Khóa luận Tìm hiểu về vi khuẩn Salmonella

- Trong thực nghiệm trên, có một số phần do thời gian quá gấp mà tôi chưa thể thực hiện được + Khảo sát tình trạng vi sinh của khu buôn bán + Khảo sát qua tình hình giết mổ gia cầm trên địa bàn thành phố Hồ Chí Minh - Lập các trung tâm kiểm dịch trên địa bàn các quận và yêu cầu thịt trước khi bán cần phải qua kiểm dịch và sử dụng các dụng cụ phân phối hợp vệ sinh - Nên lập các địa điểm bán thực phẩm tập trung để dễ dàng kiểm tra vệ sinh khu buôn bán. Thường xuyên tổ chức các đợt kiểm tra khu chăn nuôi và giết mổ để đảm bảo vệ sinh an toàn thực phẩm

doc48 trang | Chia sẻ: baoanh98 | Ngày: 12/12/2018 | Lượt xem: 37 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Khóa luận Tìm hiểu về vi khuẩn Salmonella, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
.paratyphi B và đến năm 1898, S.paratyphi A đã tìm được do N.Guyn và H Keyser. Phân loại - Về phân loại khoa học Salmonella được xếp vào: ? Giới : Bacteria ? Ngành: Proteobacteria ? Lớp: Gramma Proteobacteria ? Bộ: Enterobacteriales ? Họ: Enterobacteriaceae ? Giống: Salmonella lignieres 1900 - Lúc đầu, các loài Salmonella được đặt tên theo hội chứng lâm sàng của chúng như S.typhi hay S.paratyphi A, B, C (typhoid = bệnh thương hàn, para = phó), hoặc theo vật chủ như S.typhimurium gây bệnh ở chuột (murine = chuột), về sau người ta thấy rằng 1 loài Salmonella có thể gây ra nhiều hội chứng và có thể phân lập được ở nhiều loài khác nhau. Vì những lý do đó mà các chủng Salmonella mới phát hiện được đặt tên theo nơi mà nó được phân lập như S.teheran, S.congo, S.london. - Salmonella đã từng được chia thành các chi phụ và nhiều loài, mỗi loài lại có khả năng có chi phụ. Ví dụ như loài Salmonella enterica được chia thành 6 loài phụ gồm S.enterica, S.salamae, S.arizonae, S.diarizonae, S.houtenae và S.indica. - Bằng các kỹ thuật sinh học phân tử hiện đại, những nghiên cứu sau này cho phép xếp tất cả các loại Salmonella vào 1 loài duy nhất. Mặc dù ý kiến này đã được nêu ra nhưng cách truyền thống đã được sử dụng quá quen và có ý nghĩa riêng nên nó không được chấp nhận. - Dựa vào cấu trúc kháng nguyên, chủ yếu là kháng nguyên thân O và kháng nguyên lông H, Salmonella được chia thành các nhóm và các type huyết thanh. Hiện nay được xác định gồm trên 2500 type huyết thanh Salmonella. Đặc điểm Đặc điểm chung và đặc điểm nuôi cấy - Salmonella là trực khuẩn Gram âm, kích thước trung bình từ 2 – 3 x 0,5 – 1 µm, di chuyển bằng tiên mao trừ S. gallimarum và S. pullorum, không tạo bào tử, chúng phát triển tốt ở nhiệt độ 60C – 420C, thích hợp nhất ở 350C – 370C, pH từ 6 – 9 và thích hợp nhất ở pH = 7,2. Ở nhiệt độ từ 180C – 400C vi khuẩn có thể sống đến 15 ngày. - Salmonella là vi khuẩn kỵ khí tùy nghi. phát triển được trên các môi trường nuôi cấy thông thường. Trên môi trường thích hợp, vi khuẩn sẽ phát triển sau 24 giờ. Có thể mọc trên những môi trường có chất ức chế chọn lọc như DCA (deoxycholate citrate agar) và XLD (xylose lysine deoxycholate), trong đó môi trường XLD ít chất ức chế hơn nên thường được dùng để phân lập Salmonella. Khẩn lạc đặc trưng của Salmonella trên môi trường này là tròn, lồi, trong suốt, có tâm đen, đôi khi tâm đen lớn bao trùm khẩn lạc,môi trường xung quanh chuyển sang màu đỏ. Hình 2.3 : Vi khẩn Salmonella Tính chất hóa sinh - Salmonella không lên men lactose, lên men đường glucose và sinh hơi. Thường không lên men sucrose, salicin và inositol, sử dụng được citrate ở môn trường Simmons. - Tuy nhiên không phải loài Salmonella nào cũng có những tính chất trên, các ngoại lệ được xác định là S.typhi lên men đường glucose không sinh hơi, không sử dụng citrate trong môi trường Simmon, hầu hết các chủng S.paratyphi và S.Cholerasuis không sinh H2S, khoảng 5% các chủng Salmonella sinh độc tố sinh bacteriocin chống lại E.Coli, Shigella và ngay cả 1 số chủng Salmonella khác. Cấu trúc của Salmonella - Salmonella có ba loại kháng nguyên, đó là những chất khi xuất hiện trong cơ thể thì tạo ra kích thích đáp ứng miễn dịch và kết hợp đặc hiệu với những sản phẩm của sự kích thích đó, gồm: kháng nguyên thân O, kháng nguyên lông H và kháng nguyên vỏ K. Vi khuẩn thương hàn (S.typhi) có kháng nguyên V (Virulence) là yếu tố chống thực bào giúp cho vi khuẩn thương hàn phát triển bên trong tế bào bạch cầu. - Kháng nguyên vách tế bào (kháng nguyên thân O) + Thành phân cơ bản là vách tế bào có cấu trúc phức tạ p gồm 2 lớp. Trong cùng là một lớp peptidoglycan mỏng, cách một lớp không gian chu chất và tới lớp màng ngoài (outer membrane) là phức hợp lipidpolysaccharide gồm lipoprotein và lipopolysaccharide. + Bao bên ngoài lớp peptidoglycan là lớp phospholipid A và B (quyết định độc tố của Nội độc tố), sau đó là hai lớp polysaccharide không mang tính đặc hiệu. Kháng nguyên của nội độc tố có bản chất hóa học là lypopolysaccharide (LPS). Tính đặc hiệu của kháng nguyên O và LPS là một, nhưng tính miễn dịch thì khác nhau : kháng nguyên O ngoài LPS còn bao gồm cả lớp peptidoglycan nên tính sinh miễn dịch của nó mạnh hơn LPS. Màng ngoài có cấu trúc gần giống tế bào chất nhưng phospholipid hầu như chỉ gặp ở lớp trong, còn ở lớp ngoài là lipopolysaccharide dày khoảng 8- 10 nm gồm 3 thành phần : Lipid A, polysaccharide lõi, kháng nguyên O. Màng ngoài còn có thêm các protein: Protein cơ chất: porin ở vi khuẩn còn gọi là protein lỗ xuyên màng với chức năng cho phép một số loại phân tử đi qua chúng như dipeptide, disaccharide, các ion vô cơ. Protein màng ngoài: chức năng vận chuyển một số phân tử riêng biệt và đưa qua màng ngoài. Lipoprotein: đóng vai trò liên kết lớp peptidoglycan bên trong với lớp màng ngoài - Kháng nguyên lông (kháng nguyên H) +Kháng nguyên H: Chỉ có ở các Salmonella có lông. Hầu hết Salmonella đều có lông chỉ trừ S.galilarum, S.pulorum gây bệnh cho gia cầm. Kháng nguyên H là một loại kháng nguyên có bản chất là protit, kém bền hơn kháng nguyên O. Kháng nguyên H rất dễ bị phá huỷ ở nhiệt độ cao hoặc xử lý bằng cồn, axit yếu. + Kháng nguyên H chia làm 2 phase : F Phase 1: Có tính chất đặc hiệu gồm có 28 loại kháng nguyên lông được biểu thị bằng chữa số La tinh thường: a, b, c F Phase 2: Không có tính chất đặc hiệu, loại này có thể ngưng kết với các loại khác đôi khi thành phần này có thể gặp ở E.coli. Pha 2 gồm có 6 loại được biểu