Xây dựng dữ liệu DNA barcode cho loài mỡ Phú Thọ (magnolia chevalieri (dandy) v.s. kumar) phục vụ giám định và nghiên cứu đa dạng di truyền

Nhằm tạo dữ liệu DNA là trình tự nucleotide của một số đoạn ADN đặc trưng thường được sử dụng làm mã vạch để phục vụ giám định và nghiên cứu đa dạng di truyền ở thực vật. Nghiên cứu này đã tiến hành phân lập và xác định trình tự nucleotide của năm đoạn ADN là: matK, rbcL, trnH-psbA, ITS2 và ycf1b ở loài Mỡ phú thọ. Kết quả xác định trình tự nucleotide của các đoạn mã vạch ADN, như sau: đoạn matK có chiều dài 768 nucleotide, đoạn rbcL là 599 nucleotide, đoạn trnH-psbA là 512 nucleotide, đoạn ITS2 là 406 nucleotide và đoạn ycf1b là 1005 nucleotide. So sánh trình tự nucleotide của các đoạn trên với các trình tự nucleotide tương ứng trên ngân hàng gen quốc tế NCBI, chọn trình tự của loài có độ tương đồng cao nhất như sau: đoạn gen matK có độ tương đồng 99,73%, đoạn rbcL tương đồng 99,63%, đoạn trnH-psbA tương đồng 99,22% so với loài Magnolia conifera var. chingii; đoạn ITS2 tương đồng 96,97% so với loài Magnolia figo var. skinneriana và đoạn ycf1b tương đồng 99,5% so với loài Magnolia officinalis subsp. biloba. Trình tự nucleotide các đoạn mã vạch trên đã được đăng ký trên ngân hàng dữ liệu ADN Việt Nam với các mã số (Barcode ID) tương ứng là MMC0001, MMC0002, MMC0003, MMC0004 và MMC0005. Như vậy, cả 5 đoạn mã vạch ADN trên đều có sự khác biệt nhất định so với các loài đã công bố trên Ngân hàng gen quốc tế NCBI trong đó đoạn ITS2 có khả năng phân biệt tốt nhất.

pdf7 trang | Chia sẻ: hachi492 | Lượt xem: 87 | Lượt tải: 0Freedownload
Bạn đang xem nội dung tài liệu Xây dựng dữ liệu DNA barcode cho loài mỡ Phú Thọ (magnolia chevalieri (dandy) v.s. kumar) phục vụ giám định và nghiên cứu đa dạng di truyền, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Biotechnology and Seedling JOURNAL OF FORESTRY SCIENCE AND TECHNOLOGY NO. 2 - 2018 3 TO CREATE DNA BARCODE DATA OF MAGNOLIA CHEVALIERI (DANDY) V.S. KUMAR FOR IDENTIFICATION SPECIES AND RESEARCHING GENETIC DIVERSITY Ha Van Huan1, Luu Thi Thao Nguyen2, Nguyen Minh Quang3 1,2,3Vietnam National University of Forestry SUMMARY To create the nucleotide sequence of DNA barcode database, they are usually used as a DNA barcode to identify species and research of genetic diversity in plants. In this study, the genomic DNA was extracted from leaf tissue of Magnolia chevalieri (Dandy) V.S. Kumar. The DNA barcodes (matK, rbcL, trnH-psbA, ITS2 and ycf1b) were amplified from total DNA of Magnolia chevalieri (Dandy) V.S. Kumar by PCR technique. DNA sequencing by Sanger method and performed on an automated DNA sequencer. The DNA sequences were analyzed using software programs such as Mega6, BioEdit, GeneDoc, DNAClub and ClustalX. The PCR results indicated that all DNA bands were amplified from the samples, they have the same size similar to the theoretical size of matK, rbcL, trnH-psbA, ITS2 and ycf1b. Nucleotide sequence analysis of PCR product samples showed that the size of the isolated matK gene fragment is 768 bp, rbcL fragment is 599 bp, trnH- psbA fragment is 512 bp, ITS2 fragment is 406 bp and ycf1b fragment is 1005 bp. The above nucleotide sequences were compared with the nucleotide sequences in the international gene bank NCBI, the highest level of similarity as follows: the matK fragment and rbcL fragments compared with Magnolia conifera var. chingii species with 99.73% similarity and 99.63% similarity, respectively; the