Cell lines and gene transfer assays
Human cell lines were obtained from the American Type Culture Collection
(ATCC), except for CMS (Monaco et al., 1982) and HuACI1 (Peebles et al.,
1973). Platelets, and B and T lymphocytes were isolated as described
(Timmen and Saksela, 1980; Abe et al., 1986). Isolation of monocytes was
performed by using counterflow centrifugal elutriation (Wahl et al., 1983).
HEL cells were treated with the phorbol ester TPA and with hemin according to published procedures (Papayannopoulou et al., 1983; Larson and
Papayannopoulou, 1985). NIH3T3 mouse cells were transfected with 20
Ag of high mol. wt cellular DNA or with 1 jig of plasmid DNA by the
calcium phosphate precipitation technique (Graham and van der Eb, 1973).
Foci of transformed cells were scored after 10-14 days. Tumorigenicity
assays were performed as described (Blair et al., 1982; Fasano et al., 1984).
Tumor appearance was followed up to 2 months after inoculation.
Isolation of genomic and cDNA clones
A vav genomic library was made in XEMBL-4. DNA isolated from a thirdcycle vav-induced nude mouse tumor was partially digested with Sau3AI
and fractionated on sucrose gradients. DNA of 15-20 kb was ligated to
BamHI-digested XEMBL-4 DNA. 106 phage clones were screened by
hybridization with 32P-labeled nick-translated high mol. wt human DNA
under stringent conditions (42°C in 5 x SSC, 50% formamide, 1 x
Denhardt's solution). Filters were washed three times at room temperature
with 2 x SSC, 0.1 % SDS and twice at 55°C with 0. Ix SSC, 0.1 % SDS.
The vav cDNA library in XgtIO was prepared from poly(A)-selected RNA
of a third-cycle vav-induced nude mouse tumor using a cDNA cloning kit
(Amersham). One million phages were screened under stringent conditions
using a 32 P-labeled nick-translated 800 bp BamHI-EcoRi Ala- vav
genomic DNA fragment as a probe. Among those recombinant XgtlO phages
isolated, that containing the longest (2.8 kb) insert was selected for further
studies. Its insert was subcloned into the EcoRI site of Bluescript KS in
both orientations to generate pSK33 and pSK47. A XgtlO cDNA library
(2 x 106 clones) prepared from human K562 cells (Shtivelman et al.,
1985) was hybridized under stringent conditions to a 32P-labeled nicktranslated 2.8 kb vav cDNA probe. A recombinant phage carrying a 2.9
kb vav proto-oncogene insert was isolated and subcloned in Bluescript KS
in both orientations to generate pSK65 and pSK66.
Southern and Northern transfer analysis
High mol. wt DNA was digested to completion with appropriate restriction
endonucleases, electrophoresed in 0.8% agarose gel and submitted to
Southern transfer analysis as described (Southern, 1975). Total cellular RNA
was extracted by the guanidium thiocyanate method (Chirgwin et al., 1979)
and purified by centrifugation through cesium chloride. Poly(A)-containing
RNA was isolated by retention on oligo(dT) columns (Collaborative
Research). Total RNA (10 jig) or poly(A)-selected RNA (3 jig) were
submitted to Northern transfer analysis (Lehrach et al., 1977). The
nitrocellulose filters were hybridized to various 32P-labeled nick-translated
probes for 48 h under stringent conditions (42°C in 5 x SSC, 50%
formamide, 1 x Denhardt's solution).
Nucleotide sequencing
A series of nested deletions were generated from pSK33 and pSK47 by
the combined use of Exonuclease Ill and Mung bean nuclease (Stratagene).
Escherichia coli MV 1193 cells were transformed with the corresponding
deletion mutants and single-strand phages rescued by subsequent infection
with the helper M13 K07 phage. Single-stranded DNAs were prepared from
2289S.Katzav, D.Martin-Zanca and M.Barbacid
these phages and submitted to nucleotide sequence analysis by an automated
chain termination method using primers with multiple fluorophores
(Brumbaugh et al., 1988). To dctzrmine the sequence of the 5' domain of
the normal vav gene, a 270 bp SacI fragment from pSK65 was subcloned
in both orientations in Bluescript KS. Single-stranded DNA was obtained
from these plasmids and used as a template for sequencing by the
dideoxynucleotide chain termination technique (Sanger et al., 1977) using
the Sequenase kit (USB).
8 trang |
Chia sẻ: honghp95 | Lượt xem: 832 | Lượt tải: 0Free
Bạn đang xem nội dung tài liệu Vav, a novel human oncogene derived from a locus ubiquitously expressed in hematopoietic cells, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
The EMBO Journal vol.8 no.8 pp.2283 - 2290, 1989
vav, a novel human oncogene derived from a locus
ubiquitously expressed in hematopoietic cells
Shulamit Katzav, Dionisio Martin-Zanca and
Mariano Barbacid1
Departmental Oncology Section, BRI-Basic Research Program,
Frederick Cancer Research Facility, PO Box B, Frederick, MD 21701,
USA
'Present address: Department of Molecular Biology, Squibb Institute
for Medical Research, PO Box 4000, Princeton, NJ 08543, USA
Communicated by J.Schlessinger
A novel human oncogene, designated vav, was generated
by a genetic rearrangement during gene transfer assays.
