecule and the gene.0© 2012 Pearson Education, Inc.Figure 10.9ARNApolymeraseFree RNAnucleotidesTemplatestrand of DNANewly made RNADirection oftranscriptionTGAGGAAUCCACTTAACCGGUTUTAACCTATCFigure 10.9BRNA polymeraseDNA of genePromoterDNAInitiation12TerminatorDNA3ElongationArea shownin Figure 10.9ATerminationGrowingRNARNApolymeraseCompletedRNAFigure 10.9B_1RNA polymeraseDNA of genePromoterDNAInitiation1TerminatorDNAFigure 10.9B_22ElongationArea shownin Figure 10.9AGrowingRNAFigure 10.9B_3TerminationRNApolymeraseCompletedRNA3GrowingRNA10.10 Eukaryotic RNA is processed before leaving the nucleus as mRNAMessenger RNA (mRNA)encodes amino acid sequences andconveys genetic messages from DNA to the translation machinery of the cell, which inprokaryotes, occurs in the same place that mRNA is made, but ineukaryotes, mRNA must exit the nucleus via nuclear pores to enter the cytoplasm.Eukaryotic mRNA hasintrons, interrupting sequences that separateexons, the coding regions.0© 2012 Pearson Education, Inc.10.10 Eukaryotic RNA is processed before leaving the nucleus as mRNAEukaryotic mRNA undergoes processing before leaving the nucleus.RNA splicing removes introns and joins exons to produce a continuous coding sequence.A cap and tail of extra nucleotides are added to the ends of the mRNA tofacilitate the export of the mRNA from the nucleus, protect the mRNA from attack by cellular enzymes, and help ribosomes bind to the mRNA.0© 2012 Pearson Education, Inc.Figure 10.10DNACapExonIntronExonRNAtranscriptwith capand tailExonIntronTranscriptionAddition of cap and tailIntrons removedTailExons spliced togetherCoding sequenceNUCLEUSCYTOPLASMmRNA10.11 Transfer RNA molecules serve as interpreters during translationTransfer RNA (tRNA) molecules function as a language interpreter,converting the genetic message of mRNAinto the language of proteins.Transfer RNA molecules perform this interpreter task bypicking up the appropriate amino acid andusing a special triplet of bases, called an anticodon, to recognize the appropriate codons in the mRNA.0© 2012 Pearson Education, Inc.Figure 10.11AAmino acidattachment siteHydrogen bondRNA polynucleotidechainAnticodonA simplifiedschematic of a tRNAA tRNA molecule, showingits polynucleotide strandand hydrogen bondingFigure 10.11BEnzymetRNAATP10.12 Ribosomes build polypeptidesTranslation occurs on the surface of the ribosome.Ribosomes coordinate the functioning of mRNA and tRNA and, ultimately, the synthesis of polypeptides.Ribosomes have two subunits: small and large.Each subunit is composed of ribosomal RNAs and proteins.Ribosomal subunits come together during translation.Ribosomes have binding sites for mRNA and tRNAs.0© 2012 Pearson Education, Inc.Figure 10.12AtRNAmoleculesGrowingpolypeptideLargesubunitSmallsubunitmRNAFigure 10.12BtRNA binding sitesmRNA binding siteLarge subunitSmall subunitPsiteAsiteFigure 10.12CmRNACodonstRNAGrowingpolypeptideThe next aminoacid to be addedto the polypeptide10.13 An initiation codon marks the start of an mRNA messageTranslation can be divided into the same three phases as transcription:initiation,elongation, andtermination. Initiation brings togethermRNA,a tRNA bearing the first amino acid, andthe two subunits of a ribosome.0© 2012 Pearson Education, Inc.10.13 An initiation codon marks the start of an mRNA messageInitiation establishes where translation will begin.Initiation occurs in two steps.An mRNA molecule binds to a small ribosomal subunit and the first tRNA binds to mRNA at the start codon.The start codon reads AUG and codes for methionine.The first tRNA has the anticodon UAC.A large ribosomal subunit joins the small subunit, allowing the ribosome to function.The first tRNA occupies the P site, which will hold the