thị bằng chữa số Ả Rập 1-6 hay chữa số La Tinh e, n, x - Kháng nguyên vỏ K + Kháng nguyên K: Không phức tạp, có một kháng nguyên vỏ là kháng nguyên Vi và cũng có ở 2 type huyết thanh S.typhi và S.paratyphi. Kháng nguyên Vi – angtigen được Felix và các cộng sự phát hiện năm 1935. Kháng nguyên Vi gây hiện tượng ngưng kết chậm và xuất hiện các hạt vỏ, kháng nguyên Vi là kháng nguyên vỏ bao bọc bên ngoài kháng nguyên O, khánh nguyên Vi không tham gia vào quá trình gây bệnh. Yếu tố độc lực - Vi khuẩn Salmonella có thể tiết ra 2 loại độc tố: Ngoại độc tố và nội độc tố. + Nội độc tố của Salmonella rất mạnh gồm 2 loại: Gây xung huyết và mụn loét, độc tố ở ruột gây độc thần kinh, hôn mê, co giật. + Ngoại độc tố chỉ phát hiện khi lấy vi khuẩn có độc tính cao cho vào túi colodion rồi đặt vào ổ bụng chuột lang để nuôi, sau 4 ngày lấy ra, rồi lại cấy truyền như vậy từ 5 đến 10 lần, sau cùng đem lọc, nước lọc có khả năng gây bệnh cho động vật thí nghiệm. Ngoại độc tố chỉ hình thành trong điều kiện invivo và nuôi cấy kỵ khí. Ngoại độc tố tác động vào thần kinh và ruột. Nội độc tố - Endotoxin - Màng ngoài tế bào vi khuẩn gram âm nói chung và vi khuẩn Salmonella nói riêng, được cấu tạo bởi thành phần cơ bản là lipopolysaccharide (LPS). LPS có cấu tạo phân tử lớn, gồm 3 vùng riêng biệt với đặc tính và chức năng riêng biệt: Vùng ưa nước, vùng lõi và vùng lipit A. - Vùng ưa nước bao gồm một chuỗi polysaccharide chứa các đơn vị cấu trúc kháng nguyên O. Vùng lõi có bản chất là acid heterooligosaccharide, ở trung tâm nối kháng nguyên O với vùng lipit A. Vùng lipit A đảm nhận chức năng nội độc tố của vi khuẩn. Cấu trúc nội độc tố gần giống cấu trúc của kháng nguyên O. Cấu trúc nội độc tố biến đổi sẽ dẫn đến sự thay đổi độc lực của Salmonella. - Nội độc tố thường là lipopolysaccharide (LPS) được phóng ra từ vách tế bào vi khuẩn khi bị dung giải. Trước khi thể hiện độc tính của mình, LPS cần phải liên kết với các yếu tố liên kết tế bào hoặc các receptor bề mặt các tế bào như: Tế bào lâm ba cầu B, lâm ba cầu T, tế bào đại thực bào, tiểu thực bào, tế bào gan, lách.Rất nhiều các cơ quan trong cơ thể chịu sự tác động của nội độc tố LPS: Gan, thận, cơ, hệ tim mạch, hệ tiêu hoá, hệ thống miễn dịch; với các biểu hiện bệnh lý: Tắc mạch máu, giảm trương lực cơ thiếu oxy mô bào, toan huyết, rối loạn tiêu hoá, mất tính thèm ăn - Nội độc tố tác động trực tiếp lên hệ thống miễn dịch của cơ thể vật chủ, kích thích hình thành kháng thể. - LPS tác động lên các tế bào tiểu cầu, gây sốt nội độc tố, theo cơ chế : + Giải phóng các chất hoạt động mạnh như: Histamin. + Ngưng kết các tiểu cầu động mạch. + Đông vón, tắc mạch quản. - LPS tác động lên quá trình trao đổi gluxit: LPS làm tăng cường hoạt lực của các men phân giải glucoz, các men phân giải glycogen, làm giảm hoạt lực các men tham gia quá trình tổng hợp glycogen Độc tố đường ruột - Về cơ chế miễn dịch và di truyền các Enterotoxin của Salmonella có quan hệ gần gũi với Choleratoxin, nên được gọi là Choleratoxin like enterotoxin (CT). Còn về đặc tính sinh học Enterotoxin của Salmonella không chỉ với giống CT mà còn giống với Enterotoxin của E.Coli. - Độc tố đường ruột của vi khuẩn Salmonella có hai thành phần chính: Độc tố thẩm xuất nhanh Rapid permeability facto (RPF) và độc tố thẩm xuất chậm Delayed permeability facto (DPF). - RPF giúp Salmonella xâm nhập vào tế bào biểu mô của ruột, nó thực hiện khả năng thẩm xuất sau 1-2 giờ và kéo dài 48 giờ và làm trương các tế bào CHO (Chinese Hamster Ovary cell). Độc tố thẩm xuất nhanh có cấu trúc, thành phần giống với độc tố chịu nhiệt của E.Coli, được gọi là độc tố chịu nhiệt của Salmonella. ST có khả năng chịu được nhiệt độ 1000C trong 4 giờ, bền vững ở nhiệt độ thấp, có thể bảo quản ở nhiệt độ -20oC. Cấu trúc phân tử gồm một chuỗi polysaccharide và một chuỗi polypeptide. - RPF kích thích co bóp nhu động ruột, làm tăng sự thẩm thấu thành mạch, phá huỷ tổ chức tế bào biểu mô ruột, giúp vi khuẩn Salmonella xâm nhập vào tế bào và phát triển tăng nhanh về số lượng. Vi khuẩn tích cực tăng cường sản sinh độc tố làm rối loạn cân bằng trao đổi muối, nước và chất điện giải. Quá trình bệnh lý đường ruột và hội chứng tiêu chảy càng thêm phức tạp và nghiêm trọng. - DPF của Salmonella có cấu trúc, thành phần giống độc tố không chịu nhiệt của vi khuẩn E.Coli, nên được gọi là độc tố không chịu nhiệt của Salmonella. Nó thực hiện chức năng phản ứng chậm từ 18-24 giờ. LT bị phá huỷ ở 700C trong vòng 30 phút và ở 560C trong vòng 4 giờ. LT có cấu trúc gồm 3 chuỗi polypeptid. - DPF làm thay đổi quá trình trao đổi nước và chất điện giải, dẫn đến tăng cường bài xuất nước và chất điện giải từ mô bào vào lòng ruột, cản trở sự hấp thu, gây thoái hoá lớp tế bào villi của thành ruột, gây tiêu chảy. Độc tố tế bào - Khi cơ thể người và động vật bị tiêu chảy thì kèm theo hiện tượng mất nước và mất chất điện giải là hiện tượng hàng loạt các tế bào biểu mô ruột bị phá huỷ hoặc bị tổn thương ở các mức độ khác nhau. Sự phá huỷ hay tổn thương đó là do độc tố tế bào của Salmonella gây nên, theo cơ chế chung là: Ức chế tổng hợp protein của tế bào Eukaryotic và làm trương tế bào CHO. - Ít nhất 3 dạng độc tố của tế bào: + Dạng thứ nhất: Không bền vững với nhiệt và mẫn cảm với trypsin. Dạng này được phát hiện ở rất nhiều serovar Salmonella; có trọng lượng phân tử trong khoảng từ 56 đến 78 kDa; không bị trung hoà bởi kháng thể kháng độc tố Shigella toxin hoặc Shigella - like. Độc tố dạng này tác động theo cơ chế là ức chế tổng hợp protein của tế bào Hela và làm teo tế bào. + Dạng thứ hai: Có nguồn gốc từ protein màng ngoài tế bào vi khuẩn có cấu trúc và chức năng gần giống các dạng độc tố tế bào do Shigella và các chủng (ETEC) sản sinh ra. Dạng độc tố này cũng phổ biến ở hầu hết các serovar Salmonella gây bệnh. + Dạng thứ ba: Có trọng lượng phân tử khoảng 62 kDa; có liên hệ với độc tố Hemolysin. Hemolysin liên hệ với các độc tố tế bào có sự khác biệt với các Hemolysin khác về trọng lượng phân tử và phương thức tác động lên tế bào theo cơ chế dung giải các không bào nội bào. Cơ chế gây bệnh - Tất cả các kiểu huyết thanh Salmonella đều mang cụm gen inv (invasion) giúp cho quá trình xâm nhiễm vào trong thành ruột của người và động vật, mở đầu của tiến trình gây bệnh. Cụm gen này nằm trong hệ thống gen SPI - 1 (Salmonella pathogenicity island) có mặt trong tất cả các Salmonella, từ nhóm tiến hoá thấp nhất là S.bongori đến nhóm tiến hoá cao nhất là S.enterica. Cơ chế gây bệnh thương hàn - Bệnh thương hàn do S.typhi và S.paratyphi A, B, C gây ra. Các yếu tố độc lực chính của vi khuẩn thương hàn là khả năng bám và xâm nhập vào tế bào chủ, khả năng nhân lên trong đại thực bào và nội độc tố. Kháng nguyên Vi có mặt ở S.typhi và S.pararatyphi C là yếu tố độc lực quan trọng, những chủng vi khuẩn gây bệnh thương hàn không có kháng nguyên Vi thì số lượng cần thiết để gây bệnh cao hơn rất nhiều so với những chũng có kháng nguyên này. - Vi khuẩn xâm nhập vào cơ thể qua đường tiêu hóa do thức ăn hay nước uống bị nhiễm bẩn, số lượng cần thiết để gây bệnh vào khoảng 105 đến 107 - Đầu tiên, vi khuẩn thương hàn phải vượt qua môi trường axit của dạ dày, mặc dù chúng có khả năng đề kháng với axit nhờ có gen art (acid response tolerance), nhưng ở người bình thường, vi khuẩn thương hàn không thể tồn tại lâu, nuôi cấy dịch dạ dày âm tính sau 30 phút. Sau khi vượt qua được rào cản ở dạ dày, vi khuẩn di chuyển xuống ruột non rồi nhân lên ở đó, nhưng trong tuần đầu sẽ có 1 ít vi khuẩn đào thải theo phân, cấy phân dương tính trong 5 ngày không có nghĩa là bệnh thương hàn sẽ xảy ra. Từ ruột non, vi khuẩn thương hàn đi vào hạch mạc treo ruột nhờ tế bào M, một đại thực bào của mảng Peyer. Sau đó theo đường bạch huyết và máu gây nhiễm trùng toàn thân. Sau khoảng một tuần, nhiễm khuẩn huyết thứ phát xuất hiện. Vi khuẩn theo gan qua đường mật lại tiếp tục xâm nhập vào ruột non, tiếp tục nhân lên ở các mảng Peyer. Từ máu, vi khuẩn tới lách và các cơ quan khác. Trong ruột non, vi khuẩn chết và giải phóng ra nội độc tố. Nội độc tố kích thích dây thần knh giao cảm ở ruột gây ra hoại tử chảy máu và có thể gây thủng ruột, vị trí gây tổn thương thường nằm ở các mảng Peyer. Đây là biến chứng hay gặp ở cá bệnh nhân ăn sớm khi chưa bình phục, nhất là ăn các thức ăn cứng. Nội độc tố theo máu lên hệ thần kinh và kích thích trung tâm thần kinh thực vật ở não thất ba. Giai đoạn toàn phát bệnh, bệnh nhân sốt cao, biểu đồ thân nhiệt tăng lên theo thởi gian. Thân nhiệt tăng những nhiệt độ không tăng gây ra hiện tượng mạch và nhiệt độ phân ly. - Thời kì chưa có điều trị bằng kháng sinh, khoản một tuần ủ bệnh, diễn biến điển hình của bệnh thương hàn trải qua 4 giai đoạn, mỗi giai đoạn khoảng một tuần, Tuần thứ nhất thân nhiệt tăng cao, tuần thứ hai thì đau bụng, gan và lách to dồng thời có sự xuất hiện của các đốm hồng trên da, tuần thứ 3 có thể xuất hiện thêm các biến chứng như xuất huyết, thủng ruột, tuần thứ 4 sẽ xuất hiện thêm các biến chứng nguy hiểm dẫn đến tử vong, nếu không bệnh nhân sẽ bình phục. - Bệnh nhân thường đau đầu, buồn nôn hoặc nôn, chướng bụng, tiêu chảy, khoản 50% bệnh nhân sờ thấy gan và lá lách dưới sườn. Những trường hợp nặng thường có dấu hiệu ly bì, hôn mê, trụy tim mạch, không chữa trị kịp thời có thể dẫn đến tử vong. Những biến chứng khác như viêm phổi cấp,, viêm màng não, viêm gan, viêm tủy xương cũng có thể gặp. - Những bệnh nhân qua khỏi có khoảng 5 – 10% vẫn tiếp tục thải vi khuẩn qua phân trong quá trình hồi phục và 1- 4% trở thành người mang vi khuẩn lâu dài do vi khuẩn vẫn tồn tại trong túi mật. Tình trạng này có thể kéo dài đến nhiều năm và họ trở thành nguồn mang bệnh rất nguy hiểm. Cơ chế gây nhiễm khuẩn và nhiễm độc thức ăn - Bênh thường xảy ra do ăn phải thức ăn bị nhiễm Salmonella, nhưng cũng có thể lây truyền trực tiếp. Căn nguyên thường do vi khuẩn S.enteritidis và S.typhimurium. - Vi khuẩn xâm nhập qua ruột non nhờ các tế bào M của mảng Peyer. Trên bộ gen của Salmonella có các tác nhân gây ức chế các chất kháng khuẩn có trong lysosome, biến đổi tế bào chủ đảm bảo cho sự tồn tại của vi khuẩn, làm cản trở hoạt động nội bào như giảm lượng NADH oxidase rất cần thiết cho việc sản xuất các hợp chất kháng khuẩn. - Sự hủy hoại của đại thực bào và các tế bào biểu mô lân cận, sự chết của vi khuẩn giải phóng nội độc tố đã gây nên tổn thương cho cơ thể vật chủ và gây ra các triệu chứng. - Thời gian ủ bệnh trung bình từ 10 – 48 giờ. Sau thời gian ủ bệnh, người nhiễm thường có biểu hiện như sốt, nôn, đau bụng và tiêu chảy. Mức độ sốt khác nhau tùy vào thể trạng từng người, tiêu chảy phân thường không có máu. Ở người lớn thường chỉ dẫn đến tình trạng rối loạn đường tiêu hóa, nhưng ở trẻ sơ sinh thường gây ra nhiễm trùng rất nặng, có thể dẫn đến tình trạng nhiễm khuẩn huyết, viêm màng não và viêm xương. Ở những người khỏe mạnh, nhiễm trùng do nhiễm độc thức ăn thường tự khỏi sau 2- 5 ngày rồi tự khỏi. Nguồn gốc lây nhiễm - Các sản phẩm thịt nói chung, nhất là thịt gia cầm và thịt lợn. Tất cả các thức ăn tươi sống có nguồn gốc động vật đều có thể là nguồn vi khuẩn Salmonella. Vi khuẩn này sống tự do trong ruột động vật và có trên lông. Gia cầm có nhiều Salmonella nhất, tiếp theo là các động vật nuôi trong nhà và động vật hoang (vẹt, rùa, chó, ếch, chim mông biển, loài gặm nhấm, rắn). Vi khuẩn này có thể có trong thành phần dẫn xuất các chất từ động vật như gelatin hoặc nước bọt động vật, bởi côn trùng, loài gặm nhấm, chim hoặc các sản phẩm thịt nhiễm khuẩn gây nhiễm vào thực phẩm. Ngoài ra có thể bị nhiễm từ người khỏe mạnh có mang vi khuẩn này. Thực phẩm có nguồn gốc thực vật ít có nguy cơ nhiễm khuẩn. Vì lí do bị ức chế bởi pH < 4 và có mặt vi khuẩn lactic nên các sản phẩm lên men ít bị nhiễm. Trứng và các sản phẩm trứng ví dụ như bột nhào, nước sốt mayonnaise, protit đông tụ tách từ sữa, gia cầm là nguồn mang nhiều Salmonella, nên trứng của nó cũng bị nhiễm vì vi khuẩn này có thể xuyên qua vỏ trứng và sinh sản trong lòng đỏ trứng. - Các sản phẩm sữa như sữa không thanh trùng, phomát từ sữa tươi, kem chất béo sữa, và các sản phẩm từ sữa nói chung được chế biến từ các nông trại, các thiết bị đều có thể gây nhiễm vào nguyên liệu, tạo môi trường thuận lợi choSalmonella, và từ đó gây nhiễm độc cho sản phẩm sữa. Nếu tiến hành axit hóa chậm thì vi khuẩn dễ dàng sinh sản trong phomát nhưng nó bị phá hủy với pH < 4,5. Những sản phẩm có sữa phải được giám sát chặt chẽ bởi chúng không được thanh trùng nữa, vì vậy nếu cóSalmonella trong sữa bột thì chúng vẫn có thể sinh sản được bởi chúng có khả năng tồn tại ở điều kiện khô hạn và lây nhiễm sang