This study is granted by Ministry of Agriculture
and Rural development of Vietnam. We are
appreciated kind supports from Research Institute
for Aquaculture No.3. Thanks to Organising
Committee of Molecular Biotechnology and
Environment, MBE2015, Nha Trang University
for opportunity to join the conference.
7 trang |
Chia sẻ: huongthu9 | Lượt xem: 806 | Lượt tải: 1Free
Bạn đang xem nội dung tài liệu Bacterial diversity in penaeid shrimp hepatopancreas revealed by metagenome analysis, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Journal of Fisheries science and Technology Special issue - 2015
NHA TRANG UNIVERSITY • 29
BACTERIAL DIVERSITY IN PENAEID SHRIMP HEPATOPANCREAS
REVEALED BY METAGENOME ANALYSIS
Hua Ngoc Phuc1, Truong Hai Nam2, Do Thi Huyen2,
Nguyen Thi Trung2, Nguyen Thi Quy2, Duong Thu Huong2
ABSTRACT
Early mortality syndrome (EMS) or acute hepatopancreatic necrosis disease (AHPND) is an emerging
disease reported recently that has caused massive loss to saline shrimp aquaculture. EMS/AHPND was
recognized in Vietnam since 2011 and up to now its adverse effect is still serious to shrimp industry nationwide.
Determination of the main pathogenic factor and the role of other microbial candidates is a very important
study. This report shares results of a metagenome analysis on bacterial diversity at community level that has
been one of critical research efforts on EMS/AHPND in Vietnam in recent time.
A total of 7 metagenomic samples were extracted from farmed penaeid shrimp hepatopancrea tissues
including 2 samples of healthy shrimp populations and 5 others of infected shrimps at regions of 16S rDNA,
recA, and rpoB were sequenced by Illumina HiSeq technology. The DNA metagenome analysis revealed
a wide range of bacteria groups up to 63/171 genera on healthy and infected shrimp hepatopancreatic
samples, respectively. The mainly dominant bacteria (percentage on healthy/infected samples, respectively)
were Pseudomonas (0.74/76.59%), Stenotrophomonas (0/13.44%), Enterobacter (0/1.75%), and especially
Vibrio (0/1.28%). The routine pathogens such as Aeromonas, Enterobacter, Samonella, Vibrio were not found
in hepatopancreatic samples of healthy shrimps. Remarkable differences in this study compared to other
previous reports will be discussed with a focus on the factor Vibrio parahaemoluticus and the mechanism of
transmission in relevance to prevention of the disease.
Keyword: penaeid shrimp, EMS/AHPND, metagenome, bacterial diversity
1 Research Institute for Aquaculture No. 3 - Corresponding email: hnphuc@ria3.vn
2 Institute of Biotechnology – Vietnam Academy of Science and Technology
I. INTRODUCTION
An emerging disease occured with serious
loss to shrimp aquaculture in Asia since 2009.
The outbreake of the disease so called Early
Mortality Syndrome (EMS), and later defined
as Acute Hepatopancreatic Necrosis Disease
(AHPND) spread rapidly to Malaysia (2010),
Vietnam (2011), Thailand (2012), and Mexico
(2013) (Lightner et al., 2012; Leano and Mohan,
2012; Zorriehzahra and Banaederakhshan,
2015). The important effect of EMS/AHPND
to shrimp production in the region has been
very significant. In particular, it caused 22%
shrimp production dicrease in China and 50%
in Thailand in 2013. In general, EMS/AHPND
epidemic made global shrimp production lower
than expectation 23% (Chamberlain, 2013). In
Vietnam, more than 81,000 ha of shrimp farms
in Mekong Delta was lost due to EMS in the
years 2011-2012 (Periodical report of Directorate
of Fisheires, 2012). Several emergent efforts
were done that led to preliminary conclusion
of biotic toxins as causative factors of
EMS/AHPND. The first brief metagenomic
survey done by Centex Shrimp, Thailand
showed unexpected results of finding 5 bacterial
genera nerver known in shrimp previously.
They were Ralstonia, Delftia, Pelomonas,
Leifsonia, and Rhodococcus (Prachumwat et
al., 2012). In the same time with the publication
Journal of Fisheries science and Technology Special issue - 2015
30 • NHA TRANG UNIVERSITY
of Loc Tran et al., (2913) reporting the
agent causing EMS/AHPND, we assumed
microorganisms were the target to look
for and proposed that microbes played an
important role in the disease quick symptome.