The vav oncogene directs the synthesis of a 3.0 kb mRNA
from which we isolated a 2.8 kb-long complementary
DNA copy. Nucleotide sequence analysis of this vav
oncogene cDNA clone revealed that its 5' 167 bp were
derived from pSV2neo DNA cotransfected as a selectable
marker during gene transfer. The remaining 2597 bp
were unrelated to genes included in current data banks,
indicating that the vav oncogene is likely to be derived
from a novel human locus. The vav oncogene cDNA clone
encompasses a 2391 bp long open reading frame (ORF)
capable of directing the synthesis of a 797 amino acid long
polypeptide. The predicted vav oncogene protein sequence
exhibits several motifs reminiscent of transcriptional
factors. They include a highly acidic amino-terminal
region separated from two putative nuclear localization
signals by a proline-rich sequence, presumably a hinge
region. In addition, we identified two zinc-finger-like
domains, one of which conforms to the canonical pattern
Cys-X2-Cys-X13-Cys-X2-Cys previously found to confer
trans-activating activity to the adenovirus ElA protein.
Transcription of its normal allele, the vav proto-oncogene,
has been exclusively observed in cells of hematopoietic
origin, including those of erythroid, lymphoid and
myeloid lineages. These findings raise the possibility that
this novel locus might play an important role in
hematopoiesis.
Key words: vav/oncogene/hematopoietic cells/zinc finger
Introduction
Malignant transformation has been used as a genetic marker
to identify vertebrate loci that play active roles in the
regulation of cellular proliferation and/or differentiation.
These loci harbor the normal alleles of transforming genes
present in acute transforming retroviruses, retroviral-induced
tumors and spontaneous and carcinogen-induced malignan-
cies (Bishop, 1987). In addition to those oncogenes present
in naturally occurring tumours, transforming genes can be
generated by rearrangements that occur during gene transfer
assays. Some of these in vitro activated oncogenes are
homologous to those previously found in human tumors such
as trk (Martin-Zanca et al., 1986; Kozma et al., 1988) or
in certain retroviruses such as raf(Rapp et al., 1983; Muller
and Muller, 1984; Fukui et al., 1985; Shimizu et al., 1985).
Other oncogenes including mas (Young et al., 1986),
dbl/mcf-2 (Fasano et al., 1984; Eva and Aaronson, 1985),
ret (Takahashi et al., 1985), hstlK-fgf (Delli Bovi et al.,
1987; Taira et al., 1987), fgf-5 (Zhan et al., 1988), B-raf
(Ikawa et al., 1988) and tre (Nakamura et al., 1988)
represent previously unidentified loci. Characterization of
these transforming genes and their normal alleles will expand
the number of loci available for the study of molecular
pathways involved in the control of cell proliferation and
differentiation.
We describe here the isolation and molecular characteriza-
tion of vav, a new human oncogene that became activated
during the course of gene transfer assays aimed at
determining the presence of transforming genes in human
esophageal carcinomas suspected of having a chemical
etiology. Molecular characterization of this oncogene
revealed a novel locus that encodes a zinc finger-containing
protein whose expression is restricted to cells of
hematopoietic origin.
Results
Identification of the vav oncogene
DNAs isolated from several esophageal carcinomas kindly
provided by Dr R.Montesano (WHO, Lyon) were tested for
the ability to transform NIH3T3 mouse fibroblasts. Although
none of the DNAs was able to induce foci of morphologically
transformed cells, one DNA sample was positive in the in
vivo nude mouse tumorigenicity assay (Blair et al., 1982;
Fasano et al., 1984). NIH3T3 cells transfected with this
tumor DNA in the presence of the selectable marker
pSV2neo (Southern and Berg, 1982) were expanded in vitro,
pooled and inoculated into mice. These cells elicited the
appearance of tumors in 9 out of the 10 mice injected in
< 4 weeks. Southern transfer analysis ofDNA isolated from
these nude mouse tumors revealed the presence of multiple
human Alu+ repetitive sequences.
When the DNA isolated from the nude mouse tumors was
used in additional cycles of transfection, tumors were induced
in 100% of the mice inoculated. DNA isolated from second-
and third-cycle nude mouse tumors exhibited a consistent
pattern of human Alu+ sequences (EcoRI DNA fragments
of 30, 9 and 5 kb), a result indicative of the presence of
a human oncogene (Figure IA). The human sequences
present in these human Alu+ DNA fragments did not
hybridize, even under low-stringency conditions, to any of
20 oncogene-specific probes available at the time these
experiments were conducted (data not shown). These results
indicated that these nude tumors might contain a novel human
oncogene. Since this transforming gene represented the sixth
distinct oncogene identified in our laboratory, it was
designated by the acronym vav, the sixth letter of the Hebrew
alphabet, the native language of one of us (S.K.).
2283
S.Katzav, D.Martin-Zanca and M.Barbacid
In view of the complexity of the vav locus (>235 kb) we
wished to isolate vav cDNA clones. To identify such clones,
we generated a genomic probe containing vav exonic
sequences. DNA isolated from a third-cycle nude mouse
tumor was partially digested with Sau3AI and used to create
a genomic library in XEMBL4. One million recombinant
phages were screened with a probe consisting of 32P-labeled
nick-translated human genomic DNA. One hundred phages
were found to be positive. Five plaque-purified phages
carrying inserts of 15-20 kb were grown up, digested with
restriction endonucleases and several DNA fragments free
of human repetitive sequences were isolated by preparative
gel electrophoresis. These DNA fragments were screened
for the possible presence of exon sequences by hybridizing
them to genomic DNAs isolated from several mammalian
species. This test was based on the assumption that exonic
sequences are more likely to be evolutionarily conserved than
intron sequences. Among those DNA fragments tested, a
800 bp BamHI-EcoRI probe efficiently hybridized with
single-copy DNA sequences present in the hamster, mouse,
mink, macaque and human genomes (data not shown). This
probe was subsequently used in Northern transfer analysis
to identify a single 3.0 kb mRNA species specifically
expressed in vav-induced nude mouse tumors (Figure iB).