trnH-psbA compared with Magnolia conifera var. chingii pecies with 99.22% similarity and they cf1b fragment compared with Magnolia officinalis subsp. Biloba species 99.5% similarity. The nucleotide sequences of matK, rbcL, trnH-psbA, ITS2 and ycf1b from Magnolia chevalieri (Dandy) V.S. Kumar have been registered on the DNABank.vn with Barcode ID MMC0001, MMC0002, MMC0003, MMC0004 and MMC0005. Recommendation for using ITS2 andtrnH- psbA marker as DNA barcode to identify Magnolia chevalieri (Dandy) V.S. Kumar species. Keywords: DNA barcode, ITS2, Magnolia chevalieri, matK, rbcL, trnH-psbA, ycf1b. I. INTRODUCTION Magnolia chevalieri (Dandy) V.S. Kumar is belonging to Magnoliaceae which is considered as a high economic value wood trees in Vietnam. This type of wood has good quality so it is often used in home furniture, interior decoration and handicraft production (Wang et al., 2004). However, this species is on the list of plants that need to be conserved in the country. In Vietnam, Magnolia chevalieri distributes mainly in Phu Tho, Lao Cai, Vinh Phuc, Ha Noi, Quang Ninh, Tuyen Quang và Thanh Hoa provinces. Magnolia chevalieri is hardly found in natural forest, therefore, the conservation of Magnolia chevalieri genetic resources is essential. Previously, identification and classification of plants were mainly based on morphological methods. Although there have been improvements in the application process, there are still many difficulties as in cases that the samples have been distorted (nature, colour changes), Processed samples can not be identified. In fact, the identification of some species belonging to Magnoliaceae based on morphological indicator sometimes faces with difficulties and can be confused. Hence, More accurate identification and classification methods are required to overcome these limitations (Chase et al., 2005; Group, 2009). Recently, the development of DNA barcode technology application which is an advanced method, using the sequence of short DNA strands featured in the genome of the organism to identify and distinguish species, brings high efficiency in a short time, contributes to improve the drawbacks of the previous method (Ha Van Huan, 2015). In this study, we Biotechnology and Seedling JOURNAL OF FORESTRY SCIENCE AND TECHNOLOGY NO. 2 - 2018 4 conducted a selection of five specific DNA sequences to use as DNA barcodes which are: matK, rbcL, trnH-psbA, ITS2 and ycf1b. In which, matK, rbcL, trnH-psbA, ycf1b sequencesare located in the chloroplast genome, ITS2 sequencein the nuclear gennome (Chase et al., 2005; Group, 2009; Kress et al., 2008; Kress et al., 2005; Spooner et al., 2009; Von et al., 2011). Hence, the study of DNA barcode data construction is used as indicative standard DNA molecule in order to serve the identification and study of genetic relationship of Magnolia chevalieri (Dandy) V.S. Kumaris necessary, contributes to natural resources management, national precious gene sources conservation and development. II. RESEARCH METHODOLOGY Objects, materials Research Object: Magnolia chevalieri (Dandy) V.S. Kumar. Research Materials: 3 young leaf samples were taken from 3 different trees of Magnolia chevalieri (Dandy) V.S. Kumar which were accurately identified by the scientific names. Once collected, samples were stored in plastic bags containing silica gel desiccant, then stored at - 20°C to extract DNA for research. Symbols of Magnolia