Therefore a metagenomic study on farmed
penaeid shrimp hepatopancrea was conducted.
This study aims to find out the diversity of
bacteria present in hepatopancrea of healthy
and EMS/AHPND infected shrimps in order to
speculate the main cause of the epidemic. We
found that bacterial diversity in hepatopancreas
of penaeid was very high and the communities
in healthy and infected shrimps were very
different, especially the presence of Vibrio and
other pathogenic bacteria in diseased shrimps
but not in healthy shrimps that has not been
reported before on EMS/AHPND.
II. MATERIALS AND METHODS
1. Shrimp hepatopancrea tissue sampling
Penaeid shrimps (Penaeus monodon and
Litopenaeus vannamei) farmed in areas of the
North, Central and the South of Vietnam were
collected from October 2012 to April 2013. EMS
infected and healthy shrimps of 25-40 days old
in pond were sampled by cutting the whole
carapace with intact hepatopancreas and
immediate freezing in situ with dry ice. The
sample size was 50-100 individuals each for
one pond. The freezing samples were quickly
transported to laboratory to further steps or
keeping frozen at -80ºC until DNA extraction.
Infected shrimps were distinguished with
healthy ones by applying a practical 5-point
protocol of National Department of Animal
Health.
Totally 7 hepatopancreatic tissue samples
were successfully collected. They were marked
as TB1-1, TB2-1, TB2-2, TB3-3, TB3-4 for
infected vannamei and SK3, TK3 for healthy
monodon and vannamei, respectively.
Figure 1. The work-flowchart in this study
2. Bacterial DNA extraction and purification
Tissue samples were defrozen and ground
on a sieve with lysis buffer. The go-through
liquid was collected and centrifuged at 7000
rpm to get pellets. The pellets were lysed with
lysozyme in TE buffer at 37ºC for 10 min, and
then with proteinase-K with SDS (10%) at 56ºC
for 1 hour as described by Sambrook and
Russell (2001). The extract after purified with
phenol/chloroform/isoamyl alcohol (25:24:1,
v/v/v) was extracted with chloroform/isoamyl
alcohol (24:1, v/v) and then precipitated in100%
ethanol added to 0.1 volume of
3 M sodium acetate, pH 5.2. DNA was
recovered by centrifuge at 15,000 rpm, 4ºC
for 10 min. DNA pellets were washed with
ethanol 70% and centrifuged twice and dried at
room temperature in a clean bench. The dried
DNA pellets were dissolved in TE buffer and
checked by gel electrophoresis.
Journal of Fisheries science and Technology Special issue - 2015
NHA TRANG UNIVERSITY • 31
DNA purification was done with QIAquick
Gel Extraction kit followed protocol of Qiagen
(USA).
Resulted DNA was quantitatively and
qualitatively checked by electrophoresis and
NanoDrop 2000 (ThermoScientific, USA) and
then stored in TE solution at -80ºC.
3. Bacteria specific library construction
The amplification of specific regions of
bacterial genome was targeted at V6-V8 of
16S rRNA gene (Yu and Horrison, 2004), recA
(DNA recombination and repair coding gene),
rpoB (RNA polymerase beta subunit coding
gene) with primer pairs described in Table 1.
Table 1. A list of bacteria specific primers for PCR amplification
Bacterial gene Universal primer pairs and sequences (3’ -> 5’) Reference
16S rRNA 954F CACAAGCGGTGGAGCATGTGG
1393R ACAAGGCCCGGGAACGTATTCACC
Yu and Horrison, 2004
recA 63F ATCGAGCGGTCGTTCGGCAAGGG
504R TTGCGCAGCGCCTGGCTCAT
Gaunt et al., 2001
rpoB F1721 AACATCGGTCTGATCAACTC
R2410 TGACGTTGCATGTTCGCACCCAT
Ki et al., 2009
The specific amplification and amplicon
quanlity control test and tagging were done by
service of Macrogen Inc. (South Korea).
4. Sequencing and bioinformatic analysis
A next generation sequencing technology
of Illumina HiSeq was applied on GS-FLX
Titanium platform to sequence the tagged
amplicon libraries. Sequence data was briefly
analysed with software Roch GS-FLX version
2.8. Global alignment was asscessed by BLAST
to Silva rDNA database and pairwise alignment
was done with Needle (Rice et al., 2000).