This transcript is likely to represent the transcriptional
product of the vav oncogene.
Isolation of cDNA clones
Poly(A)-selected RNA isolated from a vav-induced third-
cycle nude mouse tumor was used to prepare a 106-member
EcoRl cDNA library in the XgtlO cloning vector. When this
library was screened with the 800 bp BamHI-EcoRI Alu-
probe, 103 phages were positive. Twenty recombinant
phages were picked at random from those exhibiting the
strongest signal. The longest insert found in these
recombinant phages was a 2.3 kb EcoRI fragment, likely
to represent an incomplete cDNA clone. To isolate a more
representative vav cDNA clone, a 300 bp PstI DNA
fragment corresponding to the 5' end of this insert was
purified and used to rescreen the cDNA library. Eleven
phages carrying inserts of 2.5 -2.8 kb were isolated. The
one exhibiting the longest insert was selected for further
studies.
Transforming activity of the vav oncogene
To test whether the vav cDNA clone (2.8 kb) was
biologically active, we subcloned it into the unique EcoRI
site of pMEX, a mammalian expression vector that carries
a multiple cloning site flanked by a Moloney murine sarcoma
virus (MSV) long terminal repeat (LTR) and polyadenyla-
tion signal from SV40. The resulting expression plasmid,
pSK27, induced 103-104 foci per itg of DNA when
transfected into NIH3T3 cells (Graham and van der Eb,
1973). A similar construction in which the cDNA clone was
inserted in the opposite orientation did not have detectable
biological activity (data not shown). vav-induced foci consist
of dense, non-refractile cells that closely resemble those that
spontaneously appear in dense cultures of NIH3T3 cells
(Figure 2A). In addition, the vav-induced foci often exhibit
formation of syncytia resulting in giant multinucleated cells
(Figure 2B). Cells derived from either NIH3T3 foci or from
nude mouse tumors retain a rather normal morphology in
subconfluent cultures. However, the vav-transformed
NIH3T3 cells grow in semisolid media with relatively good
efficiency (0.2-1 %) and readily induce tumors when
injected into nude mice.
Nucleotide sequence analysis
The nucleotide sequence of the biologically active 2.8 kb
cDNA clone of the vav oncogene was determined by an
automated chain-termination method using a difluores-
ceinated primer and laser excitation as described (Brumbaugh
et al., 1988). Single-stranded DNA purified from 5' and 3'
deletion mutants generated by unidirectional deletions using
the Exo III/Mung bean nuclease method were used as
templates for sequencing. Figure 3 depicts the entire nucleo-
tide sequence of the 2765-bp vav oncogene cDNA clone and
the deduced amino acid sequence of its putative gene product.
Several biologically relevant features could be deduced
from the nucleotide sequence: (i) nucleotides 1-167 were
identical to the pSV2neo sequences corresponding to the end
of the SV40 early promoter region (nucleotides 1-17) and
the beginning of the bacterial Tn5 sequences harboring the
neo gene (nucleotides 18-167); (ii) no significant homology
could be detected among sequences located between
nucleotides 168 and 2765 of the vav cDNA clone and those
stored in gene data banks; (iii) the cDNA clone contains a
2391 bp-long open reading frame (nucleotides 111-2501)
capable of coding for a polypeptide of 797 amino acid
residues with a calculated relative molecular mass of 91 641
daltons; (iv) this open reading frame (ORF) is followed by
Fig. 1. (A) Detection of human Alu+ sequences in nude mouse tumors
induced by the vav oncogene. DNAs (20 Ag) isolated from (a)
NIH3T3 cells, (b) second and (c) third-cycle vav-induced nude mouse
tumors were digested with EcoRI and submitted to Southern transfer
analysis (Southern, 1975). Hybridization was conducted for 48 h under
stringent conditions (42°C in 5 x SSC, 50% formamide, 1 x
Denhardt's solution) using 5 x 107 c.p.m. of 32P-labeled nick-
translated high mol. wt human DNA. Filters were exposed to Kodak
XAR-5 film at -70°C for 20 h in the presence of intensifier screens.
X HindHI DNA fragments were used as mol. wt markers. The
migration of the three major Alu+ DNA fragments is indicated by
arrows. (B) Identification of vav oncogene transcripts. Poly(A)-selected
RNA (3 jig) was isolated from (a) NIH3T3 cells and (c) a third-cycle
vav-induced nude mouse tumor and submitted to Northern transfer
analysis (Lehrach et al., 1977). Nitrocellulose filters were hybridized
for 48 h under stringent conditions (50% v/v formrnamide, 42°C) to
5 x 107 c.p.m. of a 32P-labeled nick-translated 800 bp BamHI-EcoRI
DNA derived from an Alu- genomic fragment of the vav oncogene.
The filter was exposed to Kodak XAR-5 film for 30 min. 28S and
18S RNA of Saccharomyces cerevisae and 23S and 16S RNA of
Escherichia coli R-13 were used as mol. wt markers. The migration of
the 3.0 kb vav oncogene transcript is indicated by an arrow.
2284
vav, a novel human oncogene
.4:_
-Es...
0.'
-
I
t
I .
VP
e~ /
.
^l ~ ~~S'* tr t R
sA; ^ tr.,
I.I
...' . ..>
lip
/ w> g '+& 31bi34',Jj)..s z ; 1.
i
,! t~~~
.
00
Fig. 2. Morphology of NIH3T3 cells transfected with the vax oncogene cDNA clone under the transcriptional control of retroviral regulatory
elements. (A) A representative focus. (B) occasional syncytia resulting in the formation of giant multinucleated cells.
