Đột biến gen Egfr và Kras trên bệnh nhân ung thư phổi không tế bào nhỏ

Đột biến gen KRAS Trong các nghiên cứu lâm sàng, đột biến codon 12 và 13 của KRAS đã được chứng minh là yếu tố gây kháng nguyên phát với các thuốc ức chế EGFR (15, 24). Hơn 95% trường hợp đột biến KRAS xảy ra ở codon 12 và 13 của exon 2; các đột biến KRAS tại codon 61 và 146 rất hiếm gặp và ý nghĩa lâm sàng cũng chưa rõ ràng (4). Trong nghiên cứu này, chúng tôi giải trình tự exon 2 của gen KRAS, là vùng có chứa codon 12 và 13. Trên 71 bệnh nhân đã được khảo sát KRAS, có 24 trường hợp mang đột biến ở codon 12 hay codon Trong số 33 bệnh nhân có mang đột biến KRAS (46,5%), 7 trường hợp đột biến ở hai codon, phù hợp tính đa dòng tế bào trong ung thư nói chung và ung thư phổi nói riêng(10). Một điểm rất đáng quan tâm là chúng tôi phát hiện đột biến KRAS trong cả nhóm có mang đột biến EGFR lẫn nhóm không có đột biến EGFR (Bảng 2). Các nghiên cứu trước đây thường ghi nhận rằng đột biến EGFR và đột biến KRAS loại trừ lẫn nhau(3, 24). Tuy nhiên, khi ứng dụng kỹ thuật có độ nhạy cao để phát hiện đột biến KRAS, như kỹ thuật mutant-enriched sequencing, cũng có những nghiên cứu ghi nhận đột biến KRAS gặp trong những trường hợp có đột biến EGFR và là nguyên nhân kháng thuốc nguyên phát (14). Kết 13 được phát hiện, chiếm 34% (Hình 2). Tỷ lệ này tương đồng với nhiều nghiên cứu trước đây (3, 15). Ngoài codon 12 và 13, chúng tôi còn phát hiện 9 trường hợp có đột biến tại các codon 9, 10, 14, 15, 18, 22 và 33. Các kết quả này đều được khẳng định bằng cách lập lại thí nghiệm 2 lần từ bước PCR. Một số trong các đột biến này cũng đã được báo cáo trong cơ sở dữ liệu COSMIC (Catalogue Of Somatic Mutations In Cancer), tuy nhiên ý nghĩa trong lâm sàng vẫn chưa được tìm hiểu.

pdf7 trang | Chia sẻ: hachi492 | Ngày: 28/01/2022 | Lượt xem: 76 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Đột biến gen Egfr và Kras trên bệnh nhân ung thư phổi không tế bào nhỏ, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 4 * 2011 Chuyên Đề Điều Dưỡng Kỹ Thuật Y Học 166 ĐỘT BIẾN GEN EGFR VÀ KRAS TRÊN BỆNH NHÂN UNG THƯ PHỔI KHÔNG TẾ BÀO NHỎ Hoàng Anh Vũ*, Cao Văn Động**, Ngô Thị Tuyết Hạnh***, Đặng Hoàng Minh***, Phan Thị Xinh****, Hứa Thị Ngọc Hà***. TÓM TẮT Giới thiệu: EGFR bị đột biến gây nên ung thư phổi không tế bào nhỏ (UTPKTBN) và là một đích điều trị hiệu quả của gefitinib và erlotinib. Tần suất đột biến của EGFR rất khác nhau giữa các chủng tộc. Trái lại, đột biến KRAS là một yếu tố gây kháng với điều trị bằng thuốc ức chế EGFR. Nghiên cứu này nhằm mô tả phổ đột biến của 2 gen EGFR và KRAS trên bệnh nhân Việt Nam, giúp tiên đoán đáp ứng lâm sàng với gefitinib và erlotinib. Đối tượng và phương pháp nghiên cứu: Từ tháng 11/2010 đến tháng 08/2011, 71 bệnh nhân UTPKTBN tại Bộ môn Giải Phẫu Bệnh – Đại học Y Dược TPHCM được khảo sát đột biến gen. Chúng tôi sử dụng kỹ thuật PCR (polymerase chain reaction) để khuếch đại vùng chứa các exon 18 – 21 của EGFR và exon 2 của KRAS từ bệnh phẩm là mô vùi nến. Sau đó đột biến của EGFR và KRAS được xác định bằng kỹ thuật giải trình tự chuỗi DNA. Kết quả: 30 trường hợp có đột biến của EGFR (42%), trong đó có 4 trường hợp đột biến exon 18, 2 đột biến intron 18, 7 đột biến exon 19, 1 đột biến exon 20 và 16 đột biến exon 21. Trong 33 trường hợp có đột biến KRAS (46,5%), 24 trường hợp đột biến codon 12 hoặc 13 và 9 trường hợp đột biến các codon 9, 10, 14, 15, 18, 22 và 33. Có 12 trường hợp mang cùng lúc đột biến của cả 2 gen này Kết luận: Bệnh nhân Việt Nam bị UTPKTBN có tần suất đột biến EGFR và KRAS cao nhưng hai đột