các sản phẩm khác Tình hình nhiễm Salmonella trong nước và trên thế giới Trên thế giới - Tỷ lệ nhiễm Salmonella ở châu Âu giảm đều đặn từ những năm 1990 trở lại đây, trong năm 2007 có khoảng 152.000 ca nhiễm Salmonella trên người được phát hiện, sự sai lệch của báo cáo này là rất lớn, số lượng thực tế rất có thể gấp 10 lần như thế. Ở Mỹ, tình trạng có khá hơn, ổn định ở mức 15 ca trên 100.000 người từ năm 2001 do kiểm soát tốt Salmonella trong thực phẩm từ năm 1990, bao gồm các thực phẩm sữa, trứng, nước trái cây, sản phẩm tươi sống, rau, bánh kẹo, và đặc biệt là thịt. Một đợt dịch gần đây ở Mỹ gây ra bởi S.typhimurium nhiễm trong bơ đậu phộng đã gây ảnh hưởng đến hơn 700 người trên khắp nước Mỹ - Từ tháng 7/2009 tới nay, số ca nhiễm khuẩn Salmonella được phát hiện ở Mỹ đã tăng lên 184 người, thuộc 38 bang khác nhau. Cơ quan y tế của nước này vẫn chưa xác định nguyên nhân chính xác khiến số ca nhiễm khuẩn Salmonella tăng nhanh như vậy. Tuy nhiên, mới đây các chuyên gia y tế của bang Oregon cho rằng nguồn lây lan vi khuẩn Salmonella từ các sản phẩm xúc xích. Vừa qua, các cơ quan điều tra Mỹ đã thu hồi hơn 560 tấn xúc xích do nghi bị nhiễm vi khuẩn Salmonella, tất cả số lượng này đều do Công ty Daniele International sản xuất.Tuy nhiên, ông Jason Maloni, phát ngôn viên của công ty này khẳng định: “Chưa có bằng chứng nào chứng minh các sản phẩm xúc xích của chúng tôi bị nhiễm vi khuẩn Salmonella”. Sự bùng nổ của số ca nhiễm khuẩn Salmonella ở khu vực tây bắc Thái Bình Dương đã khiến các cơ quan điều tra nghi ngờ rằng nguồn gây bệnh cho ổ dịch này là từ các sản phẩm xúc xích sau khi họ phát hiện rất nhiều người ăn xúc xích mua tại các cửa hàng ở khu vực này bị nhiễm khuẩn Salmonella. Các nhân viên điều tra tại bang Washington cũng cho biết 14 bệnh nhân bị nhiễm khuẩn Salmonella ở bang này, đã từng ăn xúc xích của hãng Daniele. Ngoài ra, các chuyên gia y tế khẳng định họ đã kiểm tra và phát hiện khuẩn Salmonella có trong các mẫu xúc xích của công ty này. Hiện tại, các nhân viên điều tra liên bang Mỹ vẫn đang làm việc để tìm ra nguyên nhân chính xác gây ra dịch nhiễm khuẩn Salmonella ở nước này. Vì thế, họ vẫn chưa thể kết luận sản phẩm xúc xích của Công ty Daniele có phải là nguồn lây bệnh chính hay không. Vì thế, những sản phẩm xúc xích của công ty này bị thu hồi là do kiểm tra bị nhiễm khuẩn Salmonella. Trong nước - Theo ông Nguyễn Công Khẩn, Cục trưởng Cục ATVSTP cho biết, hiện nay, mạng lưới kiểm nghiệm ATVSTP đã được hình thành rộng khắp trong cả nước nhưng thực tế năng lực kiểm nghiệm nhiều chỉ tiêu về an toàn thực phẩm tại các địa phương vẫn rất hạn chế. Trong 330 mẫu hoa quả có tới 2,7% số mẫu có tỷ lệ tồn dư thuốc bảo vệ thực vật cao, nhất là ở táo đỏ, quýt và lê. Đặc biệt, trong số 1.416 mẫu thịt và sản phẩm từ thịt đã phát hiện tới 40,9% số mẫu nhiễm khuẩn Salmonella gây ra các bệnh về đường tiêu hóa. Hơn nữa, khu vực TP Hồ Chí Minh và Đồng Nai là những địa phương có tỷ lệ mẫu thực phẩm nhiễm Salmonella cao nhất, chiếm từ 84- 95% mẫu được giám sát. Các phương pháp phát hiện Salmonella Phương pháp truyền thống Nguyên tắc - Salmonella có thể được phát hiện ( phân tích định tính ) bằng một quy trình bao gồm 4 bước là tăng sinh, tăng sinh chọn lọc, phân lập và khẳng định. Salmonella thường có mặt trong mẫu với một số lượng nhỏ, bị tổn thương và cùng hiện diện chung với một số lượng lớn vi sinh vật thuộc họ Enterobacteriaceae có tính cạnh tranh mạnh và ức chế sự tăng trưởng của Salmonella. + Bước tăng sinh : tùy theo đặc tính thành phần hóa học của mẫu cần chọn quy trình tăng sinh phù hợp. Thông thường tỷ lệ giữa mẫu và môi trường tăng sinh là 1 : 9, tuy nhiên tùy trường hợp mà tỷ lệ này có thể thay đổi + Bước tăng sinh chọn lọc : Các môi trường tăng sinh chọn lọc thường dùng để phát hiện Salmonella trong các mẫu thực phẩm là Rappaport Vassiliadis (RV), Selenite Cystein Broth,Tetrathionate Mueler Kauffmanm Broth (TT ) Các nghiên cứu gần đây cho thấy môi trường RV có thể thay thế cho các môi trường khác để phân tích nhiều mẫu khác nhau. Tuy vậy, môi trường TT thường được dùng để phân tích các mẫu thịt tươi sống, các mẫu có mật độ nhiễm cao, các mẫu thức ăn gia súc Hiện nay người ta khuyến khích là nên dùng ít nhất hai loại môi trường tăng sinh chọn lọc để phát hiện tất cả các serotype Salmonella nếu có hiện diện trong mẫu. + Bước phân lập : nhằm tách và nhận dạng Salmonella khỏi các quần thể vi sinh vật khác trong mẫu. Nhiều loại môi trường rắn khác nhau được sử dụng để phân lập Salmonella, mỗi môi trường giúp nhận dạng các giống của nhóm này dựa trên một vài đặc tính. Hiện nay, các tiêu chuẩn vệ sinh an toàn thực phẩm khuyến khích sử dụng ít nhất 2 loại môi trường phân lập khác nhau để tăng cường khả năng phát hiện tất cả các dòng Salmonella, đặc biệt là môi trường XLD được khuyến khích sử dụng + Bước khẳng định : nhằm xác định lại các khuẩn lạc đặc trưng của Salmonella xuất hiện trên môi trường phân lập. Bước này dựa trên các thử nghiệm sinh hóa và các thử nghiệm huyết thanh đặc trưng cho Salmonella. Các thử nghiệm sinh hóa được khuyến khích sử dụng là KIA/TSI, indol, LDC (Lysine decarboxylase), ODC ( Ornithine decarboxylase ), urea, manitol, sorbitol, các thử nghiệm huyết thanh O và H đa giá. - Môi trường và hóa chất + Buffered Pepton Water (BPW) + Rappaport Vassiliadis Soya Pepton (RV) + Malachite Green Magnesium Chloride + Tetrethionate Muller – Kauffmanm + Xylose Lysine Deoxycholate (XLD) + Hektoen Entric Agar (HE) + Bismuth Sulphite Agar (BS) + Brillian Green Phenol Red Lactose Sucrose (BPLS) + Triple Sugar Iron (TSI) + Urea + Lysine Decarboxylase + Ornithine Decarboxylase + Manitol + Sucrose + Sorbitol + Tryptone + Thuốc thử Kovac’s + Kháng huyết thanh Salmonella đa giá Phương pháp thực hiện Tăng sinh - Đối với các loại mẫu thông thường, tiến hành cân 25g mẫu vào túi PE vô trùng, bổ sung 225ml dung dịch BPW và đồng nhất mẫu trong 15 hoặc 30 giây. Ủ ở 370C trong 18 – 24 giờ. Đối với một số loại mẫu có chứa các chất gây độc hoặc ức chế sự phát triển của Salmonella cần tiến hành quy trình đặc biệt + Đối với thịt gia cầm tươi sống : Đặt gia cầm vào một túi PE lớn, cho them 1 lít BPW, lắc bằng máy lắc 30 giây để môi trường thấm vào toàn bộ mẫu + Đối với mẫu sữa khô : Cân 25g mẫu vào túi PE vô trùng, cho thêm 