264 bp of 3' non-coding sequences that contain a consensus
polyadenylation signal (AATAAA, nucleotides 2738 -2743)
followed 14 residues downstream by a short (8 bp) poly(A)
tail.
Predicted amino acid sequences
The nucleotide sequence of the cDNA clone of the vav
oncogene predicts the synthesis of a 797 amino acid long
polypeptide with the following relevant features (Figure 3):
2285
A
aft
....
1^ ..
f .-_
N
_.
Jt e
I _
*, O.
,.
i.. i `. :-
V
i i
x nf;,
..Idir
.kl
f
.t
f.-:
11
0 .,P
I
"N -.4.
*. i
Ili,
..i
-1 .
...
.1
..
.v
v
:
S.Katzav, D.Martin-Zanca and M.Barbacid
4!
'..**** .*.
-4
-t+
2286
vav, a novel human oncogene
(i) the 19 amino-terminal residues are coded by sequences
derived from the bacterial Tn5 sequences harboring the neo
gene, albeit in a different reading frame than the bacterial
enzyme; (ii) there are six potential N-glycosylation sites
(Asn-X-Ser/Thr), two of which are located within the
rearranged sequences contributed by the bacterial Tn5 gene;
(iii) a 45 amino acid long domain (residues 84-128)
composed of mostly acidic (Glu/Asp) amino acid residues
(23 residues or 51 %); (iv) two proline-rich sequences
including Pro-Pro-Ser-Pro (residues 289-292) and Pro-Pro-
Pro-Pro (residues 558-561) that may represent hinge
regions needed for the appropriate folding of the vav
oncogene product; (v) an Arg-Arg-Gly-Asp-Ser-Tyr motif
(residues 387-392) that may be a phosphorylation site for
protein kinase A (Creighton, 1984); (vi) two putative nuclear
localization signals, Lys-Thr-Arg-Glu-Leu-Lys-Lys-Lys
(residues 438-445) and Lys-Lys-Asp-Lys-Leu-His-Arg-Arg
(residues 527 -534) (Dingwall and Kaskey, 1986); and (vii)
two putative zinc-finger-like motifs (Sunderman and Barber,
1988). The first of these motifs, Cys-X2-Cys-X13-Cys-
X2-Cys (residues 480-500), conforms to the canonical
pattern Cys-X2-4-Cys-X2 15-Cys-X2-4-Cys (Berg, 1986).
Moreover, this type of motif has been found to confer trans-
activating activity to the larger (289 amino acids) of the two
proteins coded for by the adenovirus ElA oncogene (Culp
et al., 1988). The second motif, His-X2-Cys-X6-Cys-
X2-His (residues 505-518), exhibits two histidine residues
in the flanking positions. Although histidine residues often
replace cysteines in the Cys-X2-4-Cys domain, this
particular structure has not been previously described. These
features, taken together, suggest that the vav oncogene might
encode a DNA-binding phosphoprotein, perhaps a
transcriptional factor (Ptashne, 1988).
Mechanism of activation
The above nucleotide sequence suggests that the vav
oncogene became activated by a rearrangement that placed
SV40 regulatory sequences present in the cotransfecting
pSV2neo plasmid DNA in front of a novel cellular proto-
oncogene. Since nucleotide 1 of our vav cDNA clone is
located 46 bp downstream from the major site used in vivo
for the initiation of SV40 early mRNA synthesis (SV40
nucleotide 5237), it is likely that transcription of vav
oncogene sequences is directed by SV40 regulatory elements.
Transcriptional activation of the vav oncogene by the SV40
early promoter raised the possibility that this transforming
gene might have been generated during the course of gene
transfer assays. To prove this hypothesis, DNA isolated from
the original esophageal carcinoma was tested by Southern
transfer analysis along with DNA prepared from white blood
cells of healthy donors and from vav-induced nude mouse
tumors. When the DNAs were probed with a 900 bp PstI
DNA fragment derived from the 5' end of the vav oncogene
cDNA clone, only the mouse tumor DNAs induced by this
oncogene contained rearranged sequences (data not shown).
These results indicate that the vav oncogene became activated
during in vitro manipulations and is unlikely to play a role
in the genesis of human esophageal tumors.
To determine whether additional mutations were required
to activate the vav oncogene, we isolated its normal allele
from a cDNA library of K562 cells (Shtivelman et al., 1985).
K562 is a hematopoietic cell line derived from a chronic
myelogenous leukemia which expresses significant levels of
a 2.9 kb-long vav-related transcript. Two million
recombinant XgtlO phages were screened with the 5' 900 bp
PstI DNA fragment of the vav oncogene. Five phages were
found to be positive, and the one containing the longest insert
(2.8 kb) was subcloned into Bluescript KS and used in sub-
sequent studies.
Comparison of the restriction endonuclease map of this
normal vav cDNA clone with that of its transforming allele
revealed complete identity except at their respective 5' termini
(data not shown). Nucleotide sequence analysis of the 5'
sequences of the normal vav gene transcript confirmed that
they were replaced by those derived from pSV2neo during
the generation of the vav oncogene (Figure 4). Next, we
prepared a chimeric vav gene construct in which the 2.6 kb
Sac -EcoRI DNA fragment of the vav oncogene was
replaced by the corresponding sequences derived from the
normal vav proto-oncogene (Figure 5). The resulting
plasmid, pSK77, exhibited a transforming activity (10
f.f.u./tg) comparable to that of the vav oncogene (Figure 5).