chevalieri (Dandy) V.S. Kumar samples were taken in accordance with their abbreviations and scientific names of species: MMC1, MMC2, MMC3. The primers were designed for cloning fragments of DNA sequences as in table 1. Table 1. List of primers to clone the fragments of DNA barcode Forward/Reverse Primers Primer sequence (dimensional 5’ - 3’) Cloned fragments of DNA barcode matK - mLKTF 5’- TTCCATGGCCTTCTTTBCATTTGTTGC - 3’ matK matK - mLKTR 5’- TTCCATGGTTTTTTGAGGATCCGCTGT - 3’ rP1F 5’- ATGTCACCACAAACAGAGACTAAAGC -3’ rbcL rP1R 5’- GTAAAATCAAGTCCACCRCG -3’ trnPF1 5’- GTTATGCATGAACGTAATGCTC -3’ trnH - psbA psbPR1 5’- CGCGCATGGTGGATTCACAATCC -3’ Chemicals: The chemicals used to isolate the total DNA from Calocedrus macrolepis leaf samples: Plant DNA Isolation Kit of Norgen, Canada; Chemicals for PCR cloning fragments of DNA barcode: Master mix of iNtRON Biotechnology, Korea; PCR Purification Kit of Norgen, Canada; Chemicals for electrophoresis on Agarose gel: Agarose, 1 kb DNA Ladder, RedSafeTM nucleic acid staining solution provide by Norgen, Canada. Research methods Total DNA isolation Total DNA is isolated from leaf samples of Magnolia chevalieri under the guidance of Plant DNA Isolation Kit, Norgen, Canada. Concentration, purity and integrity levels of total DNA are determined by spectrophotometric and electrophoresis methods on 1% agarose gel. Cloning fragments of DNA barcodes by PCR technique The fragments of DNA such as: matK, rbcL, trnH-psbA, ITS2 and ycf1 bare cloned by PCR technique on PCR 9700 Thermal Cycler Applied Biosystems (USA), each PCR reaction was performed in a total volume of 20 μl, including: H2O deion (7 µl), 2x PCR Master mix Solution (10 µl), 10 pmol/µl of forward primers (1.0 µl), 10 pmol/µl of reverse primers (1.0 µl) and 50 ng/µl of DNA template (1 µl). PCR reaction program: 94oC in 2 minutes; (94oC: 30 seconds, 59oC: 30 seconds, 72oC: 1 minute) repeating 40 cycles; 72oC in 5 minutes; PCR product preservation is at 4oC. Primer melting temperature (Tm) of reactions are different depending on the used primers. Biotechnology and Seedling JOURNAL OF FORESTRY SCIENCE AND TECHNOLOGY NO. 2 - 2018 5 Each PCR reaction was repeated 3 times on each sample. PCR results aretested by electrophoresis on 1.2% agarose gel and observed under ultraviolet light (UV). PCR products are purified according to instructions of PCR Purification Kit of Norgen, Canada. Identification and analysis of nucleotide sequences of cloned DNA fragments PCR products cloned fragments of DNA barcodes after purification are sent to the 1 st Base lab in Malaysia for sequencing. The nucleotide sequence of the DNA fragment is determined by sequencer, using Kit BigDye® Terminator v3.1 Cycle Sequencing. The nucleotide sequences of DNA fragment are processed and analyzed using specialized software such as DNAClub, Biohit, Mega6... The nucleotide sequence of DNA barcode fragments after processing are registered in the Vietnamese DNA database bank (www.dnabank.vn). III. RESULTS AND DISCUSSION Result of total DNA extraction from Magnolia chevalieri (Dandy) V.S. Kumar leaves Total DNA extracted from leaves of Magnolia chevalieri (Dandy) was tested by Electrophoresis on 1.0% agarose gel to preliminarily evaluate the content and quality. The result of electrophores is test shows that the DNA band is relatively sharp, with little break age, it proves that the total DNA is quite intact. The concentration and