Taxonomic assignment was made by Macrogen
applying in-house software. The whole
process from sequencing to biofinformatic
output is shown in Figure 2.
Figure 2. A schematic draw showing steps of sequencing and data analysis
Journal of Fisheries science and Technology Special issue - 2015
32 • NHA TRANG UNIVERSITY
III. RESULTS AND DISCUSSION
1. Shrimp hepatopancreatic metagenome
and bacteria specific library construction
A total of 7 DNA samples were successfully
extracted and purified from shrimp
hepatopancreatic tissues nationwide in which
2 were of healthy monodon and vannamei and
5 were of EMS infected vannamei. Howerver
two of them were not passed the QC test to go
further amplification. The amount and quality of
DNA were shown in Table 2. The present study
would faced the difficulty in terms of
hapetopancreatic sample recovery from
frozen samples and the small number of
bacterial cells existing in shrimp hepatopancreas.
As far as it knows this is the second shrimp
metagenome project ever done with little
experience and few references.
Twelve bacteria specific metagenome
amplicons were processed and eleven PCR
products were passed the next QC test (Table
2.). To this step, PCR bias maybe caused by
inhibitors somehow remained in the DNA
sample should be the problem (Wilson, 1997).
2. Diversity of bacterial community in
penaeid shrimp hepatopancreas
In general, 173 millions nucleotides of
433.000 reads were sequenced from 10
metagenomic libraries. Taxonomic assignment
resulted in 29 phyla of Bacteria kingdom. The
major phyla (>1% relative abundance) included
Acidobacteria, Actinobacteria, Cyanobacteria,
Bacteroidetes, Firmicutes, and Proteobacteria.
At genus level, total 175 genera of Bacteria
kingdom were found for all samples with 3
molecular markers 16S, recA, and rpoB.
Among major phyla, Proteobacteria was very
predominant, even up to 99% (reads) in sample
TB1-1. This finding is similar to those reported
by Tzuc et al., (2014) on white-leg shrimp
Litopenaeus vannamei and Cheung et al., (2015)
on shrimp model Neocaridina denticulata.
In those studies, Bacteroidetes, Firmicutes,
Actinobacteria, and Cyanobacteria were also
found at high percentage of abundance.
However, a comparison of diversity at genus
level showed that microbial community in
penaeid shrimps was much more abundant
than in shrimp Neocaridina denticulata (175
compared to 7 genera). Tzuc et al., (2014)
suceesfully isolated strains of 2 genera of
Vibrio and Pseudoalteromonas in the whole
digestive system of white-leg shrimp. This indicates
that a very small proportion of bacterial
community in shrimp organs can be culturable.
In addition, none of five bacteria genera
found in infected shrimp reported in Thailand
(Prachumwat et al., 2012) was found in this study.
Table 2. A summary result record of shrimp hepatopancreatic metagenome process
Metagenomic
DNA
ng / A260/280 Template
QC test
Successful specific
amplification
PCR product QC
test
Successful
sequencing
Successful
taxonomic
assignment
TB1-1 7042.5 / 1.78 passed 16S, recA, rpoB 16S, recA, rpoB 16S, recA, rpoB 16S, recA, rpoB
TB2-1 3380.6 / 1.69 failed
TB2-2 7912.5 / 1.83 passed 16S, rpoB 16S, rpoB 16S, rpoB rpoB
TB3-3 7200.0 / 1.85 passed 16S
TB3-4 3562.5 / 1.71 failed
SK3 5709.4 / 1.80 passed 16S, recA, rpoB 16S, recA, rpoB 16S, recA, rpoB 16S, recA, rpoB
TK3 4755.0 / 1.68 passed 16S, recA, rpoB 16S, recA, rpoB 16S, recA, rpoB
Journal of Fisheries science and Technology Special issue - 2015
NHA TRANG UNIVERSITY • 33
3. Bacterial abundance in healthy and EMS/AHPND infected shrimps
Although the metagenomic process of healthy vannamei was resulted in unexpected
results (Table 2.) and that of EMS/AHPND infected monodon was not available, it roughly showed
a very different microbial composition in hepatopancreatic tissues of two groups of shrimps. In
details, totally 63 bacteria genera were found in hepatopancrea of healthy monodon (SK3-16S,
recA, rpoB, Fig. 3) and 171 genera found in infected vanamei (TB1-1-16S, recA, rpoB; TB2-2-rpoB).