These findings demonstrate that insertion of the pSV2neo
sequences in the 5' domain of the normal vav proto-oncogene
was sufficient for its malignant activation.
vav proto-oncogene expression
In order to gain information regarding the physiological role
of the normal human vav locus, we screened a battery of
human cell lines from distinct lineages for expression of
proto-vav gene sequences. Representative results are depicted
in Figure 6. None of the epithelial, mesenchymal or neuro-
ectodermal cell lines tested expressed detectable levels of
the normal 2.9 kb proto-vav gene transcript (Table I). In
contrast, this transcript could be readily observed in mRNAs
prepared from cell lines of hematopoietic origin (Figure 6).
Cell lines representative of each of the three major
hematopoietic differentiation lineages-lymphoid, myeloid
and erythroid-were found to express approximately
equivalent levels of the 2.9 kb proto-vav gene transcript
Fig. 3. Nucleotide sequence of a vav oncogene cDNA clone. (A) Schematic diagram. Untranslated sequences are depicted by a thin bar. Coding
sequences (flanked by the initiator ATG and terminator TGA codons) are represented by the thicker box. Highlighted domains include sequences
derived from pSV2neo (17), a region rich in acidic amino acid residues (-), two proline-rich stretches (M), a potential target for protein kinase A
phosphorylation (a), two putative nuclear localization signals (3) and two zinc-finger-like domains (EO). Cysteine residues (0) and consensus
glycosylation sites (v) are also shown. (B) Nucleotide and predicted amino acid sequence of the 2765 bp insert of the vav oncogene cDNA clone.
The sequences of the flanking EcoRI linkers have been omitted. Nucleotide numbers are indicated in the right column. Amino acid numbers are
indicated underneath the corresponding residue. Nucleotides I - 17 (SV40 early promoter) and 18- 167 (TnS bacterial gene) are derived from
pSV2neo. Nucleotide 168-2765 are derived from the vav proto-oncogene. The vertical arrow (+) indicates the separation between pSV2neo and vav
proto-oncogene-derived sequences. The presumed initiator ATG codon is boxed and the terminator TGA codon is marked with asterisks. Other in-
frame termination codons are underlined. A consensus polyadenylation signal (AATAAA) is underlined by a wavy line. Sequences encompassing
each of the domains highlighted in the above schematic diagram are indicated as follows: cysteine residues are shaded; consensus glycosylation sites
(Asn-X-Ser/Thr) are underlined by broken lines; the highly acidic region is indicated by solid black underlining; proline rich sequences are
underlined by open bars; the putative nuclear localization signals are indicated by a hatched underlining; the potential site for protein kinase A
phosphorylation is underlined by a crossed bar: and the two zinc-finger-like sequences are boxed.
2287
S.Katzav, D.Martin-Zanca and M.Barbacid
Hindill
Hin
TGGCCCAGGCCCTCCGGGATGGTGTCCTTCTGTGTCAGCTGCrTAACAACCTGCTACCCCATGCCATCAACCTGCGTGAG5TC7
11 11 II I I I 11IAGCGGAACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCG ATGTCAGCTACTGGGCTATCTGGACAAGGGAA,
CCCCCAGATGTCCCAGTTCCTGTGCCTTAAGAACArrAGAACCTTCCTGTCCACCTGCTGTGAGAAGrTCGGC CTCAAGCGGAC
11 1111111111111111111111111111111111111111111111111111111111111111111CGCAAAGAGAAAGCAGTTCCTGTGCCTTAAGAACATTAGAACCTTCCTGTCCACCTGCTGTGAGsAGrTCGGCCTCAAGCGGAC
GTGTGAAC 93 (Table I). Similar results were obtained when normal human
CTAAGGA 63 B-cells, T-cells (either untreated or PHA-stimulated),
CI 184 monocytes or platelets were used instead of cell lines (Table
,IIIGCAAG 154 I). These results indicate that the vav proto-oncogene is
Sacl specifically expressed in cells of the hematopoietic system.
,GCrAW"T 275
Sacl
a 245
Discussion
Fig. 4. Mechanism of activation of the vav oncogene. Comparative
nucleotide sequence analysis of the 5' domains of the vav proto-
oncogene and oncogene cDNA clones. Vertical lines indicate identical
nucleotides. The putative initiator codon (ATG) of the vav oncogene is
boxed. In-frame terminator codons are underlined. The black vertical
arrow indicates the breakpoint between pSV2neo and vav gene
sequences. Diagnostic restriction endonuclease cleavage sites are also
indicated.
Ec7
pSK 27 MSV-LTR
_H
103
Fig. 5. Transforming activity of vav cDNA clones. Expression
plasmids including pSK27, which contains the entire vav oncogene
cDNA sequences (hatched box), and pSK77, which encompasses a
chimeric vav gene containing 5' vav oncogene (hatched box) and 3'
vav proto-oncogene (open box) sequences, were tested for their ability
to transform NIH3T3 cells in gene transfer assays (Graham and van
der Eb, 1975). Sequences derived from pSV2neo are indicated by a
solid black box. Coding cDNA sequences are represented by the thick
boxes. Non-coding sequences are indicated by thin boxes.
Transcriptional regulatory elements (MSV-LTR) and polyadenylation
signal (PA) present in the pMEX expression plasmid are also
indicated.
...