biến không loại trừ lẫn nhau. Giải trình tự chuỗi DNA để chẩn đoán đột biến gen có thể giúp chọn lựa bệnh nhân phù hợp cho điều trị thuốc kháng EGFR. Từ khóa: đột biến, gen EGFR, gen Kras, ung thư phổi không tế bào nhỏ ABSTRACT EGFR AND KRAS MUTATIONS IN PATIENTS WITH NON-SMALL CELL LUNG CANCER Hoang Anh Vu, Cao Van Dong, Ngo Thi Tuyet Hanh, Dang Hoang Minh, Phan Thi Xinh, Hua Thi Ngoc Ha * Y Hoc TP. Ho Chi Minh * Vol. 15 - Supplement of No 4 - 2011: 165 - 171 Background: EGFR mutations lead to non-small cell lung cancer (NSCLC) and are targets for selective therapy by gefitinib and erlotinib. The frequency of EGFR mutations are varied among different races. In contrast, KRAS mutations are significantly associated with absence of responsiveness to EGFR inhibitors. This study was performed to characterize the frequency and pattern of EGFR and KRAS mutations in Vietnamese patients, predicting clinical response to gefitinib and erlotinib. Materials and methods: From November, 2010 to August, 2011, 71 patients with NSCLC at Department of Pathology – University of Medicine and Pharmacy were analyzed for gene mutations. PCR (polymerase chain reaction) was used to amplify EGFR exons 18 – 21 and KRAS exon 2 from paraffin-embedded tissue samples. *Bộ môn Mô – Phôi, Đại học Y Dược TP.HCM **Đại học Khoa học Tự Nhiên TP.HCM ***Bộ môn Giải Phẫu Bệnh, Đại học Y Dược TP.HCM ****Bộ môn Huyết học, Đại học Y Dược TP.HCM Tác giả liên lạc: .TS Hoàng Anh Vũ ĐT: 01222993537 Email: hoangvuxinh@yahoo.com Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 4 * 2011 Nghiên cứu Y học Chuyên Đề Điều Dưỡng Kỹ Thuật Y Học 167 Mutations were identified by direct DNA sequencing. Results: Thirty EGFR mutations were detected (42%), including 4 mutations in exon 18, 2 in intron 18, 7 in exon 19, 1 in exon 20, and 16 in exon 21. KRAS mutations were found in 33 samples (46.5%). Among which, 24 mutations were in codon 12 or 13, and other 9 mutations were in codons 9, 10, 14, 15, 18, 22, and 33. Concurrent mutations in EGFR and KRAS were detected in 12 patients. Conclusion: High frequency of mutations in EGFR and KRAS were found in Vietnamese patients with NSCLC. However, mutations in the two genes were not mutually exclusive. Direct DNA sequencing can detect gene mutations for selecting NSCLC patients benefit from EGFR inhibitors. Key words: mutation, EGFR, KRAS, non-small cell lung cancer. ĐẶT VẤN ĐỀ Ung thư phổi chiếm tỷ lệ cao nhất và cũng là nguyên nhân tử vong hàng đầu trong tất cả các bệnh ung thư. Trên thế giới, trong số khoảng 12,7 triệu trường hợp ung thư mới được chẩn đoán hằng năm, ung thư phổi chiếm 1,61 triệu trường hợp (12,7% ), với 1,38 triệu trường hợp tử vong(6). Tại Việt Nam, ung thư phổi nguyên phát có xuất độ cao, đặc biệt ở nam giới, với tỷ lệ 24,6 bệnh nhân/ 100.000 dân tại khu vực Thành Phố Hồ Chí Minh và – 38,8 bệnh nhân/ 100.000 dân tại khu vực Hà Nội (1). Từ năm 2005 -2006, trong 93.719 trường hợp tử vong do ung thư có 22.209 do ung thư phổi (17). Đột biến gen EGFR trong NSCLC được báo cáo lần đầu tiên năm 2004 trên những bệnh nhân có đáp ứng với gefitinib(12,19). Đột biến xảy ra tại các exon 18 – 21, khiến cho protein EGFR luôn trong trạng thái hoạt hóa không phụ thuộc chất truyền tín hiệu ngoại bào. Do các đột biến rất đa dạng, kỹ thuật giải trình tự chuỗi DNA được coi là tốt nhất để khảo sát các đột biến EGFR. Thường gặp nhất là đột biến mất đoạn (deletion) xảy ra trên exon 19, kế đến là đột biến điểm L858R tại exon 21. Các đột biến thêm đoạn (duplication) trên exon 20 hay đột biến điểm trên exon 18 