Bacterial diversity in penaeid shrimp hepatopancreas revealed by metagenome analysis

This study is granted by Ministry of Agriculture and Rural development of Vietnam. We are appreciated kind supports from Research Institute for Aquaculture No.3. Thanks to Organising Committee of Molecular Biotechnology and Environment, MBE2015, Nha Trang University for opportunity to join the conference.

pdf7 trang | Chia sẻ: huongthu9 | Lượt xem: 891 | Lượt tải: 1Freedownload
Bạn đang xem nội dung tài liệu Bacterial diversity in penaeid shrimp hepatopancreas revealed by metagenome analysis, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Journal of Fisheries science and Technology Special issue - 2015 NHA TRANG UNIVERSITY • 29 BACTERIAL DIVERSITY IN PENAEID SHRIMP HEPATOPANCREAS REVEALED BY METAGENOME ANALYSIS Hua Ngoc Phuc1, Truong Hai Nam2, Do Thi Huyen2, Nguyen Thi Trung2, Nguyen Thi Quy2, Duong Thu Huong2 ABSTRACT Early mortality syndrome (EMS) or acute hepatopancreatic necrosis disease (AHPND) is an emerging disease reported recently that has caused massive loss to saline shrimp aquaculture. EMS/AHPND was recognized in Vietnam since 2011 and up to now its adverse effect is still serious to shrimp industry nationwide. Determination of the main pathogenic factor and the role of other microbial candidates is a very important study. This report shares results of a metagenome analysis on bacterial diversity at community level that has been one of critical research efforts on EMS/AHPND in Vietnam in recent time. A total of 7 metagenomic samples were extracted from farmed penaeid shrimp hepatopancrea tissues including 2 samples of healthy shrimp populations and 5 others of infected shrimps at regions of 16S rDNA, recA, and rpoB were sequenced by Illumina HiSeq technology. The DNA metagenome analysis revealed a wide range of bacteria groups up to 63/171 genera on healthy and infected shrimp hepatopancreatic samples, respectively. The mainly dominant bacteria (percentage on healthy/infected samples, respectively) were Pseudomonas (0.74/76.59%), Stenotrophomonas (0/13.44%), Enterobacter (0/1.75%), and especially Vibrio (0/1.28%). The routine pathogens such as Aeromonas, Enterobacter, Samonella, Vibrio were not found in hepatopancreatic samples of healthy shrimps. Remarkable differences in this study compared to other previous reports will be discussed with a focus on the factor Vibrio parahaemoluticus and the mechanism of transmission in relevance to prevention of the disease. Keyword: penaeid shrimp, EMS/AHPND, metagenome, bacterial diversity 1 Research Institute for Aquaculture No. 3 - Corresponding email: [email protected] 2 Institute of Biotechnology – Vietnam Academy of Science and Technology I. INTRODUCTION An emerging disease occured with serious loss to shrimp aquaculture in Asia since 2009. The outbreake of the disease so called Early Mortality Syndrome (EMS), and later defined as Acute Hepatopancreatic Necrosis Disease (AHPND) spread rapidly to Malaysia (2010), Vietnam (2011), Thailand (2012), and Mexico (2013) (Lightner et al., 2012; Leano and Mohan, 2012; Zorriehzahra and Banaederakhshan, 2015). The important effect of EMS/AHPND to shrimp production in the region has been very significant. In particular, it caused 22% shrimp production dicrease in China and 50% in Thailand in 2013. In general, EMS/AHPND epidemic made global shrimp production lower than expectation 23% (Chamberlain, 2013). In Vietnam, more than 81,000 ha of shrimp farms in Mekong Delta was lost due to EMS in the years 2011-2012 (Periodical report of Directorate of Fisheires, 2012). Several emergent efforts were done that led to preliminary conclusion of biotic toxins as causative factors of EMS/AHPND. The first brief metagenomic survey done by Centex Shrimp, Thailand showed unexpected results of finding 5 bacterial genera nerver known in shrimp previously. They were Ralstonia, Delftia, Pelomonas, Leifsonia, and Rhodococcus (Prachumwat et al., 2012). In the same time with the publication Journal of Fisheries science and Technology Special issue - 2015 30 • NHA TRANG UNIVERSITY of Loc Tran et al., (2913) reporting the agent causing EMS/AHPND, we assumed microorganisms were the target to look for and proposed that microbes played an important role in the disease quick symptome. Therefore a metagenomic study on farmed penaeid shrimp hepatopancrea was conducted. This study aims to find out the diversity of bacteria present in hepatopancrea of healthy and EMS/AHPND infected shrimps in order to speculate the main cause of the epidemic. We found that bacterial diversity in hepatopancreas of penaeid was very high and the communities in healthy and infected shrimps were very different, especially the presence of Vibrio and other pathogenic bacteria in diseased shrimps but not in healthy shrimps that has not been reported before on EMS/AHPND. II. MATERIALS AND METHODS 1. Shrimp hepatopancrea tissue sampling Penaeid shrimps (Penaeus monodon and Litopenaeus vannamei) farmed in areas of the North, Central and the South of Vietnam were collected from October 2012 to April 2013. EMS infected and healthy shrimps of 25-40 days old in pond were sampled by cutting the whole carapace with intact hepatopancreas and immediate freezing in situ with dry ice. The sample size was 50-100 individuals each for one pond. The freezing samples were quickly transported to laboratory to further steps or keeping frozen at -80ºC until DNA extraction. Infected shrimps were distinguished with healthy ones by applying a practical 5-point protocol of National Department of Animal Health. Totally 7 hepatopancreatic tissue samples were successfully collected. They were marked as TB1-1, TB2-1, TB2-2, TB3-3, TB3-4 for infected vannamei and SK3, TK3 for healthy monodon and vannamei, respectively. Figure 1. The work-flowchart in this study 2. Bacterial DNA extraction and purification Tissue samples were defrozen and ground on a sieve with lysis buffer. The go-through liquid was collected and centrifuged at 7000 rpm to get pellets. The pellets were lysed with lysozyme in TE buffer at 37ºC for 10 min, and then with proteinase-K with SDS (10%) at 56ºC for 1 hour as described by Sambrook and Russell (2001). The extract after purified with phenol/chloroform/isoamyl alcohol (25:24:1, v/v/v) was extracted with chloroform/isoamyl alcohol (24:1, v/v) and then precipitated in100% ethanol added to 0.1 volume of 3 M sodium acetate, pH 5.2. DNA was recovered by centrifuge at 15,000 rpm, 4ºC for 10 min. DNA pellets were washed with ethanol 70% and centrifuged twice and dried at room temperature in a clean bench. The dried DNA pellets were dissolved in TE buffer and checked by gel electrophoresis. Journal of Fisheries science and Technology Special issue - 2015 NHA TRANG UNIVERSITY • 31 DNA purification was done with QIAquick Gel Extraction kit followed protocol of Qiagen (USA). Resulted DNA was quantitatively and qualitatively checked by electrophoresis and NanoDrop 2000 (ThermoScientific, USA) and then stored in TE solution at -80ºC. 3. Bacteria specific library construction The amplification of specific regions of bacterial genome was targeted at V6-V8 of 16S rRNA gene (Yu and Horrison, 2004), recA (DNA recombination and repair coding gene), rpoB (RNA polymerase beta subunit coding gene) with primer pairs described in Table 1. Table 1. A list of bacteria specific primers for PCR amplification Bacterial gene Universal primer pairs and sequences (3’ -> 5’) Reference 16S rRNA 954F CACAAGCGGTGGAGCATGTGG 1393R ACAAGGCCCGGGAACGTATTCACC Yu and Horrison, 2004 recA 63F ATCGAGCGGTCGTTCGGCAAGGG 504R TTGCGCAGCGCCTGGCTCAT Gaunt et al., 2001 rpoB F1721 AACATCGGTCTGATCAACTC R2410 TGACGTTGCATGTTCGCACCCAT Ki et al., 2009 The specific amplification and amplicon quanlity control test and tagging were done by service of Macrogen Inc. (South Korea). 