Fig. 6. vav proto-oncogene expression in human cells. Poly(A)-selected
RNAs were isolated from (a) K562; (b) MOLT-4; (c) RPMI-6666; (d)
CMS; (e) U937; (f) KG-1; (g) IM-9; (h) CCRF-CEM; (i) A431; (j)
HOS; (k) T98G; (1) IMR32; (m) Y79; (n) A172; (o) M413; and (p)
SK-N-SH human cell lines. The developmental lineages of each of
these cell lines are described in Table I. RNAs (3 ig) were submitted
to Northern transfer analysis (Lehrach et al. 1977) and hybridized for
48 h under stringent conditions (42°C in 5 x SSC, 50% formamide,
1 x Denhardt's solution) to 32P-labeled nick-translated probes specific
for the vav proto-oncogene cDNA clone (2.8 kb EcoRI DNA
fragment) and chicken ,B-actin (2 kb HindIII DNA fragment of plasmid
B2000, Cleveland et al., 1980). In panel A, the vav proto-oncogene
probe was stripped from the filter prior to hybridization of the (3-actin
probe. In panel B, both probes (7 x 107 c.p.m. of each) were mixed
in the hybridization reaction. Hybridized filters were exposed to Kodak
XAR-5 film at -700C for 4 h in the presence of intensifer screens.
Molecular weight markers are those described in the legend to
Figure 1. The migration of the vav proto-oncogene and 3-actin
transcripts is indicated by arrows.
The vav oncogene was generated by a genetic rearrangement
that replaced its 5' domain by sequences derived from the
bacterial Tn5 gene present in the cotransfecting pSV2neo
DNA used as a selectable marker in gene transfer assays.
This rearrangement also resulted in the transcriptional
activation of vav gene sequences presumably by the
neighboring SV40 early promoter contained within pSV2neo.
At the present time, we do not know whether the trans-
forming properties of the vav oncogene are due to its ectopic
expression in NIH3T3 cells, the modification of its amino-
terminal domain or a combination of both. Isolation of full-
length cDNA clones of the vav proto-oncogene should
provide conclusive information regarding the mechanism of
activation of this human gene.
Analysis of the predicted amino acid sequence of the vav
gene product reveals a particularly hydrophilic molecule rich
in both acidic and basic residues. Glutamic acid is the most
abundant amino acid residue (64 residues or 8.4%). Other
highly charged amino acid residues are lysine (53 residues),
arginine (52 residues) and aspartic acid (46 residues). In total,
charged amino acids represent 31.1 % of all residues. Acidic
residues are concentrated between positions 84 and 128 (23
out of these 45 residues are either glutamic acid or aspartic
acid with a net charge of -23) with total exclusion of basic
residues. Acidic domains are believed to be involved in
protein-protein interactions (Sigler, 1988), thus suggesting
that the vav gene product might be part of a functional protein
complex. In addition, the predicted sequence of the vav
protein contains two clusters of basic residues that could
represent nuclear localization signals (Dingwall and Kaskey,
1986) and a putative site for protein kinase A phosphoryla-
tion (Creighton, 1984). These features suggest that the vav
gene might encode a nuclear phosphoprotein.
The predicted sequence of the vav gene product exhibits
two zinc-finger-like domains. Putative zinc finger domains
have been identified in transcriptional factors such as the
yeast GAL4 and the Xenopus TFIIIA proteins; several
morphogenic gene products of Drosophila; the mammalian
transcriptional activator SPI; and the steroid and retinoic
acid receptor families (Berg, 1986; Evans, 1988; Sunderman
and Barber, 1988). However, it has been recently pointed
out that zinc fingers might not be exclusive to DNA-binding
proteins (Frankel and Pabo, 1988). In the vav protein the
two zinc-finger-like motifs and the N-terminal acidic region
are separated by at least a cluster of prolines (residues
289-292) that are likely to serve as a hinge region separating
two domains presumably involved in DNA binding and
transcriptional activation. This structural feature has been
found in well-characterized transcriptional activators such
as the yeast GCN4 and GAL4 proteins, the jun oncogene
and the steroid receptor family, independently of whether
they mediate their DNA interactions with zinc finger motifs
or not (Ptashne, 1988).
Analysis of vav proto-oncogene transcripts in cells of
various developmental lineages has revealed a truly
2288
proto-vav
proto-vav
vav
proto-vav
vav
11111111
GCCGAGCTC
-------------------------- PA..............
:oRl Sacl
,j--4 EcoRl
EcoRl Sac
pSK 77 MSV-LTR
vav, a novel human oncogene
Table I. vav proto-oncogene expression in human cells
Hematopoietic cells vav Non-hematopoietic cells vav
proto-oncogene proto-oncogene
expression expression
Lymphoid Epithelial
Raji + HeLA
IM-9 + A431 -
Normal B-cells + MCF-7
CCRF-CEM + PA- I -
MOLT-4 + TERA2 -
RPMI-6666 + M413 -
Normal T-cells +
Monocytic Mesenchymal
CMS + HOS -
KG-I + HT-1080 -
U-937 +
Normal monocytes +
Multipotential Neuroectodermal
K562 + U-373 MG -
HEL + HS 683 -
HEL + hemina + SK-N-SH
HEL + TPAb + A172 -
Y79 _
IMR 32 -
T98G -
Other Other
Normal platelets + HuACIlI
aErythroid lineage.
bMonocytic lineage.
remarkable pattern of expression. Whereas no vav mRNA
could be detected in cell lines of epithelial, mesenchymal
or neuroectodermal origin, high levels of vav proto-oncogene
expression were observed in each of the hematopoietic cells
tested, including those of lymphoid, myeloid and erythroid
lineages. The ubiquitous expression of the proto-vav gene
in hematopoietic cells, along with the resemblance of its gene
product to transcriptional factors, raise the possibility that
this locus might be involved in the transcriptional machinery
required for the proliferative maintenance of the
hematopoietic system.
Materials and methods
Cell lines and gene transfer assays
Human cell lines were obtained from the American Type Culture Collection
(ATCC), except for CMS (Monaco et al., 1982) and HuACI1 (Peebles et al.,
1973). Platelets, and B and T lymphocytes were isolated as described
(Timmen and Saksela, 1980; Abe et al., 1986). Isolation of monocytes was
performed by using counterflow centrifugal elutriation (Wahl et al., 1983).