purity of the DNA solution is determined by Spectrophotometric method at A260nm and A280nm wavelengths. The result shows that the total DNA solution extracted from leaves of Magnolia chevalieri (Dandy) ensures the technical requirements to make molds for cloning the being interested DNA fragments. Result of cloning DNA barcode fragments using PCR Total DNA products after extracting and diluting to the appropriate concentration will be used directly as a mold for cloning matK, rbcL, trnH-psbA, ITS2 and ycf1b fragments using specific pairs of primers. The composition and reaction cycle are described in the method section. Each PCR reaction was repeated 3 times on each sample. PCR products were examined by electrophoresis on 1.2% agarose gel, using marker 1 kb. Electrophoresis The result shows that the corresponding DNA bands appear to the right size as expected: Figure 1. PCR result of DNA barcode fragments cloning A. PCR result of matK gene fragment cloning; B. rbcL; C. trnH - psbA; D. ITS2; E. ycf1b; M. DNA marker 1 kb of Norgen E M M1 M2 M3 ycf1b 1.000 bp 1.500 M M1 M2 M3 matK 700 bp 1000 A M M1 M2 M3 rbcL 300 bp 500 B D M M1 M2 M3 ITS2 300 bp 500 M M1 M2 M3 trnH-psbA 500 bp 700 C Biotechnology and Seedling JOURNAL OF FORESTRY SCIENCE AND TECHNOLOGY NO. 2 - 2018 6 Electrophores is result of PCR product off DNA barcode fragments on 1% agarose gel shows that DNA bands are bold, sharp, with no by products and right with the expected size, it proves that PCR products are specific, can be purified and directly used to proceed to determine nucleotide sequence of barcode fragments for Magnolia chevalieri (Dandy) V.S. Kumar. The result of identifying and analyzing the nucleotide sequence of the DNA barcode PCR products of DNA barcode fragments after purification were proceeded to determine the nucleotide sequence. The result of sequencing analysis shows that matK, rbcL, trnH-psbA, ITS2 and ycf1b fragments have the lengths of 768 bp, 599 bp, 512 bp, 406 bp and 1005 bp accordingly. The above result shows that the lengths of the corresponding DNA barcode fragments are equal to the expected length and band size on electrophores is gel. Comparing DNA sequences in all three iterations, we found no significantly difference, matK, rbcL, trnH-psbA, ITS2 and ycf1b sequence fragments were registed in Vietnamese DNA Data Bank (DNABank.vn) with the corresponding Barcode IDs: MMC0001, MMC0002, MMC0003, MMC0004 and MMC0005. Table 2. The nucleotide sequence of the matK gene fragment, including 768 nucleotides Barcode ID: MMC0001 5’TTCCATGGCCTTCTTTGCATTTATTGCGATTCTTTCTCCACGAGTATCGTAATTCGAATAGTCT CATTACTCCAAAGAAATCCATTTCTCTTTTTTCAAAAGAGAATCAAAGATTCTTCTTGTTACTA TATAATTCTCATGTATATGAATGTGAATCCGTATTAGTGTTTCTCCGTAAACAATCTTCTCATTT ACGATCAACATCCTCTGGAACTTTTCTTGAGCGAACACATTTCTATGGAAAAATAGAACATCT TGTAGTAGTGCTTCGTAATGATTTTCAGAAGACCCTATGGTTGTTCAAGGACCCTTTCATGCAT TATGTCAGATATCAAGGAAAATCCATTCTGGCTTCAAAGGGGACTCATCTTCTGATGAAGAAA TGGAAATCTCACCTTGTCCATTTTTGGCAATGTCATTTTTACTTGTGGTCTCTACCGGACAGGA TCCATATAAACCAATTATACAATCATTCCTTATATTTTCTGGGCTATCTTTCAAGTGTACGACT AAACACTTCGGTGGTAAGGATTCAAATGCTAGAGAATTCATTTCTAATAGATACTTCTATTAAT AAATTCGAGACCCTAGTCCCAATTATTCCTCTGATTGGATCAGTGGCTAAAGCGAAATTTTGTA ACGTATCAGGGCATCCCATTAGTAAGTCGGTCCGGGCCGATTCGTCAGATTCTGATATTATCA ATCGATTTGGGCGGATATACAGAAATCTTTCTCATTATCACAGTGGATCCTCAAAAAACCATG GAA-3’ Table 3. The nucleotide sequence of the rbcL gene fragment, including 599 nucleotides Barcode ID: MMC0002 