growing peptide chain.The A site is available to receive the next tRNA.0© 2012 Pearson Education, Inc.Figure 10.13AStart of genetic messageCapEndTailFigure 10.13BInitiatortRNAmRNAStart codonSmallribosomalsubunitLargeribosomalsubunitPsiteAsiteMetAUGUAC2AUGUAC1Met10.14 Elongation adds amino acids to the polypeptide chain until a stop codon terminates translationOnce initiation is complete, amino acids are added one by one to the first amino acid.Elongation is the addition of amino acids to the polypeptide chain.0© 2012 Pearson Education, Inc.Each cycle of elongation has three steps.Codon recognition: The anticodon of an incoming tRNA molecule, carrying its amino acid, pairs with the mRNA codon in the A site of the ribosome.Peptide bond formation: The new amino acid is joined to the chain.Translocation: tRNA is released from the P site and the ribosome moves tRNA from the A site into the P site.010.14 Elongation adds amino acids to the polypeptide chain until a stop codon terminates translation© 2012 Pearson Education, Inc.Elongation continues until the termination stage of translation, whenthe ribosome reaches a stop codon,the completed polypeptide is freed from the last tRNA, andthe ribosome splits back into its separate subunits.010.14 Elongation adds amino acids to the polypeptide chain until a stop codon terminates translation© 2012 Pearson Education, Inc.Figure 10.14_s1PolypeptidemRNACodon recognitionAnticodonAminoacidCodonsPsiteAsite1Figure 10.14_s2PolypeptidemRNACodon recognitionAnticodonAminoacidCodonsPsiteAsite1Peptide bond2formationFigure 10.14_s3PolypeptidemRNACodon recognitionAnticodonAminoacidCodonsPsiteAsite1Peptide bond2formationTranslocation3NewpeptidebondFigure 10.14_s4PolypeptidemRNACodon recognitionAnticodonAminoacidCodonsPsiteAsite1Peptide bond2formationTranslocation3NewpeptidebondStopcodonmRNAmovement10.15 Review: The flow of genetic information in the cell is DNA RNA proteinTranscription is the synthesis of RNA from a DNA template. In eukaryotic cells,transcription occurs in the nucleus andthe mRNA must travel from the nucleus to the cytoplasm.0© 2012 Pearson Education, Inc.10.15 Review: The flow of genetic information in the cell is DNA RNA proteinTranslation can be divided into four steps, all of which occur in the cytoplasm:amino acid attachment,initiation of polypeptide synthesis,elongation, andtermination.0© 2012 Pearson Education, Inc.Figure 10.15DNATranscriptionmRNARNApolymeraseTranscriptionTranslationAmino acidEnzymeCYTOPLASMAmino acidattachment2134tRNAATPAnticodonInitiation ofpolypeptide synthesisElongationLargeribosomalsubunitInitiatortRNAStart CodonmRNAGrowingpolypeptideSmallribosomalsubunitNew peptidebond formingCodonsmRNAPolypeptideTermination5Stop codon10.16 Mutations can change the meaning of genesA mutation is any change in the nucleotide sequence of DNA.Mutations can involve large chromosomal regions or just a single nucleotide pair.0© 2012 Pearson Education, Inc.10.16 Mutations can change the meaning of genesMutations within a gene can be divided into two general categories.Base substitutions involve the replacement of one nucleotide with another. Base substitutions mayhave no effect at all, producing a silent mutation,change the amino acid coding, producing a missense mutation, which produces a different amino acid,lead to a base substitution that produces an improved protein that enhances the success of the mutant organism and its descendant, orchange an amino acid into a stop codon, producing a nonsense mutation.0© 2012 Pearson Education, Inc.10.16 Mutations can change the meaning of genesMutations can result in deletions or insertions that mayalter the reading frame (triplet grouping) of the mRNA, so that nucleotides are