Figure 3. Diversity of bacterial community found in hepatopancreas of
healthy monodon based on 16S, recA, rpoB at genus level
The remarkable note that the most abundant bacteria (Pseudomonas, 76.59%;
Stenotrophomonas, 13.44%; Acinetobacter, 5.95%) and other pathogenic bacteria such as Vibrio
(1.28%), Enterobacter (1.75%), Aeromonas (0.01%) were not found in healthy shrimps (Table 3).
Bacterial taxonomic assignment of sequences from infected shrimp was too complicated to show in
a single figure at genus level, therefore it was instead shown at order level in Figure 4.
Figure 4. Diversity of bacterial community found in hepatopancreas of
infected vannamei based on 16S, recA, rpoB at order level
Journal of Fisheries science and Technology Special issue - 2015
34 • NHA TRANG UNIVERSITY
In this study, we analysed metagenomes of
bacteria extracted from healthy and diseased
penaeid shrimps. Taxonomic assignment
showed that healthy monodon may be favourable
for the inhabitation of several probiotic
bacteria such as Bacillus, Rhodobacter, and
Rhodopseudomonas. On the other hand,
several known pathogenic bacteria found in
EMS/AHPND infected vannamei but not in
healthy monodon. These were Pseudomonas,
Vibrio, Aeromonas, Enterobacter. Tran
et al. (2013) reported that the causative
factor of EMS/AHPND was a strain of Vibrio
parahaemolyticus having a virulent gene.
Other genomic works later found the virulent
gene encoding a strong toxin (Yang et al.,
2014). It means that even present at a low
density, the toxic bacterium can cause death
to shrimp. Therefore Vibrio although found
in this study at a low abundance but it must
be important to mention. Other pathogenic
bacteria present at higher abundance may play
an opportunistic role of the disease progress. In
such a context, it is possible that the transmission
of the mobile toxin gene can be performed from
V. parahaemolyticus to these bacteria and the
epidemic becomes more complicated to track
out. This requires further research in order to
understand fully the mechanism of the quick
and wide infection of EMS/AHPND.
IV. CONCLUSION
Diverse bacterial communities were found
in hepatopancreas of penaeid shrimps. They
were diversely different groups in healthy and
EMS/AHPND infected shrimps. The abundance
Table 3. Comparison of bacterial diversity infected in healthy
and diseased shrimp hepatopancreas
Major genera Healthy shrimp* EMS/AHPND infected shrimp*
Acidothermus present (1.47%) absent
Acinetobacter absent present (5.95%)
Aeromonas absent present (0.01%)
Bacillus present (0.25%) absent (0.03%)
Chryseobacterium absent present (17.9%)
Enterobacter absent present (1.55%)
Lactobacillus absent present (0.04%)
Lactococcus absent present (0.08%)
Methylobacterium absent present (1.65%)
Nitrospira present (2.1%) absent
Paenibacillus present (3.35%) present minor
Pedobacter present (7.1%) absent
Pseudomonas present (0.74%) present (38.4%)
Rhodobacter present (1.77%) absent
Rhodopseudomonas present (3.52%) absent
Salmonella absent present (0.04%)
Stenotrophomonas present minor present (7.22%)
Vibrio absent present (1.28%
Notes: * average relative abundance based on percentage of reads in taxonomic assignment.
A large proportion of reads was not successfully referred from database, sorted as unknown, about
80% for healthy shrimp and about 30% of those for infected shrimp
Journal of Fisheries science and Technology Special issue - 2015
NHA TRANG UNIVERSITY • 35
of the pathogenic groups indicates their
roles and their interaction in causing the
complicated pathological signs of EMS/
AHPND. Further studies are needed to figure
out the importance of Pseudomonas,
Stenotrophomonas, Chryseobacterium,
and Enterobacter in addition to Vibrio in the
EMS/AHPND infection.
ACKNOWLEDGEMENT
This study is granted by Ministry of Agriculture
and Rural development of Vietnam. We are
appreciated kind supports from Research Institute
for Aquaculture No.3. Thanks to Organising
Committee of Molecular Biotechnology and
Environment, MBE2015, Nha Trang University
for opportunity to join the conference.