5’ATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACA AATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAG TAACTCCTCAACCCGGAGTTCCACCTGAGGAAGCAGGGGCTGCGGTAGCTGCCGAATCTTCTA CTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGAT GCTACCACATCGAGCCCGTTCCTGGGGAGGAAAGTCAATTTATTGCTTATGTAGCTTACCCTTT AGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGG TTCAAAGCCCTACGAGCTCTACGTCTGGAGGATCTGCGAATTCCTACTGCTTATGTCAAAACTT TCCAAGGCCCGCCCCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCAC TATTGGGATGTACTATTAAACCAAAATTGGGGTTATCCGCCAAGAACTACGGTAGGGCGGTTT ATGAATGTCTCCGTGGTGGACTTGATTTTAC-3’ Biotechnology and Seedling JOURNAL OF FORESTRY SCIENCE AND TECHNOLOGY NO. 2 - 2018 7 Table 4. The nucleotide sequence of the trnH-psbA gene fragment, including 512 nucleotide Barcode ID: MMC0003 5’CGCGCATGGTGGATTCACAATCCACTGCCTTGAGCCACTTGGCTACATCCGCCCCTCCGCTCT AATTTCCACCATTCATGATTATTGTATTGAGTCTTTCTTACTTTCTGAGATACAGATATTGAAC ATAAAATGCCAATCCTGTAAATTGTAAATGTACAAAGAAATTCCTTTATGAAAAAAAAAAAG AAAATGATTTTGAGGAACATACAGAAATTACAATACAGATCGGTACAAAACAAAAATAGGAT GTTCGATCATGAACCAACCAACAATAATGTTTTCTTAAGTTGAAATAAAGAAATGAAAATGGC AAAAATGTTTCTGTGAATAAAACACTACTGAATCGAACGGATCAATACCCAACTTCTTGATAG AACAAGAAGTTGGGTATTGATCGGATCCTTCAACGACTCATATACACTAAGACTGAAGTATTA TCCATTTGTAGATGGAACTTCAACAGCAGCTAGGTCTAGAGGGAAATTGTGAGCATTACGTTC ATGCATAAC-3’ Table 5. The nucleotide sequence of the ITS2 gene fragment, including 406 nucleotide Barcode ID: MMC0004 5’ATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGC GCCCGAGGCCACCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCACCGTGCTGCCCCACCCG GCGCCCGCCCCACCCGGCGGCGGCGCCGCGGGGCGGAGACTGGCCGCCCGTGCGCCCCGCGC GCGCGGCCGGCTGAAAAGCATTCGCTCCCCCCCGCCGGGGCGCGGACGCGGCGGTAGGTGGT TTGAGAGGCGGCTGCCTCGTCGGAGCCCGGACGCCGCGCCCGTCGCCCCGCGCGGCGAAGTG GCACCCAGCTCGGCCGCCCCCGCGCGGCCCTCGCGCAGCGACCCCAGGTCAGGCGGGGACAC CCGCTGAGTTTAAGCATATCAATAAGCGGAGGA-3’ Table 6. The nucleotide sequence of the ycf1b gene fragment, including 1005 nucleotide Barcode ID: MMC0005 5’ACGAAAATCCGATTGTTGCGAGTAACGTATCAACGCCACCTCTTCTGCTTGATCACTATTAG TACTGGTACTAGTATAAGTATTGGTATTCTGATCATTATTGGTATTCTGATCATTATTGGTATTC TGATCATTATTGGTATTCTGATCATTATTGGTATTCTGATCATTATCAGTATAAATTACTACAC GTTTGGCTTTTCTTGAACGAATCCCATGATCCTCTGTCGATTCTTCCTCATTTTCTGCCTCCTGT TCTTCCAAATGGCCGGTTAATTTGTATGACCATCGAGGAACCTTTTTACCGATTTCTTCTATTCC AATAGATTTCTTTTGAATTGTTTGATCATTTGGATCAGTTGTAACTACATCGGATAGAAATTTC AAACATTTCGTTTGATTTTCTGAATCAAGTCTTGTTTGTTCGACCAATAGAGCAAATCCTTTCA AATTCAAACTAGGTGTTGATTCCCCAGCTAATTCACTGATTGAGGTCAAGGAATGACCAATGT CTGTCGATAATGATTCTCCATTAAATAAATCCATTTTTTGTTCAAATTCTCGGTAATCGTTAGG AAAGATACCATGAATCTTATTTATCCAAACCTTTTCTATGGAATCTTCTGTCCAAGTGATTGAA TCATCCATAATTGAACGTGAATATCCTTTTTTGGTTGTTCCACGATATGATCCGTTCAAAAAAG GATCATATATTTTAGGCAAGCATTCTTGTTCATTCTCATTATTGCACAATCTTGTCCTTTTTTCG AGCACATCCAGAGTAAGAGTTCCCCTGTCTAGGGCTTCTATTCGATTTACGAACTCATTGCTCA AGTTGTTCCTTTTTTGTTCATTGGTAGAAACCCAATGATTATACAGATCCTCCGGGGATAATAG TTTTTCTGTCGTACGCAAAGACATCTTTCTTTGTATCATTTCCCCAAAAGTCGACAAACTAGGG GGATATGTAAAAGATATTCGTTTTTTTCCATCACTTGGACATGT-3’ We conducted a comparison of the nucleotide sequences of DNA barcode fragments (matK, rbcL, trnH-psbA, ITS2 and ycf1b) of Magnolia chevalieri (Dandy) V.S. Kumar with the nucleotide sequence of the corresponding barcode fragments of other Magnolia sp. on the NCBI international gene bank, then selected the species with the highest similarity in nucleotide sequence, the results are shown in table 7. Biotechnology and Seedling JOURNAL OF FORESTRY