HEL cells were treated with the phorbol ester TPA and with hemin accor-
ding to published procedures (Papayannopoulou et al., 1983; Larson and
Papayannopoulou, 1985). NIH3T3 mouse cells were transfected with 20
Ag of high mol. wt cellular DNA or with 1 jig of plasmid DNA by the
calcium phosphate precipitation technique (Graham and van der Eb, 1973).
Foci of transformed cells were scored after 10-14 days. Tumorigenicity
assays were performed as described (Blair et al., 1982; Fasano et al., 1984).
Tumor appearance was followed up to 2 months after inoculation.
Isolation of genomic and cDNA clones
A vav genomic library was made in XEMBL-4. DNA isolated from a third-
cycle vav-induced nude mouse tumor was partially digested with Sau3AI
and fractionated on sucrose gradients. DNA of 15-20 kb was ligated to
BamHI-digested XEMBL-4 DNA. 106 phage clones were screened by
hybridization with 32P-labeled nick-translated high mol. wt human DNA
under stringent conditions (42°C in 5 x SSC, 50% formamide, 1 x
Denhardt's solution). Filters were washed three times at room temperature
with 2 x SSC, 0.1 % SDS and twice at 55°C with 0. Ix SSC, 0.1 % SDS.
The vav cDNA library in XgtIO was prepared from poly(A)-selected RNA
of a third-cycle vav-induced nude mouse tumor using a cDNA cloning kit
(Amersham). One million phages were screened under stringent conditions
using a 32 P-labeled nick-translated 800 bp BamHI-EcoRi Ala- vav
genomic DNA fragment as a probe. Among those recombinant XgtlO phages
isolated, that containing the longest (2.8 kb) insert was selected for further
studies. Its insert was subcloned into the EcoRI site of Bluescript KS in
both orientations to generate pSK33 and pSK47. A XgtlO cDNA library
(2 x 106 clones) prepared from human K562 cells (Shtivelman et al.,
1985) was hybridized under stringent conditions to a 32P-labeled nick-
translated 2.8 kb vav cDNA probe. A recombinant phage carrying a 2.9
kb vav proto-oncogene insert was isolated and subcloned in Bluescript KS
in both orientations to generate pSK65 and pSK66.
Southern and Northern transfer analysis
High mol. wt DNA was digested to completion with appropriate restriction
endonucleases, electrophoresed in 0.8% agarose gel and submitted to
Southern transfer analysis as described (Southern, 1975). Total cellular RNA
was extracted by the guanidium thiocyanate method (Chirgwin et al., 1979)
and purified by centrifugation through cesium chloride. Poly(A)-containing
RNA was isolated by retention on oligo(dT) columns (Collaborative
Research). Total RNA (10 jig) or poly(A)-selected RNA (3 jig) were
submitted to Northern transfer analysis (Lehrach et al., 1977). The
nitrocellulose filters were hybridized to various 32P-labeled nick-translated
probes for 48 h under stringent conditions (42°C in 5 x SSC, 50%
formamide, 1 x Denhardt's solution).
Nucleotide sequencing
A series of nested deletions were generated from pSK33 and pSK47 by
the combined use of Exonuclease Ill and Mung bean nuclease (Stratagene).
Escherichia coli MV 1193 cells were transformed with the corresponding
deletion mutants and single-strand phages rescued by subsequent infection
with the helper M13 K07 phage. Single-stranded DNAs were prepared from
2289
S.Katzav, D.Martin-Zanca and M.Barbacid
these phages and submitted to nucleotide sequence analysis by an automated
chain termination method using primers with multiple fluorophores
(Brumbaugh et al., 1988). To dctzrmine the sequence of the 5' domain of
the normal vav gene, a 270 bp SacI fragment from pSK65 was subcloned
in both orientations in Bluescript KS. Single-stranded DNA was obtained
from these plasmids and used as a template for sequencing by the
dideoxynucleotide chain termination technique (Sanger et al., 1977) using
the Sequenase kit (USB).
Expression plasmids
pSK27 was generated by subcloning the entire 2.8 kb EcoRI vav oncogene
cDNA insert of pSK33 into the unique EcoRI site of pMEX. pMEX is a
mammalian expression vector in which the polylinker sequences of pUC 18
(minus the HindIll recognition site) are flanked by a Moloney MSV-LTR
and the polyadenylation signal of SV40. pSK77 was generated by subcloning
the 5' 270 bp EcoRI-Sacl DNA fragment of the vav oncogene and the
3' 2.6 kb SacI-EcoRI DNA fragment of the vav proto-oncogene into the
EcoRI site of pMEX.
Acknowledgements
We are indebted to J.Brumbaugh and D.Conway for their help in determining
the nucleotide sequence of the vav oncogene. We would also like to thank
R.Montesano for providing tumor samples, E.Canaani for the K562 cDNA
library, M.Ernst for help with gene transfer assays, and F.Coulier, S.Hughes
and B.Stanton for helpful discussions. Research sponsored by the National
Cancer Institute, DHHS, under contract no. NOI-CO-74101 with Bionetics
Research, Inc. The contents of this publication do not necessarily reflect
the views or policies of the Department of Health and Human Services,
nor does mention of trade names, commercial products or organizations
imply endorsement by the US Government.
Papayannopoulou,T., Nakamato,B., Yokochi,T. Chait,A. and Kannagi,R.
(1983) Blood, 62, 832-845.
Peebles,P.T., Fischinger,P.J., Bassin,R.H. and Papageorge,A.G. (1973)
Nature New Biol.,, 242, 98-101.