225ml BPW, để yên ở nhiệt độ phòng khoảng 60 phút. Sau đó lắc cho tan hoàn toàn + Đối với các mẫu gia vị hay các loại thực phẩm chứa nhiều gia vị : đồng nhất mẫu với tỷ lệ 1/100 trong BPW ( thay vì 1/10 như bình thường ) trước khi tăng sinh. Biện pháp này nhằm giảm nồng độ các chất ức chế sự tăng trưởng của Salmonella trong bước tăng sinh + Đối với các loại mẫu như casein, phomat, bơ và các sản phẩm tương tự khác : thực hiện dồng nhất mẫu trong môi trường tăng sinh đã được làm ấm đến 400C + Đối với các sản phẩm chứa coca: đồng nhất mẫu trong môi trường Skim Milk Broth được làm ấm đến 400C + Đối với dừa, các sản phẩm từ dừa và các mẫu có hàm lượng chất béo cao: đồng nhất mẫu trong môi trường BPW, sau đó cho thêm 2 – 3 giọt Triton X – 100 trước khi ủ tăng sinh Tăng sinh chọn lọc + Lắc để trộn đều dịch tăng sinh, sau đó chuyển 0,1ml sang 10ml môi trường tăng sinh chọn lọc RV đã được ủ ấm đến 420C. Ủ ở 420C trong 18 – 24 giờ, khi cần thiết có thể kéo dài ủ thêm 24 giờ + Một số môi trường tăng sinh chọn lọc khác cũng được sử dụng, mỗi loại môi trường chỉ có tác dụng chọn lọc dựa trên một đặc điểm phát triển của Salmonella, một số dòng chỉ có thể tăng trưởng trong môi trường này mà không thể tăng trưởng trong môi trường khác. Do vậy, để tăng khả năng phát hiện tất cả các dòng Salmonella hiện diện trong thực phẩm cần phải dùng ít nhất hai loại tăng sinh chọn lọc khác nhau cho cùng một mẫu. Ngoài ra mỗi môi trường cần được ủ ở các nhiệt độ khác nhau Phân lập và nhận diện + Dùng que cấy vòng thực hiện kỹ thuật cấy phân lập khuẩn lạc đơn với giống từ dịch tăng sinh chọn lọc trên đĩa môi trường phân lập đặc trưng cho Salmonella như XLD, HE, BS Cường độ chọn lọc và mức độ phân biệt thể hiện ở hình thái của khuẩn lạc Salmonella trên từng môi trường cũng khác nhau. Để chọn lọc và nhận dạng tất cả các dòng Salmonella cần sử dụng ít nhất hai loại môi trường chọn lọc phân biệt khác nhau cho cùng một mẫu. Các biểu hiện của Salmonella trên từng môi trường khác nhau như sau + Môi trường XLD: khuẩn lạc tròn, lồi, trong suốt, có hay không có tâm đen, đôi khi tâm đen quá lớn bao trùm khuẩn lạc, môi trường xung quanh chuyển sang màu hồng Hình 2.4: Khẩn lạc đặc trưng của Salmonella trên môi trường XLD + Môi trường HE: khuẩn lạc có màu thay đổi từ xanh dương đến xanh lục, có hay không có tâm đen, đôi khi tâm đén quá lớn bao trùm khuẩn lạc Hình 2.5: Khuẩn lạc đặc trưng của Salmonella trên môi trường HE + Môi trường BS: khuẩn lạc có màu nâu xám hay màu đen, thỉnh thoảng có ánh kim tím, môi trường chuyển thành màu nâu và sau đó chuyển sang màu đen nếu kéo dài thời gian ủ Hình 2.6: Khẩn lạc đặc trưng của Salmonella trên môi trường BS Khẳng định + Từ mỗi môi trường phân lập cấy chuyển ít nhất 5 khuẩn lạc đặc trưng qua môi trường không chọn lọc như TSA. Ủ ở 370C trong 18 – 24 giờ. Các khuẩn lạc đặc trưng trên môi trường này được sử dụng cho các test sinh hóa và huyết thanh + Các thử nghiệm sinh hóa chính cần thực hiện cho Salmonella là: lên men glucose, urea, manitol, indol, H2S, VP, ODC, LDC, saccharose, sorbitol. Các chủng Salmonella cho kết quả thử nghiệm như sau + Thử nghiệm H2S (KIA hay TSI): Salmonella chỉ lên men được đường glucose trong môi trường, vì vậy phần nghiêng của môi trường có màu đỏ, phần sâu có màu vàng. Đa số các chủng Salmonella đều có khả năng sinh H2S nên có các vạch màu đen trong môi trường. Có thể quan sát thấy hiện tượng sinh hơi qua hiện tượng làm vỡ thạch hoặc môi trường bị đẩy lên để lại một khoảng hở dưới đáy ống nghiệm + Thử nghiệm LDC (+): sau khi nuôi cấy, môi trường bị kiềm hóa, màu không đổi ( màu tím hay xanh ) + Thử nghiệm urea (-): Salmonella không phân giải urea nên không làm thay đổi pH của môi trường, sau khi nuôi cấy môi trường vẫn giữ nguyên màu + Lên men manitol, sorbitol (+): môi trường sau khi nuôi cấy bị acid hóa chuyển sang màu vàng. + Thử nghiệm indol và VP (-) Thử nghiệm Môi trường Biểu hiện đặc trưng H2S TSI/KIA Phần nghiêng đỏ, sâu vàng, nứt thạch và xuất hiện vạch đen LDC LDC Không đổi màu Urea Urea Không đổ màu Manitol,sorbitol Manitol, sorbitol Bị acid hóa,môi trường chuyển sang màu vàng Indol Trypton Không xuất hiện vòng đỏ khi nhỏ thuốc thử Kovac’s VP VP Không đổi màu khi nhỏ α – napthol 5% và KOH 40% Bảng 2.1: Biểu hiện đặc trưng của Salmonella trong test sinh hóa - Các thử nghiệm kháng nguyên cần được thử nghiệm song song với mẫu đối chứng bằng nước muối sinh lý để tránh hiện tượng ngưng kết giả. Hai loại huyết thanh đa giá cần dùng là Salmonella Polyvalent O và Salmonella Polyvalent H. Phản ứng (+) khi chủng thử nghiệm ngưng kết kháng huyết thanh nhưng không ngưng kết với nước muối sinh lý Phương pháp hiện đại - Phương pháp truyền thống mất khá nhiều thời gian (5 ngày) để cho ra kết quả, do đó người ta đã phát triển rất nhiều phương pháp thử nhanh để phát hiện Salmonella trong các mẫu thực phẩm và mẫu nước trong thời gian ngắn, từ đó có biện pháp xử lý kịp thời đối với các mẫu nhiễm. Xu hướng sử dụng PCR và IMS thường đượ c sử dụ ng. Phương pháp PCR giúp phát hiện nhanh; tuy nhiên dễ xảy ra hiện tượng âm tính giả, đòi hỏi các thao tác phải thành thạo. Multiplex PCR giúp tiết kiệm thời gian, số lượng mẫu và chi phí; tuy nhiên lại có độ nhạy kém hơn. Người ta đã phát triển thêm phương pháp Real Time PCR từ PCR truyền thống. Phương pháp này có độ nhạy rất cao, cho kết quả sớm hơn, không cần phải chạy điện di sau phản ứng khuếch đại. Phương pháp miễn dịch từ phân tách là một lựa chọn tốt hơn. Nó có độ nhạy cao (< 104 CFU/ml), thời gian ngắn (thí nghiệm được thực hiện trong 4-5 giờ). - Bên cạnh những kỹ thuật Sinh học phân tử cơ bản để phát hiện và định danh Salmonella, còn có những phương pháp khác, như: phương pháp miễn dịch (huyết thanh học, kỹ thuật ELISA, Western blot). Và đôi khi để tăng hiệu quả, độ tin cậy cho xét nghiệm người ta c̣n kết hợp nhiều phương pháp với nhau, ví dụ: IMS-PCR assay (Immunomagnetic Separation and Polymerase Chain Reaction) để phát hiện Salmonella trong thực phẩm. Phương pháp PCR - Nguyên tắc : Phương pháp định tính này dựa vào việc xác định đoạn ADN đích có được khuếch đại hay không. Quá trình xác định được thực hiện bằng cách điện di sản phẩm khuếch đại trên gel agarose, nhuộm màu ADN bằng etyl bromua và quan sát bằng đèn UV có bước sóng là 302 mm. Nếu trong mẫu có gen đích, trên bảng gel điện di sẽ xuất hiện sản phẩm khuếch đại có kích thước phù hợp với độ dài của đoạn ADN đích đã định. Nếu trong mẫu không có gen đích, trên gel diện di không xuất hiện sản phẩm khuếch đại hay sản phẩm khuếch đại có kích thước không phù hợp với đoạn ADN đích. - Thiết bị, dụng cụ, hoá chất và môi trường + Thiết bị, dụng cụ + Tủ ấm 37oC. + Máy luân nhiệt. + Máy ly tâm dùng cho ống eppendorf 1,5 ml. + Máy lắc ống nghiệm. + Thiết bị điện di ngang và bộ nguồn điện di có điện thế hoạt động từ 80 đế 150 volt. + Hộp đèn soi UV có kính lọc 302mm. + Bộ chụp ảnh trên đèn UV. + Ống Eppendorf 0,2. 