SCIENCE AND TECHNOLOGY NO. 2 - 2018 8 Table 7. Comparing the nucleotide sequence of the barcodes matK, rbcL, trnH-psbA, ITS2 and ycf1b of Magnolia chevalieri Dandy V.S. Kumar with the nucleotide sequence of the corresponding barcode fragments of other Magnolia sp. published on the NCBI No DNA barcode fragment Species for comparison NCBI Accession No. Differential nucleotides Simil-arity (%) 1 matK Magnolia conifera var. chingii JN050058.1 2 99.73 2 rbcL Magnolia conifera var. chingii JN50121.1 2 99.63 3 trnH-psbA Magnolia conifera var. chingii JN05177.1 3 99.22 4 ITS2 Magnolia figo var. skinneriana KP092910.1 11 96.97 5 ycf1b Magnolia officinalis subsp. biloba JN867581.1 5 99.5 Results of the analysis showed that when comparing the sequence of 5 fragments of DNA matK, rbcL, trnH-psbA, ITS2 and ycf1b of Magnolia chevalieri (Dandy) V.S. Kumar with other species in the same genus, all DNA fragments have a definite difference compared to those published in the NCBI gene bank, hence, all 5 of these fragments are valid for use. However, the degree of variation of the indicators is different, the larger indicator's difference, the greater its value, in which ITS2 indicator has the most difference (3.03%), followed by trnH-psbA, ycf1b, rbcL and matK. From the result of the analysis of DNA barcode nucleotide sequence, we recommend using ITS2 and trnH-psbA indicators to identify anddetermine the genetic relationship for Magnolia chevalieri (Dandy) V.S. Kumar, however, to increase accuracy, they can be combined with other indicators such as ycf1b, rbcL and matK. IV. CONCLUSION Successfully cloned matK, rbcL, trnH- psbA, ITS2 and ycf1b sequence fragmentsby PCR technique. Sequence analysis result shows that the lengths of matK, rbcL, trnH- psbA, ITS2 and ycf1b fragments are 768 bp, 599 bp, 512 bp, 406 bp and 1005 bp accordingly. The nucleotide sequences of the above barcodes have been registered on the DNA database of Vietnam with corresponding barcode IDMMC0001, MMC0002, MMC0003, MMC0004 and MMC0005. The result of the sequential comparison of the DNA fragments shows that the matK fragment has a similarity of 99.73%, followed by rbcL, trnH-psbA 99.63%, 99.22% respectively compared to Magnolia conifera var. chingii; ITS2 fragment has a similarity of 96.97% with Magnolia figo var. skinneriana and ycf1b fragment has 99.5% similarity with Magnolia officinalis subsp. biloba. Using ITS2 and trnH-psbA indicators to identify and determine the genetic relationship for Magnolia chevalieri (Dandy) V.S. Kumar, however, to increase accuracy, they can be combined with other indicators such as ycf1b, rbcL and matK. ACKNOWLEDGEMENT The work is done within the framework of the project “Creating a database of DNA barcode for some economic-value large timber trees, non-timber forest products” (2014 - 2017) under the Core Program of Development and Application of Biotechnology in Agriculture and Rural Development to 2020, Ministry of Agriculture and Rural Development. The study was conducted in Vietnam National University of Forestry. REFERENCES 1. Chase MW, Salamin N, Wilkinson M, Dunwell JM, Kesanakurthi RP, Haider N, Savolainen V (2005). Land plants and DNA barcodes: Short-term and long- term goals. Philos Trans R Soc Lond B Biol Sci, 360: 1889-1895. Biotechnology and Seedling JOURNAL OF FORESTRY SCIENCE AND TECHNOLOGY NO. 2 - 2018 9 2. Wang DL, Li ZC, Hao G, Chiang TY, Ge XJ (2004). Genetic diversity of Calocedrus macrolepis (Cupressaceae) in southwestern China. Biochem Syst Ecol, 32: 797-807. 