Ptashne,P. (1988) Nature, 335, 683-689.
Rapp,U.R., Reynolds,F.H. and Stephenson,J.R. (1983) J. Virol., 45,
914-924.
Sanger,F., Nicklen,S. and Coulson,A.R. (1977) Proc. Natl. Acad. Sci. USA,
74, 5463-5467.
Shimizu,K., Nakatsu,Y., Sekiguchi,M., Hokamura,K., Tanaka,K.,
Terada,M. and Sugimura,T. (1985) Proc. Nat!. Acad. Sci. USA, 82,
5641 -5645.
Shtivelman,E., Lifshitz,B., Gale,R.P. and Canaani,E. (1985) Nature, 315,
550-554.
Sigler,P.B. (1988) Nature, 333, 210-211.
Southern,E.M. (1975) J. Mol. Biol., 98, 503 -5 17.
Southern,P.J. and Berg,P. (1982) J. Mol. Appl. Gen., 1, 327-341.
Sunderman,F.W. and Barber,A.M. (1988) Ann. Clinic. Lab. Sci., 18,
267-288.
Taira,M., Yoshida,T., Miyagawa,K., Sakamoto,H., Terada,M. and
Sugimura,T. (1987) Proc. Natl. Acad. Sci. USA, 84, 2980-2984.
Takahashi,M., Ritz,J. and Cooper,G.M. (1985) Cell, 42, 581-588.
Timmen,T. and Saksela,E. (1980) J. Immunol. Methods, 36, 285-291.
Wahl,L.M., Katona,I.M., Wilder,R.L., Winter,C.C., Haroui,B., Scher,I.
and Wahl,S.M. (1984) Cell. Immunol., 85, 373-383.
Young,D., Waitches,G., Birchmeier,C., Fasano,O. and Wigler,M. (1986)
Cell, 45, 711-719.
Zhan,X., Bates,B., Hu,X. and Goldfard,M. (1988) Mol. Cell. Biol., 8,
3487-3495.
Received February 20, 1989; revised March 29, 1989
References
Abe,H., Rossio,J.L., Ruscehi,F.W., Matsushima,K. and Oppenheim,J.J.
(1986) J. Immunol. Methods, 90, 111-123.
Berg,J.M. (1986) Science, 232, 485-487.
Bishop,M. (1987) Science, 235, 305-310.
Blair,D.G., Cooper,C.S., Oskarsson,M.K., Eader,L.A. and Vande
Woude,G.F. (1982) Science, 281, 1122-1125.
Brumbaugh,J.A., Midderdorf,L.R., Grone,D.L. and Ruth,J.L. (1988) Proc.
Natl. Acad. Sci. USA, 85, 5610-5614.
Chirgwin,J., Przybryla,A., MacDonald,R. and Rutter,W. (1979)
Biochemistry, 18, 5294-5299.
Cleveland,D.W., Lopata,M.A., MacDonald,R.J., Cowan,N.J., Rutter,W.J.
and Kirschner,M.W. (1980) Cell, 20, 95-105.
Creighton,T.F. (1984) Proteins: Structural and Molecular Principles.
Freeman, New York, pp. 83-84.
Culp,J.S., Webster,L.C., Friedman,D.J., Smith,C.L., Huang,W.-J.,
Wu,F.Y.-H., Rosenberg,M. and Ricciardi,R.P. (1988) Proc. Natl. Acad.
Sci. USA, 85, 6450-6454.
Delli Bovi,P., Curatola,A.M., Kern,F.G., Greco,A., Ihmarm,M. and
Basilico,C. (1987) Cell, 50, 729-737.
Dingwall,C. and Kaskey,R.A. (1986) Annu. Rev. Cell. Biol., 2, 367-390.
Eva,A. and Aaronson,S.A. (1985) Nature, 316, 273-275.
Evans,R. (1988) Science, 240, 889-895.
Fasano,O., Birnbaum,D., Edlund,L., Fogh,J. and Wigler,M. (1984) Mol.
Cell. Biol., 4, 1695-1705.
Frankel,A.D. and Pabo,C.O. (1988) Cell, 53, 675.
Fukui,M., Yamamoto,T., Kawai,S., Marvo,K. and Toyoshima,K. (1985)
Proc. Natl. Acad. Sci. USA, 82, 5954-5958.
Graham,F.L. and van der Eb,A.J. (1973) Virology, 52, 456-467.
Ikawa,S., Fukui,M., Veyama,Y. Tamaok,N., Yamamoti,T. and
Toyoshima,K. (1988) Mol. Cell. Biol., 8, 2651-2654.
Kozma,S.C., Redmond,S.M.S., Xiao-Chung,F., Saurer,S.M., Groner,B.
and Hynes,N.E. (1988) EMBO J., 7, 147-154.
Larson,A.E. and Papayannopoulou,T. (1985) Exp. Hematol., 13, 129-135.
Lehrach,H., Diamond,D., Wozney,J.M. and Boedtker,H. (1977)
Biochemistry, 16, 4743-4751.
Martin-Zanca,D., Hughes,S. and Barbacid,M. (1986) Nature, 319,
743-748.
Monaco,G., Vigneti,E., Lancieri,M., Cornaglia-Ferraris,P., Lambertenghi-
Deliliers,G. and Revoltella,R. (1982) Cancer Res., 42, 4182-4189.
Muller,R. and Muller,D. (1984) EMBO J., 3, 1121-1127.
Nakamura,T., Hillova,J., Mariage-Samson,R. and Hill,M. (1988) Oncogene
Res., 2, 357-370.
2290
Các file đính kèm theo tài liệu này:
j_1460_2075_1989_tb08354_x_9149_2106481.pdf