grouped into different codons,lead to significant changes in amino acid sequence downstream of the mutation, andproduce a nonfunctional polypeptide.0© 2012 Pearson Education, Inc.10.16 Mutations can change the meaning of genesMutagenesis is the production of mutations.Mutations can be caused byspontaneous errors that occur during DNA replication or recombination ormutagens, which includehigh-energy radiation such as X-rays and ultraviolet light andchemicals.0© 2012 Pearson Education, Inc.Figure 10.16ANormal hemoglobin DNAMutant hemoglobin DNAmRNAmRNASickle-cell hemoglobinNormal hemoglobinGluValCTTGAACTGAAUFigure 10.16BNormalgeneNucleotidesubstitutionNucleotidedeletionNucleotideinsertionInsertedDeletedmRNAProteinMetMetLysPheLysPheAlaAlaGlySerAUGAAGUUUGGCGCAGCGCAAGUUUAUGAAMetLysAlaHisLeuGUUAUGAAGGCGCAUUMetLysAlaHisLeuGUUAUGAAGGCUGGCTHE GENETICS OF VIRUSES AND BACTERIA© 2012 Pearson Education, Inc.10.17 Viral DNA may become part of the host chromosomeA virus is essentially “genes in a box,” an infectious particle consisting ofa bit of nucleic acid,wrapped in a protein coat called a capsid, and in some cases, a membrane envelope.Viruses have two types of reproductive cycles.In the lytic cycle,viral particles are produced using host cell components,the host cell lyses, andviruses are released.0© 2012 Pearson Education, Inc.10.17 Viral DNA may become part of the host chromosome2. In the Lysogenic cycleViral DNA is inserted into the host chromosome by recombination.Viral DNA is duplicated along with the host chromosome during each cell division.The inserted phage DNA is called a prophage. Most prophage genes are inactive.Environmental signals can cause a switch to the lytic cycle, causing the viral DNA to be excised from the bacterial chromosome and leading to the death of the host cell.0© 2012 Pearson Education, Inc.Figure 10.17_s1PhageAttachesto cellPhage DNABacterialchromosomeThe phage injects its DNALytic cycleThe phage DNAcircularizes12The cell lyses,releasingphages4New phage DNA andproteins are synthesizedPhages assemble3Figure 10.17_s2PhageAttachesto cellPhage DNABacterialchromosomeThe phage injects its DNALytic cycleThe phage DNAcircularizes12The cell lyses,releasingphages4New phage DNA andproteins are synthesizedPhages assemble3OREnvironmentalstressLysogenic cycleMany celldivisionsThe lysogenic bacteriumreplicates normallyProphagePhage DNA inserts into the bacterialchromosome by recombination57610.18 CONNECTION: Many viruses cause disease in animals and plantsViruses can cause disease in animals and plants.DNA viruses and RNA viruses cause disease in animals.A typical animal virus has a membranous outer envelope and projecting spikes of glycoprotein.The envelope helps the virus enter and leave the host cell.Many animal viruses have RNA rather than DNA as their genetic material. These include viruses that cause the common cold, measles, mumps, polio, and AIDS.0© 2012 Pearson Education, Inc.10.18 CONNECTION: Many viruses cause disease in animals and plantsThe reproductive cycle of the mumps virus, a typical enveloped RNA virus, has seven major steps: entry of the protein-coated RNA into the cell,uncoating—the removal of the protein coat,RNA synthesis—mRNA synthesis using a viral enzyme,protein synthesis—mRNA is used to make viral proteins,new viral genome production—mRNA is used as a template to synthesize new viral genomes, assembly—the new coat proteins assemble around the new viral RNA, andexit—the viruses leave the cell by cloaking themselves in the host cell’s plasma membrane.0© 2012 Pearson Education, Inc.10.18 CONNECTION: Many viruses cause disease in animals and plantsSome animal viruses, such as herpesviruses, reproduce in the cell nucleus. Most plant viruses