4. Sequencing and bioinformatic analysis A next generation sequencing technology of Illumina HiSeq was applied on GS-FLX Titanium platform to sequence the tagged amplicon libraries. Sequence data was briefly analysed with software Roch GS-FLX version 2.8. Global alignment was asscessed by BLAST to Silva rDNA database and pairwise alignment was done with Needle (Rice et al., 2000). Taxonomic assignment was made by Macrogen applying in-house software. The whole process from sequencing to biofinformatic output is shown in Figure 2. Figure 2. A schematic draw showing steps of sequencing and data analysis Journal of Fisheries science and Technology Special issue - 2015 32 • NHA TRANG UNIVERSITY III. RESULTS AND DISCUSSION 1. Shrimp hepatopancreatic metagenome and bacteria specific library construction A total of 7 DNA samples were successfully extracted and purified from shrimp hepatopancreatic tissues nationwide in which 2 were of healthy monodon and vannamei and 5 were of EMS infected vannamei. Howerver two of them were not passed the QC test to go further amplification. The amount and quality of DNA were shown in Table 2. The present study would faced the difficulty in terms of hapetopancreatic sample recovery from frozen samples and the small number of bacterial cells existing in shrimp hepatopancreas. As far as it knows this is the second shrimp metagenome project ever done with little experience and few references. Twelve bacteria specific metagenome amplicons were processed and eleven PCR products were passed the next QC test (Table 2.). To this step, PCR bias maybe caused by inhibitors somehow remained in the DNA sample should be the problem (Wilson, 1997). 2. Diversity of bacterial community in penaeid shrimp hepatopancreas In general, 173 millions nucleotides of 433.000 reads were sequenced from 10 metagenomic libraries. Taxonomic assignment resulted in 29 phyla of Bacteria kingdom. The major phyla (>1% relative abundance) included Acidobacteria, Actinobacteria, Cyanobacteria, Bacteroidetes, Firmicutes, and Proteobacteria. At genus level, total 175 genera of Bacteria kingdom were found for all samples with 3 molecular markers 16S, recA, and rpoB. Among major phyla, Proteobacteria was very predominant, even up to 99% (reads) in sample TB1-1. This finding is similar to those reported by Tzuc et al., (2014) on white-leg shrimp Litopenaeus vannamei and Cheung et al., (2015) on shrimp model Neocaridina denticulata. In those studies, Bacteroidetes, Firmicutes, Actinobacteria, and Cyanobacteria were also found at high percentage of abundance. However, a comparison of diversity at genus level showed that microbial community in penaeid shrimps was much more abundant than in shrimp Neocaridina denticulata (175 compared to 7 genera). Tzuc et al., (2014) suceesfully isolated strains of 2 genera of Vibrio and Pseudoalteromonas in the whole digestive system of white-leg shrimp. This indicates that a very small proportion of bacterial community in shrimp organs can be culturable. In addition, none of five bacteria genera found in infected shrimp reported in Thailand (Prachumwat et al., 2012) was found in this study. Table 2. A summary result record of shrimp hepatopancreatic metagenome process Metagenomic DNA ng / A260/280 Template QC test Successful specific amplification PCR product QC test Successful sequencing Successful taxonomic assignment TB1-1 7042.5 / 1.78 passed 16S, recA, rpoB 16S, recA, rpoB 16S, recA, rpoB 16S, recA, rpoB TB2-1 3380.6 / 1.69 failed TB2-2 7912.5 / 1.83 passed 16S, rpoB 16S, rpoB 16S, rpoB rpoB TB3-3 7200.0 / 1.85 passed 16S TB3-4 3562.5 / 1.71 failed SK3 5709.4 / 1.80 passed 16S, recA, rpoB 16S, recA, rpoB 16S, recA, rpoB 16S, recA, rpoB TK3 4755.0 / 1.68 passed 16S, recA, rpoB 16S, recA, rpoB 16S, recA, rpoB Journal of Fisheries science and Technology Special issue - 2015 NHA TRANG UNIVERSITY • 33 3. Bacterial abundance in healthy and EMS/AHPND infected shrimps Although the metagenomic process