3. Ford C, Ayres K, Toomey N, Haider N, Stahl J, Kelly L, Wikstrom N, Holling sworth P, Duff R, Hoot S, Cowan R, Chase M, Wilkinson M (2009). Selection of candidate coding DNA barcoding regions for use on ADN plants. Bot J Linn Soc, 159(1): 1-11. 4. Group CPW (2009). A DNA barcode for land plants. Proc Natl Acad Sci USA, 106: 2794-2797. 5. Kress JW, Wurdack KJ, Zimmer EA, Weigt LA, Janzen DH (2005). Use of DNA barcodes to identify flowering plants. Proc Natl Acad Sci USA, 102(23): 8369-74. 6. Kress JW, Erickson DL (2008). DNA barcodes: Genes, genomics, and bioinformatics. Proc Natl Acad Sci USA, 105(8): 2761-2762. 7. Kress JW, Wurdack KJ, Zimmer EA, Weigt LA, Janzen DH (2005). Use of DNA barcodes to identify flowering plants. Molecular Econogy Proc Natl Acad Sci USA, 102: 8369-8374. 8. Spooner DM (2009). DNA barcoding will frequently fail in complicated groups: an example in wild potatoes. Am J Bot, 96: 1177-1189. 9. Storchova H, Olson MS (2007). The architecture of the chloroplast psbA-trnH non coding region in angiosperms. Plant sys and evol, 268: 235-256. 10. Von Crautlein MKH, Pietilainen M, Rikkinen J (2011). DNA barcoding: a tool for improved taxon identification and detection of species diversity. Biodivers Converv, 20: 373-389. 11. Ha Van Huan, Nguyen Van Phong (2015). Identification of DNA Barcode sequence for Tam Dao yellow tea (Camellia tamdaoensis): An endemic plant species of Vietnam. Science and Technology Journal of Agriculture and Rural Development. 5: 123-130. XÂY DỰNG DỮ LIỆU DNA BARCODE CHO LOÀI MỠ PHÚ THỌ (MAGNOLIA CHEVALIERI (DANDY) V.S. KUMAR) PHỤC VỤ GIÁM ĐỊNH VÀ NGHIÊN CỨU ĐA DẠNG DI TRUYỀN Hà Văn Huân1, Lưu Thị Thảo Nguyên2, Nguyễn Minh Quang3 1,2,3Trường Đại học Lâm nghiệp TÓM TẮT Nhằm tạo dữ liệu DNA là trình tự nucleotide của một số đoạn ADN đặc trưng thường được sử dụng làm mã vạch để phục vụ giám định và nghiên cứu đa dạng di truyền ở thực vật. Nghiên cứu này đã tiến hành phân lập và xác định trình tự nucleotide của năm đoạn ADN là: matK, rbcL, trnH-psbA, ITS2 và ycf1b ở loài Mỡ phú thọ. Kết quả xác định trình tự nucleotide của các đoạn mã vạch ADN, như sau: đoạn matK có chiều dài 768 nucleotide, đoạn rbcL là 599 nucleotide, đoạn trnH-psbA là 512 nucleotide, đoạn ITS2 là 406 nucleotide và đoạn ycf1b là 1005 nucleotide. So sánh trình tự nucleotide của các đoạn trên với các trình tự nucleotide tương ứng trên ngân hàng gen quốc tế NCBI, chọn trình tự của loài có độ tương đồng cao nhất như sau: đoạn gen matK có độ tương đồng 99,73%, đoạn rbcL tương đồng 99,63%, đoạn trnH-psbA tương đồng 99,22% so với loài Magnolia conifera var. chingii; đoạn ITS2 tương đồng 96,97% so với loài Magnolia figo var. skinneriana và đoạn ycf1b tương đồng 99,5% so với loài Magnolia officinalis subsp. biloba. Trình tự nucleotide các đoạn mã vạch trên đã được đăng ký trên ngân hàng dữ liệu ADN Việt Nam với các mã số (Barcode ID) tương ứng là MMC0001, MMC0002, MMC0003, MMC0004 và MMC0005. Như vậy, cả 5 đoạn mã vạch ADN trên đều có sự khác biệt nhất định so với các loài đã công bố trên Ngân hàng gen quốc tế NCBI trong đó đoạn ITS2 có khả năng phân biệt tốt nhất. Từ khóa: ITS2, mã vạch ADN, matK, Mỡ phú thọ, rbcL, trnH-psbA, ycf1b. Received : 07/3/2018 Revised : 28/3/2018 Accepted : 05/4/2018

Các file đính kèm theo tài liệu này:

  • pdfxay_dung_du_lieu_dna_barcode_cho_loai_mo_phu_tho_magnolia_ch.pdf