are RNA viruses.To infect a plant, they must get past the outer protective layer of the plant.Viruses spread from cell to cell through plasmodesmata.Infection can spread to other plants by insects, herbivores, humans, or farming tools.There are no cures for most viral diseases of plants or animals.0© 2012 Pearson Education, Inc.2Figure 10.18Viral RNA (genome)Glycoprotein spikeProtein coat MembranousenvelopeEntryCYTOPLASMUncoatingPlasmamembraneof host cell13546ProteinsynthesisViral RNA(genome)RNA synthesisby viral enzymemRNANewviral proteinsAssemblyNew viralgenomeTemplateRNA synthesis(other strand)Exit76Figure 10.18_1Viral RNA (genome)Protein coat MembranousenvelopeEntryCYTOPLASMUncoatingPlasmamembraneof host cell1Viral RNA(genome)RNA synthesisby viral enzymeGlycoprotein spike23Figure 10.18_24mRNANewviral proteinsAssemblyNew viralgenomeTemplateRNA synthesis(other strand)ExitProteinsynthesis67510.19 EVOLUTION CONNECTION: Emerging viruses threaten human healthViruses that appear suddenly or are new to medical scientists are called emerging viruses. These include theAIDS virus,Ebola virus,West Nile virus, andSARS virus.0© 2012 Pearson Education, Inc.10.19 EVOLUTION CONNECTION: Emerging viruses threaten human healthThree processes contribute to the emergence of viral diseases:mutation—RNA viruses mutate rapidly.contact between species—viruses from other animals spread to humans.spread from isolated human populations to larger human populations, often over great distances.0© 2012 Pearson Education, Inc.10.20 The AIDS virus makes DNA on an RNA templateAIDS (acquired immunodeficiency syndrome) is caused by HIV (human immunodeficiency virus).HIVis an RNA virus,has two copies of its RNA genome,carries molecules of reverse transcriptase, which causes reverse transcription, producing DNA from an RNA template.0© 2012 Pearson Education, Inc.Figure 10.20AEnvelopeGlycoproteinProtein coatRNA(two identicalstrands)Reversetranscriptase(two copies)After HIV RNA is uncoated in the cytoplasm of the host cell,reverse transcriptase makes one DNA strand from RNA,reverse transcriptase adds a complementary DNA strand,double-stranded viral DNA enters the nucleus and integrates into the chromosome, becoming a provirus,the provirus DNA is used to produce mRNA,the viral mRNA is translated to produce viral proteins, andnew viral particles are assembled, leave the host cell, and can then infect other cells.010.20 The AIDS virus makes DNA on an RNA template© 2012 Pearson Education, Inc.Figure 10.20BViral RNADNAstrandReversetranscriptaseDouble-strandedDNAViralRNAandproteins123456CYTOPLASMNUCLEUSChromosomalDNAProvirusDNARNA10.21 Viroids and prions are formidable pathogens in plants and animalsSome infectious agents are made only of RNA or protein.Viroids are small, circular RNA molecules that infect plants. Viroidsreplicate within host cells without producing proteins andinterfere with plant growth.Prions are infectious proteins that cause degenerative brain diseases in animals. Prionsappear to be misfolded forms of normal brain proteins,which convert normal protein to misfolded form.0© 2012 Pearson Education, Inc.10.22 Bacteria can transfer DNA in three waysViral reproduction allows researchers to learn more about the mechanisms that regulate DNA replication and gene expression in living cells.Bacteria are also valuable but for different reasons.Bacterial DNA is found in a single, closed loop, chromosome.Bacterial cells divide by replication of the bacterial chromosome and then by binary fission.Because binary fission is an asexual process, bacteria in a colony are genetically identical to the parent cell.0© 2012 Pearson Education, Inc.
Các file đính kèm theo tài liệu này:
biol_1408_ch_10_8154.ppt