of healthy vannamei was resulted in unexpected results (Table 2.) and that of EMS/AHPND infected monodon was not available, it roughly showed a very different microbial composition in hepatopancreatic tissues of two groups of shrimps. In details, totally 63 bacteria genera were found in hepatopancrea of healthy monodon (SK3-16S, recA, rpoB, Fig. 3) and 171 genera found in infected vanamei (TB1-1-16S, recA, rpoB; TB2-2-rpoB). Figure 3. Diversity of bacterial community found in hepatopancreas of healthy monodon based on 16S, recA, rpoB at genus level The remarkable note that the most abundant bacteria (Pseudomonas, 76.59%; Stenotrophomonas, 13.44%; Acinetobacter, 5.95%) and other pathogenic bacteria such as Vibrio (1.28%), Enterobacter (1.75%), Aeromonas (0.01%) were not found in healthy shrimps (Table 3). Bacterial taxonomic assignment of sequences from infected shrimp was too complicated to show in a single figure at genus level, therefore it was instead shown at order level in Figure 4. Figure 4. Diversity of bacterial community found in hepatopancreas of infected vannamei based on 16S, recA, rpoB at order level Journal of Fisheries science and Technology Special issue - 2015 34 • NHA TRANG UNIVERSITY In this study, we analysed metagenomes of bacteria extracted from healthy and diseased penaeid shrimps. Taxonomic assignment showed that healthy monodon may be favourable for the inhabitation of several probiotic bacteria such as Bacillus, Rhodobacter, and Rhodopseudomonas. On the other hand, several known pathogenic bacteria found in EMS/AHPND infected vannamei but not in healthy monodon. These were Pseudomonas, Vibrio, Aeromonas, Enterobacter. Tran et al. (2013) reported that the causative factor of EMS/AHPND was a strain of Vibrio parahaemolyticus having a virulent gene. Other genomic works later found the virulent gene encoding a strong toxin (Yang et al., 2014). It means that even present at a low density, the toxic bacterium can cause death to shrimp. Therefore Vibrio although found in this study at a low abundance but it must be important to mention. Other pathogenic bacteria present at higher abundance may play an opportunistic role of the disease progress. In such a context, it is possible that the transmission of the mobile toxin gene can be performed from V. parahaemolyticus to these bacteria and the epidemic becomes more complicated to track out. This requires further research in order to understand fully the mechanism of the quick and wide infection of EMS/AHPND. IV. CONCLUSION Diverse bacterial communities were found in hepatopancreas of penaeid shrimps. They were diversely different groups in healthy and EMS/AHPND infected shrimps. The abundance Table 3. Comparison of bacterial diversity infected in healthy and diseased shrimp hepatopancreas Major genera Healthy shrimp* EMS/AHPND infected shrimp* Acidothermus present (1.47%) absent Acinetobacter absent present (5.95%) Aeromonas absent present (0.01%) Bacillus present (0.25%) absent (0.03%) Chryseobacterium absent present (17.9%) Enterobacter absent present (1.55%) Lactobacillus absent present (0.04%) Lactococcus absent present (0.08%) Methylobacterium absent present (1.65%) Nitrospira present (2.1%) absent Paenibacillus present (3.35%) present minor Pedobacter present (7.1%) absent Pseudomonas present (0.74%) present (38.4%) Rhodobacter present (1.77%) absent Rhodopseudomonas present (3.52%) absent Salmonella absent present (0.04%) Stenotrophomonas present minor present (7.22%) Vibrio absent present (1.28% Notes: * average relative abundance based on percentage of reads in taxonomic assignment. A large proportion of reads was not successfully referred from database, sorted as unknown, about 80% for healthy shrimp and about 30% of those for infected shrimp Journal of Fisheries science and Technology Special issue - 2015 NHA TRANG UNIVERSITY • 35 of the pathogenic groups indicates their roles and their interaction in