0,5 ml; 1,5 ml chuyên dùng cho PCR. + Hoá chất, môi trường - Mồi gồm hai mồi invA1 và invA2 được thiết lập cách nhau 520 bp trong gen invA có vai trò trong quá trình xâm nhiễm Salmonella vào thành ruột động vật và người. Trình tự của hai mồi như sau : + invA1 : 5' - TTGTTACGGCTATTTTGACCA -3' + invA2 : 5' - CTGACTGCTACCTTGGCTGATG - 3' Nồng độ mồi sử dụng trong phân tích được pha loãng thành 6 pM trong đệm TE. Ðệm TE có thành phần như sau : 10 mM Tris-HCl (pH = 8), 1 mM EDTA. - Môi trường nuôi cấy vi sinh vật và các loại hoá chất khác : Khuyến khích sử dụng môi trường nuôi cấy dạng bột khô và các vật liệu dùng cho phản ứng khuếch đại PCR được tổng hợp thành kit đang được lưu hành trên thị trường có thành phần phù hợp như. Quá trình pha chế, bảo quản, sử dụng phải tuân thủ theo hướng dẫn của nhà sản xuất. Trong trường hợp sử dụng các vật liệu hoá chất riêng lẻ, độ tinh khiết của các thành phần và nước pha chế phải đảm bảo chất lượng dùng cho vi sinh và sinh học phân tử. - Thang DNA :Nên sử dụng thang đo phù hợp có thể ước lượng được đoạn khuếch đại 520 bp. Có thể sử dụng sản phẩm khuếch đại có kích thước 520 bp đã biết trước làm thang đo trong phương pháp này. - Agarose : Sử dụng trong kỹ thuật này là loại dùng để điện di ADN có kích thước nhỏ hơn 1000 bp. - Phương pháp tiến hành + Lấy mẫu : Cân chính xác 25 g mẫu (hoặc một khối lượng chính xác tuỳ theo yêu cầu) rồi cho vào bình tam giác hoặc bao PE vô trùng. + Tăng sinh : Nhằm làm tăng số lượng Salmonella trong mẫu, các tế bào bị suy yếu hay tổn thương cũng được phục hồi và phát triển. Giai đoạn này được tiến hành trong môi trường không chọn lọc và trên nguyên tắc cứ một phần khối lượng mẫu sẽ bổ sung 9 phần khối lượng môi trường tăng sinh. Nếu lấy 25 g mẫu, phải bổ sung 225 g môi trường tăng sinh dung dịch pepton đệm. Ủ mẫu có môi trường tăng sinh ở nhiệt độ 37,0oC 1,0oC trong khoảng 18 giờ 2 giờ. + Xử lý mẫu giải phóng DNA : Giai đoạn này nhằm thu nhận sinh khối sau khi tăng sinh, rửa sạch môi trường sau khi nuôi cấy, phá vỡ tế bào để giải phóng DNA. Cách xử lý như sau: ? Lắc đều canh khuẩn tăng sinh. Hút 0,5 ml vào trong ống eppendorf có thể tích 1,5 ml, ly tâm với tốc độ 10 000 vòng/phút trong 5 phút rồi loại bỏ phần môi trường lỏng bên trên. Rửa sinh khối bên dưới với nước cất vô trùng rồi tiếp tục ly tâm với chế độ như trên để loại bỏ phần nước. ? Huyền phù sinh khối trong ống với 0,5 ml nước cất vô trùng. Ðun sôi cách thuỷ trong 10 phút. Ly tâm huyền dịch sau khi đun với tốc độ 10 000 vòng/phút trong 5 phút để lắng các mảnh vỡ tế bào xuống đáy. Phần dịch trong bên trên được coi là khuôn DNA để tiến hành phản ứng khuếch đại. - Khuếch đại + Giai đoạn này nhằm làm tăng số lượng bản sao đoạn DNA đích trên máy luân nhiệt (thermocycler) bằng hai mồi đặc trưng. Quá trình khuếch đại được tiến hành trong khoảng 30 chu kỳ. + Chuẩn bị ống khuếch đại ? Hút 45 ml hỗn hợp khuếch đại PCR 1,1 x cho vào trong ống nghiệm PCR có thể tích 0,2 hoặc 0,5 ml, thêm vào 1 ml mỗi mồi invA1 và invA2 có nồng độ 6 pM và 3 ml mẫu khuôn ADN. Tổng thể tích trong một ống khuếch đại là 50 ml. ? Ðối chứng dương: thay dịch khuôn DNA mẫu bằng dịch ADN của Salmonella chuẩn đã biết. ? Ðối chứng âm: thay dịch khuôn DNA mẫu bằng nước cất vô trùng. + Chương trình khuếch đại ? Các ống khuếch đại được đặt vào trong máy luân nhiệt. Chương trình khuếch đại như sau: Duy trì nhiệt độ 95oC trong 5 phút để làm biến tính hoàn toàn các sợi DNA trong mẫu. Tiếp theo là 35 chu kỳ, mỗi chu kỳ có 3 bước như sau: 95oC/60 giây; 54oC/45 giây và 72oC/60 giây. Sau khi kết thúc 35 chu kỳ, mẫu được giữ ở nhiệt độ 72oC trong 10 phút, sau đó giữ ổn định ở nhiệt độ 20oC cho đến khi điện di. - Ðiện di sản phẩm khuếch đại + Chuẩn bị gel điện di agarose 1% ? Gel agarose 1 % pha trong đệm TAE 1x được đun chảy hoàn toàn và đổ vào khay điện di đã có sẵn các lược để tạo giếng. Gel điện di phải có độ dày khoảng 3 - 4 mm. Gel sau khi chuẩn bị được ngâm chìm hoàn toàn trong đệm TAE. + Chuẩn bị dịch điện di ? Mẫu sau khi khuếch đại được nhuộm với 10 ml đệm tải mẫu 6x rồi trộn thật đều. + Ðiện di ? Một giếng trong gel điện di được sử dụng cho thang DNA chuẩn hay mẫu đối chứng dương. Nạp 10 ml dịch điện di đã chuẩn bị vào trong gel agarose. Tiến hành điện di trong 60 phút ở hiệu điện thế 100 vôn. - Nhuộm DNA, quan sát sản phẩm khuếch đại + Chuẩn bị dung dịch nhuộm mẫu ? Pha dung dịch nhuộm DNA như sau: cho 0,2 ml etyl bromua 10 mg/ml vào 0,5 lít nước, pha vào trong khay chứa có miệng rộng hơn bản gel điện di. + Nhuộm gel ? Ngâm bản gel đã điện di vào dung dịch nhuộm trong 10 phút. Rửa gel bằng nước trong khoảng 3 - 5 phút để loại bỏ phần etyl bromua dư. + Quan sát, chụp hình ? Cho bản gel đã nhuộm lên hộp đèn soi UV, đóng kính bảo vệ, bật đèn rồi quan sát các vạch sáng đỏ của DNA xuất hiện trên bản gel. Sau đó, chụp hình để lưu trữ kết quả. - Ðọc và giải thích kết quả + Kết quả phân tích chỉ được xem xét kết luận khi mẫu đối chứng dương tính có sản phẩm khuếch đại DNA với kích tước 520 bp và mẫu đối chứng âm không có sản phẩm này. + Mẫu được kết luạn là dương tính Salmonella khi có sản phẩm khuếch đại 520 bp trên bản gel. + Mẫu được kết luận là âm tính khi không có sản phẩm khuếch đại, hay sản phẩm khuếch đại có kích thước khác hơn 520 bp. Phương pháp ELISA - ELISA được sử dụng rộng rãi dưới dạng các kit thương mại và có thể cải tiến để tự động hóa. ELISA có thể sử dụng để phát hiện và định lượng vi sinh thực phẩm trong thời gian vài giờ sau khi tăng sinh. Kĩ thuật này có độ nhạy khoảng 106CFU/ml. tuy nhiên vẫn phải thực hiện bước tăng sinh và tăng sinh chọn lọc trước khi thực hiện các phản ứng miễn dịch - Transia Salmonella (Diffchamb AB, Sweden) là 1 bộ kit phát hiện nhanh Salmonella spp. dựa trên nguyên tắc E sanwich. Khi hỗn hợp tăng sinh chọn lọc được cho vào giếng, nếu có sự hiện diện của vi sinh vật mục tiêu, kháng nguyên tiêm mao của vi sinh vật sẽ tạo phức hợp với kháng thể cố định trên giếng và kháng thể tự do có gắn enzyme peroxydase tạo thành 1 phức hợp kép (sanwhich). Sau đó các kháng thể có gắn enzyme ở dạng tự do không tạo phức hợp sanwhich sẽ bị rửa khỏi phản ứng. Phức hợp sanwihch sẽ được phát hiện nhờ sự bổ sung cơ chất của phản ứng (ure peroxide và teramethylbenzidine). Enzyme peroxide sẽ thủy phân cơ chất tạo phản ứng màu xanh dương. Phản ứng kết thúc bằng cách bất hoạt enzyme bằng dung dịch kết thúc làm acid hóa môi trường và lầm môi trường chuyển từ màu xanh sang màu vàng. Sự hình thành màu vàng chứng minh sự hiện diện của kháng nguyên hay vi sinh vật mục tiêu và mật độ màu của vi sinh vật có thể xác định được bằng cách đo cường độ màu bằng máy so màu Các biện pháp kiểm soát Salmonella trong thực phẩm -  Đối với gia súc và gia cầm: Trong chăn nuôi cần chú ý đề phòng bệnh tật cho chúng. Phải kiểm tra thú y khi giết súc vật, điều này càng làm tốt thì càng ít có cơ hội bán hoặc xuất ra các loại thịt đã nhiễm Salmonella. Trong khi giết thịt phải đảm bảo tính riêng rẽ, tránh sự lây lan của vi khuẩn, chú ý tới các loại dụng cụ dùng khi giết thịt . - Trong bảo quản thực phẩm, đảm bảo thời gian cất giữ thực phẩm đã chế biến và các nguyên liệu. Chú ý thịt băm, patê... thịt nghiền mà không ướp lạnh ngay sau đó sẽ tạo điều kiện cho toàn bộ khối nguyên liệu đó nhiễm trùng mau chóng. - Đun sôi thực phẩm trước khi ăn là biện pháp tốt nhất. Thịt đã ướp lạnh thời gian đun nấu phải kéo dài hơn bình thường, khi đun phải đảm bảo nhiệt độ sôi cả bên trong miếng thịt (ít nhất là 5 phút). Thực phẩm còn thừa, thực phẩm dự trữ phải đun lại trước khi ăn. Với trứng có thể bị nhiễm Salmonella rất sớm ngay khi mới đẻ (trứng vịt, ngan, ngỗng...), vì vậy phải chế biến chín hoàn toàn, tuyệt đối không ăn sống hoặc hồng đào.Bảo đảm vệ sinh nơi ăn, tránh ruồi, nhặng, chuột. - Thực hiện nghiêm ngặt chế độ khám tuyển trước khi vào và khám định kỳ (1 năm/1 lần) đối với người tiếp xúc trực tiếp với thực phẩm nhất là thực phẩm đã nấu chín. Chương III : NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU Địa điểm và thời gian - Thời gian: Từ ngày 31/05/2010 đến ngày 12/06/2010. - Địa điểm thực hiện: Phòng thí nghiệm Khoa Môi trường và Công nghệ Sinh học, Trường Đại học Kỹ Thuật Công Nghệ Thành Phố Hồ Chí Minh. - Địa chỉ: 144/24 Điện Biên Phủ, P25, Q. Bình Thạnh, TP. Hồ Chí Minh. Đối tượng và phạm vi nghiên cứu - Nghiên cứu và phát hiện Salmonella trên một số mẫu thịt gà tươi sống trên địa bàn hai quận Phú Nhuận và Bình Thạnh thành phố Hồ Chí Minh. Vật liệu thí nghiệm Các dụng cụ và hóa chất tiến hành thí nghiệm - Kéo cắt mẫu. - Pipet 1ml, 5ml, 10ml. - Đĩa petri. - Micropipet 10µl-200µl. - Túi PE vô trùng. - Que cấy thẳng, que cấy vòng - Cân điện tử. - Ống nghiệm khử trùng. - Tủ ấm 37oC, 42oC. - Nồi hấp khử trùng 121oC. - Đèn cồn. - Quả bóp cao su. - Chai chịu nhiệt dung tích 500ml, 1000ml. - Gía ống nghiệm inox. - Tủ cấy. - Bông không thấm. - Que cấy. - Cồn 96o, 70o - Nước cất khử trùng Các môi trường sử dụng - Môi trường BPW (Ấn Độ) - Môi trường RV (Ấn Độ) - Môi trường XLD (Ấn Độ) - Môi trường dùng để test sinh hóa : + LDC (Ấn Độ) + Manitol (Ấn Độ) + Urea (Merck) + VP (Ấn Độ) + TSI (Ấn Độ) + Trypton (Ấn Độ) Nội dung thực hiện Mẫu thịt gà Thu mẫu tại các địa điểm khảo sát Đánh giá các chỉ tiêu Cảm quan Salmonella Nhận xét, Kết luận Hình 3.1: Nội dung thực hiện thí nghiệm Phương pháp nghiên cứu Quy trình phân tích 25 g mẫu + 225 ml BPW, đồng nhất mẫu trong 30 giây độ pha loãng 10-1 Đem ủ ở 37oC trong 24 giờ Lấy 0.1ml canh trường cho vào môi trường RV Ủ ở 42oC ± 0,5 trong 24 giờ Cấy chuyển trên môi trường XLD và ủ ở nhiệt độ 37 oC trong 24 giờ KL đặc trưng của Salmonella trên môi trường XLD : tròn, lồi, trong suốt, có tâm đen đôi khi tâm đen quá lớn bao trùm khuẩn lạc, môi trường xung quanh chuyển sang màu đỏ Cấy chuyển vào môi trường test sinh hóa : môi trường TSI, Manitol phenol red, Urea, LDC, Trypton, VP Biểu hiện đặc trưng của Salmonella : trên TSI: đỏ/vàng/H2S(+)/gas(+)/; Manitol(+); Urea(-); LDC(+); Indol(-); VP(-) Ủ ở 37oC trong 24 giờ Hình 3.2: Quy trình phân tích Salmonella trong thí nghiệm Thuyết minh quy trình Chuẩn bị mẫu. - Dùng kéo vô khuẩn cắt 25g mẫu (không lấy mỡ, lấy cả chất lỏng nếu có), cho vào bao nilong vô khuẩn. Thêm vào 225ml môi trường PBW đã hấp khử trùng để nguội. Tiến hành đồng nhất mẫu được độ pha loãng 10-1. Đem ủ ở nhiệt độ 370C trong 24 giờ. Cấy mẫu. - Tăng sinh: Cấy 0,1ml dịch mẫu có nồng độ 10-1 vào ống nghiệm có chứa 10ml môi trường tăng sinh chọn lọc RV, Ủ ở 42 ± 0,5 oC trong 24 giờ. - Phân lập: Cấy mẫu từ môi trường RV sang môi trường thạch đĩa XLD và ủ ở nhiệt độ 370C trong 24 giờ. Nhận dạng khuẩn lạc đặc trưng của salmonella trên môi trường XLD: tròn, lồi, trong suốt , có tâm đen đôi khi tâm đen quá lớn bao trùm cả khuẩn lạc, môi trường xung quanh chuyển sang màu đỏ (hồng). Hình 3.3: Khuẩn lạc đặc trưng của Salmonella - Chọn 5 khuẩn lạc đặc trưng cấy chuyển sang môi trường thạch đĩa TSA, tăng sinh không chọn lọc và ủ ở 37 ± 0,5oC trong 24 giờ Thử nghiệm khẳng định. - Lấy khuẩn lạc từ môi trường TSA cấy sang các môi trường thử nghiệm sinh hóa. Thực hiện như sau: Thử nghiệm trên môi trường TSI: - Hấp khử trùng môi trường TSI ở 1210C trong 15 phút và phân phối môi trường vào các ống vô trùng để làm ống thạch nghiêng. - Dùng que cấy vòng cấy sinh khối từ khuẩn lạc của giống thuần sâu vào đáy của ống thạch nghiêng. - Sau khi cấy xong thì ủ ở 370C trong vòng 24h – 48h. - Salmonella chỉ lên men được đường glucose trong môi trường TSI ð phần nghiêng của môi trường TSI có màu đỏ, phần sâu có màu vàng. - Salmonella có khả năng H2S ð xuất hiện các vệt màu đen trong môi trường TSI. - Có thể thấy hiện tượng sinh hơi qua hiện tượng làm vỡ thạch môi trường hoặc môi trường bị đẩy lên trên tạo ra một khoảng không bên dưới ống nghiệm. Positive Negative Hình 3.4: Thử nghiệm trên môi trường thạch TSI Negative Thử nghiệm Urea Broth: - Cấy VSV vào môi trường canh urea có chứa chất chỉ thị là bromocresol purple - Ủ ở 370C trong khoảng 