REFERENCES
1. Directorates of Fisheries, Ministry of Agriculture and Rural development, 2012. Periodical report.
2. Chamberlain G., 2013. Early mortality syndrome: Managing the perfect killer. Webinar, Global Aquaculture
Alliance, Ho Chi Minh, December 2013.
3. Cheung M. K., Yip H. Y., Nong W., Law P. T. W., Chu K. H., Kwan H. S., Hui J. H. L., 2015. Rapid change of
microbiota diversity in the gut but not the hepatopancreas during gonadal development of the new shrimp model
Neocaridina denticulata. Mar. Biotechnol., DOI 10.1007/s10126-015-9662-8.
4. Gaunt M. W., Turner S. L., Rigottier-Gois L., Lloyd-Macgilp S. A., Young J. P., 2001. Phylogenies of atpD and
recA support the small subunit rRNA-based classification of rhizobia. Int. J. Syst. Evol. Microbiol., 51(Pt6):
2037-2048.
5. Ki J. S., Zhang W., Qian P.-Y., 2009. Discovery of marine Bacillus species by 16S rRNA and rpoB comparison
and their usefulness for species identification. J. Microbiol. Meth., 77: 48-57.
6. Leano E. M., Mohan C.V., 2012. Early mortality syndrome (EMS)/Acute Hepatopancreatic Necrosis Syndrome
(AHPNS): An emerging threat in the Asian shrimp industry. Network of Aquaculture Centres in Asia-Pacific.
Asian fisheries society . Fish health section. Electronic newsletter. No. 10.
7. Lightner D.V., Redman R.M., Pantoja C.R., Noble B.I., Tran L., 2012 Early mortality syndrome affects shrimp
in Asia. Glob. Aquacul. Adv., January/February 2012:40.
8. Prachumwat A., Thitamadee S., Sriurairatana S., Chuchird N., Limsuwan C., Jantratit W., Chaiyapechara
S., Flegel T.W., 2012. Shortgun sequencing of bacteria from AHPNS a new shrimp disease threat for Thailand.
9. Rice P., Longden I., Bleasby A., 2000. EMBOSS: the European Molecular Biology Open Software Suite. Trends
Genet., 16(6): 276-277.
10. Sambrook J., Russell D. W., 2001. Molecular Cloning: A Laboratory Manual, 3rd Ed. Cold Spring Harbor Lab
Press, New York, 999 pp.
11. Tran L., Nunan L., Redman R. M., Mohney L. L., Pantoja C. R., Fitzsimmons K., Lightner D. V., 2013.
Determination of the infectious nature of the agent of acute hepatopancreatic necrosis syndrome affecting
penaeid shrimp. Dis. Aquat. Org., 105: 45-55.
12. Tzuc J. T., Escalante D. R., Herrera R. R., Cortes G. G., 2014. Microbiota from Litopenaeus vannamei: digestive
tract microbial community of Pacific white shrimp (Litopenaeus vannamei). SpringerPlus, 3: 280.
13. Wilson I. G., 1997. Inhibition and facilitation of nucleic acid amplification. Appl. Envir. Microbiol., 63(10):
3741-3751.
14. Yang Y.-T., Chen I.-T., Lee C.-T., Chen C.-Y., Lin S.-S., Hor L.-I., Tseng T.-C., Huang Y.-T., Sritunyalucksana
K., Thitamadee S., Wang H.-C., Lo C.-F., 2014. Draft genome sequences of four strains of Vibrio parahaemolyticus,
three of which cause Early Mortality Syndrome/Acute Hepatopancreatic Necrosis Disease in shrimp in China
and Thailand. Genome Announcements, 2(5): e00816-14.
15. Yu, Z., Morrison M., 2004. Comparisons of different hypervariable regions of rrs genes for use in fingerprinting
of microbial communities by PCR-denaturing gradient gel electrophoresis. Appl. Environ. Microbiol., 70:
4800–4806.
16. Zorriehzahra M. J., Banaederakhshan R., 2015. Early mortality syndrome (EMS) as new emerging threat in
shrimp industry. Adv. Anim. Vet. Sci., 3(2s): 64-72.
Các file đính kèm theo tài liệu này:
bacterial_diversity_in_penaeid_shrimp_hepatopancreas_reveale.pdf