causing the complicated pathological signs of EMS/ AHPND. Further studies are needed to figure out the importance of Pseudomonas, Stenotrophomonas, Chryseobacterium, and Enterobacter in addition to Vibrio in the EMS/AHPND infection. ACKNOWLEDGEMENT This study is granted by Ministry of Agriculture and Rural development of Vietnam. We are appreciated kind supports from Research Institute for Aquaculture No.3. Thanks to Organising Committee of Molecular Biotechnology and Environment, MBE2015, Nha Trang University for opportunity to join the conference. REFERENCES 1. Directorates of Fisheries, Ministry of Agriculture and Rural development, 2012. Periodical report. 2. Chamberlain G., 2013. Early mortality syndrome: Managing the perfect killer. Webinar, Global Aquaculture Alliance, Ho Chi Minh, December 2013. 3. Cheung M. K., Yip H. Y., Nong W., Law P. T. W., Chu K. H., Kwan H. S., Hui J. H. L., 2015. Rapid change of microbiota diversity in the gut but not the hepatopancreas during gonadal development of the new shrimp model Neocaridina denticulata. Mar. Biotechnol., DOI 10.1007/s10126-015-9662-8. 4. Gaunt M. W., Turner S. L., Rigottier-Gois L., Lloyd-Macgilp S. A., Young J. P., 2001. Phylogenies of atpD and recA support the small subunit rRNA-based classification of rhizobia. Int. J. Syst. Evol. Microbiol., 51(Pt6): 2037-2048. 5. Ki J. S., Zhang W., Qian P.-Y., 2009. Discovery of marine Bacillus species by 16S rRNA and rpoB comparison and their usefulness for species identification. J. Microbiol. Meth., 77: 48-57. 6. Leano E. M., Mohan C.V., 2012. Early mortality syndrome (EMS)/Acute Hepatopancreatic Necrosis Syndrome (AHPNS): An emerging threat in the Asian shrimp industry. Network of Aquaculture Centres in Asia-Pacific. Asian fisheries society . Fish health section. Electronic newsletter. No. 10. 7. Lightner D.V., Redman R.M., Pantoja C.R., Noble B.I., Tran L., 2012 Early mortality syndrome affects shrimp in Asia. Glob. Aquacul. Adv., January/February 2012:40. 8. Prachumwat A., Thitamadee S., Sriurairatana S., Chuchird N., Limsuwan C., Jantratit W., Chaiyapechara S., Flegel T.W., 2012. Shortgun sequencing of bacteria from AHPNS a new shrimp disease threat for Thailand. 9. Rice P., Longden I., Bleasby A., 2000. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet., 16(6): 276-277. 10. Sambrook J., Russell D. W., 2001. Molecular Cloning: A Laboratory Manual, 3rd Ed. Cold Spring Harbor Lab Press, New York, 999 pp. 11. Tran L., Nunan L., Redman R. M., Mohney L. L., Pantoja C. R., Fitzsimmons K., Lightner D. V., 2013. Determination of the infectious nature of the agent of acute hepatopancreatic necrosis syndrome affecting penaeid shrimp. Dis. Aquat. Org., 105: 45-55. 12. Tzuc J. T., Escalante D. R., Herrera R. R., Cortes G. G., 2014. Microbiota from Litopenaeus vannamei: digestive tract microbial community of Pacific white shrimp (Litopenaeus vannamei). SpringerPlus, 3: 280. 13. Wilson I. G., 1997. Inhibition and facilitation of nucleic acid amplification. Appl. Envir. Microbiol., 63(10): 3741-3751. 14. Yang Y.-T., Chen I.-T., Lee C.-T., Chen C.-Y., Lin S.-S., Hor L.-I., Tseng T.-C., Huang Y.-T., Sritunyalucksana K., Thitamadee S., Wang H.-C., Lo C.-F., 2014. Draft genome sequences of four strains of Vibrio parahaemolyticus, three of which cause Early Mortality Syndrome/Acute Hepatopancreatic Necrosis Disease in shrimp in China and Thailand. Genome Announcements, 2(5): e00816-14. 15. Yu, Z., Morrison M., 2004. Comparisons of different hypervariable regions of rrs genes for use in fingerprinting of microbial communities by PCR-denaturing gradient gel electrophoresis. Appl. Environ. Microbiol., 70: 4800–4806. 16. Zorriehzahra M. J., Banaederakhshan R., 2015. Early mortality syndrome (EMS) as new emerging threat in shrimp industry. Adv. Anim. Vet. Sci., 3(2s): 64-72.

Các file đính kèm theo tài liệu này:

  • pdfbacterial_diversity_in_penaeid_shrimp_hepatopancreas_reveale.pdf
Tài liệu liên quan