12h – 18h - Thử nghiệm (+): môi trường chuyển sang màu vàng. - Thử nghiệm (-): môi trường không đổi màu. ð Salmonella không phân giải urea nên không làm thay đổi pH môi trường. Sau khi nuôi cấy môi trường vẫn giữ nguyên màu tím. Negative Negative Negative Hình 3.5: Thử nghiệm Urea Broth Lên men mannitol: - Môi trường sử dụng là môi trường phenol red broth base có pH 7.4, chỉ thị môi trường này là phenol red có màu đỏ sẽ chuyển thành màu vàng khi pH < 6.8. - Tiến hành cấy vào các ống môi trường các chủng VSV cần khẳng định. - Ủ 370C trong 18 – 24h. - Khả năng lên men của chủng được đánh giá dựa vào sự sinh acid và sinh hơi - Sinh acid (+): môi trường màu cam chuyển sang vàng. - Sinh hơi (-): có bọt khí trong ống Durnham. ð Môi trường sau khi nuôi cấy salmonella bị acid hóa và chuyển thành màu vàng. Negative Negative Positive Hình 3.6: Lên men Mannitol Thử nghiệm LDC (Lysine Decarboxylase): - Sử dụng môi trường Falkow. - Tiến hành cấy vào các ống môi trường các chủng VSV cần khẳng định. - Chất chỉ thị màu trong môi trường là Bromocresol purple. - Phản ứng (+): môi trường giữ nguyên màu tím ban đầu, canh khuẩn đục. - Phản ứng (-): môi trường từ tím chuyển sang vàng. ð Sau khi nuôi cấy salmanella môi trường chuyển thành kiềm, môi trường giữ nguyên màu tím ban đầu. Negative Hình 3.7: Thử nghiệm LDC Thử nghiệm khả năng sinh Indol: - Cấy VSV thử nghiệm qua môi trường canh trypton ủ khoảng 24 giờ ở 37oC. - Nhỏ vài giọt ether để kéo indol lên bề mặt môi trường, thêm vài giọt thuốc thử Kovac’s - Quan sát sau vài phút. - Thử nghiệm (+): trên bề mặt môi trường xuất hiện vòng màu đỏ cánh sen. - Thử nghiệm (-): không xuất hiện vòng đỏ. Hình 3.8: Thử nghiệm Indol Negative Negative Positive Thử nghiệm Voges – Proskauer: - Cấy vi sinh vật vào trong môi trường glucose phosphate (MR-VP Broth) - Ủ ở nhiệt độ 370C trong vòng từ 2-5 ngày - Thêm vào canh khuẩn dung dịch thuốc thử anpha- naphtol 5% trong cồn và dung dịch KOH 40% hay NaOH 40 %. với tỷ lệ 3:1. - Quan sát phản ứng xảy ra trong 5 phút. - Thử nghiệm (+):xuất hiện màu đỏ hay hồng sáng trên mặt môi trường. - Thử nghiệm (-): môi trường không đổi màu. Hình 3.9: Thử nghiệm Voges – Proskauer Negative 3.4.5. Nhận định tính sinh hoá đặc hiệu: Tính chất sinh hoá Dương hoặc âm tính Tỷ lệ % với vi khuẩn Salmonella TSI lactose - 99,2 TSI sucrose - 99,5 TSI glucose + 100 TSI glucose sinh hơi + 91,2 TSI hydro-sulfua + 91,6 Phân giải urê - 100,0 Lên men mannitol + Phản ứng Indol - 98,2 Phản ứng V.P - 100,0 Bảng 3.1: Phát hiện hay không phát hiện Salmonella trong 25g mẫu Kết quả Kết quả cảm quan - Về màu sắc, thịt gà có màu đặc trưng, phần thịt hồng, phần mỡ màu vàng tươi và da màu vàng hoặc trắng - Về mùi, thịt có mùi đặc trưng, không có mùi lạ - Về tính chất, bề mặt thịt có nước, có độ đàn hồi tốt - Về cảm quan nhìn chung là tốt, thịt nhìn còn tươi, tính chất, màu sắc, mùi vị không có gì lạ. Nhưng đánh giá cảm quan không đủ để xem xét mức độ sạch của thịt Kết quả đánh giá mức độ nhiễm Salmonella - Đánh giá theo TCVN 4829:2001 (ISO 6579:1993) với quy đinh mức độ nhiễm Salmonella là 0 CFU/25g Hình 3.10 : Tỷ lệ nhiễm Salmonella trên các mẫu khảo sát - Theo bảng trên, mẫu 3 và mẫu 5 đã nhiễm Salmonella với tỷ lệ 33.33%. Việc tạp nhiễm Salmonella có thể do thao tác của người phân phối thịt không hợp vệ sinh, không dùng các dụng cụ bảo hộ. Hoặc cũng có thể thịt bị tạp nhiễm do không khí, vì vệ sinh khu buôn bán cũng có thể là do nhiễm ở trung tâm giết mổ. Hai mẫu nhiễm có thể nói lên tình trạng vệ sinh an toàn thực phẩm ở hai khu vực này là rất thấp, vì tỷ lệ tạp nhiễm trong quy định của TCVN là 0 CFU/25g - Tóm lại, ba mẫu 1, 2 và 4 âm tính với Salmonella có thể sử dụng được, nhưng cũng phải đảm bảo vệ sinh an toàn thực phẩm, vì không chỉ có Salmonella mới gây ra những ca ngộ độc thực phẩm nghiêm trọng, không nhiễm Salmonella không có nghĩa là không nhiễm các vi sinh vật khác. - Hai mẫu 3 và 5 không thể sử dụng được, cơ sở phân phối cần có biện pháp vệ sinh tốt hơn, đổi khu vực lấy thực phẩm khác để tránh tình trạng lây nhiễm Chương IV: KẾT LUẬN VÀ KIẾN NGHỊ Kết luận - Sau quá trình nghiên cứu lý thuyết và thực nghiệm, chúng tôi nhận thấy rằng Salmonella là một loài vi khuẩn khá nguy hiểm, chúng gây ra bệnh thương hàn, nhiễm trùng huyết và một số bệnh khác. Đáng nói là loài này thường tạp nhiễm vào thực phẩm, điều này vô cùng nguy hiểm vì theo TCVN, mức độ nhiễm Salmonella là 0 CFU/25 g. - Mạng lưới kiểm tra an toàn vệ sinh thực phẩm tuy trải rộng khắp cả nước, nhưng năng lực kiểm dịch chưa được cao ở các địa phương , nhất là ở các thành phố lớn như Tp. Hồ Chí Minh Kiến nghị - Trong thực nghiệm trên, có một số phần do thời gian quá gấp mà tôi chưa thể thực hiện được + Khảo sát tình trạng vi sinh của khu buôn bán + Khảo sát qua tình hình giết mổ gia cầm trên địa bàn thành phố Hồ Chí Minh - Lập các trung tâm kiểm dịch trên địa bàn các quận và yêu cầu thịt trước khi bán cần phải qua kiểm dịch và sử dụng các dụng cụ phân phối hợp vệ sinh - Nên lập các địa điểm bán thực phẩm tập trung để dễ dàng kiểm tra vệ sinh khu buôn bán. Thường xuyên tổ chức các đợt kiểm tra khu chăn nuôi và giết mổ để đảm bảo vệ sinh an toàn thực phẩm TÀI LIỆU THAM KHẢO TÀI LIỆU TIẾNG VIỆT Bộ môn vi sinh vật trường đại học y Hà Nội (2007), vi sinh vật y học, Nxb y học, Hà Nội. Bộ môn vi sinh vật trường đại học y khoa Huế (2004), bài giảng vi sinh y học. Bộ y tế (2008), vi sinh vật y học, Nxb y học, Hà Nội. Trần Linh Phước (2009), phương pháp phân tích vi sinh vật trong nước, thực phẩm và mỹ phẩm, Nxb Giáo Dục, Hà Nội TÀI LIỆU NƯỚC NGOÀI Bibek Ray (2009), FUNDAMENTAL FOOD MICROBIOLOGY, ,Boca Raton London New York Washington, D.C, USA. Camilla Giammarini and Mauro Magnani, Listeriolysin O from Listeria monocytogenes, Diatheva, Centre for Biotechnology, University of Urbino, Italy Cynthia L.Sears and James B.Kaper (1996), Enteric Bacterial Toxins: Mechanisms of Action and Linkage to Intestinal Secretion, American Society for Microbiology FAO and WHO (2009), Salmonella and Campylobacter in chicken meat Jame M.Jay (2000), Modern Food Microbiology WHO, Risk assessments of Salmonella in eggs and broiler chickens

Các file đính kèm theo tài liệu này:

  • docTIM HIEU VE VI KHUAN SALMONELLA.doc
  • docxLời cảm ơn.docx
Tài liệu liên quan