ít gặp hơn. Đặc biệt, đột biến hầu như chỉ gặp trên loại carcinôm tuyến, rất hiếm khi tìm thấy ở carcinôm gai – tuyến(13, 22). Hơn nữa, tỷ lệ bệnh nhân có mang đột biến EGFR rất khác nhau giữa các chủng tộc: Tỷ lệ này chỉ xấp xỉ 3% ở người Mỹ, nhưng lên đến khoảng 32% ở người Nhật(19), 36,4% ở Hàn Quốc (2), 55% ở Đài Loan(8) và 57,4% ở Thái Lan (21). Erlotinib (biệt dược Tarceva của Roche) và gefitinib (biệt dược Iressa của Astrazeneca) là thuốc ức chế đặc hiệu EGFR. Trên bệnh nhân châu Á, Iressa tỏ ra rất hiệu quả, đặc biệt nếu bệnh nhân có mang đột biến của EGFR, với tỷ lệ sống thêm 1 năm là 79%(23). Ngay cả những trường hợp đã có di căn não, erlotinib và gefitinib cũng tỏ ra có hiệu quả trên bệnh nhân có mang đột biến EGFR(9). Các kết quả nghiên cứu nhằm tìm ra những chỉ điểm sinh học cho đáp ứng với thuốc ức chế đặc hiệu EGFR cho thấy tình trạng đột biến gen EGFR chính là yếu tố tiên đoán chính xác nhất(20, 25). Mặt khác, trong những con đường truyền tín hiệu nội bào của thụ thể EGFR, có sự tham gia của trục RAS/RAF/MAPK (7). Nếu KRAS ở trạng thái bình thường (wild-type KRAS), hoạt động của nó phụ thuộc vào hoạt tính của thụ thể EGFR. Trái lại, khi có đột biến của KRAS, nó sẽ tự hoạt hóa không phụ thuộc EGFR. Các nghiên cứu thử nghiệm lâm sàng trong NSCLC đã chứng minh rằng điều trị bằng thuốc ức chế đặc hiệu EGFR chỉ có hiệu quả trong những trường hợp không kèm đột biến tại KRAS(15, 24). Tại Việt Nam, đã có nhiều nghiên cứu về dịch tễ học, lâm sàng và giải phẫu bệnh của ung thư phổi, nhưng thiếu các nghiên cứu đi sâu tìm hiểu cơ chế phân tử của căn bệnh phổ biến này. Nghiên cứu này nhằm mô tả phổ đột biến của 2 gen EGFR và KRAS trên bệnh nhân Việt Nam, Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 4 * 2011 Chuyên Đề Điều Dưỡng Kỹ Thuật Y Học 168 giúp tiên đoán đáp ứng lâm sàng với gefitinib và erlotinib. ĐỐI TƯỢNG - PHƯƠNG PHÁP NGHIÊN CỨU Đối tượng nghiên cứu Bệnh nhân được chẩn đoán ung thư phổi và có bệnh phẩm lưu trữ tại Bộ môn Giải Phẫu Bệnh - Đại học Y Dược Tp. Hồ Chí Minh trong giai đoạn từ 10/2009 đến 08/2011. Tất cả các mẫu bệnh phẩm đều được chẩn đoán xác định bằng nhuộm HE thường qui, thuộc 1 trong các thể giải phẫu bệnh sau: carcinôm tuyến, carcinôm tế bào gai, carcinôm gai – tuyến và carcinôm tế bào lớn. Tách chiết genomic DNA Bệnh phẩm là mô vùi nến đã dùng để chẩn đoán giải phẫu bệnh. Trường hợp là bệnh phẩm phẫu thuật, vùng mô ung thư được đánh dấu trên lam giải phẫu bệnh để phân biệt với vùng mô lành xung quanh (từ 5 – 10 tiêu bản), rồi được cạo vào tube ly tâm 1,5 mL bằng các lưỡi dao phẫu thuật riêng biệt. Những trường hợp bệnh phẩm sinh thiết quá nhỏ không thể đánh dấu phân biệt vùng ung thư và mô lành nên được thu toàn bộ vào tube ly tâm. Xylene (Merck, Đức) được thêm vào tube ly tâm 2 lần để khử nến, sau đó được rửa lại bằng ethanol tuyệt đối và để khô trước khi ủ với proteinase K (Invitrogen, Mỹ) trong dung dịch đệm ở 480C trong 16 giờ. Tinh sạch sản phẩm DNA sau khi ủ proteinase K được thực hiện bằng phenol – chloroform (Invitrogen, Mỹ). Cuối cùng, kết tủa DNA bằng ethanol tuyệt đối trong muối NH4OAC. DNA được pha loãng trong 25 – 50 µL nước cất và định nồng độ DNA bằng spectrophotometer. Khuếch đại các exon bằng PCR: Các đoạn mồi (Bảng 1) được thiết kế bằng phần mềm Oligo 4.1 dựa trên trình tự chuẩn của EGFR mang accession number NG_007726 trong GenBank và của KRAS mang accession number NG_007524. Trong mỗi tube PCR có tổng thể tích 50 µL, các thành phần gồm có PCR buffer, dNTP (250 µM cho mỗi loại), 2 loại mồi xuôi và ngược (0,5 µM cho mỗi loại), 1,25 unit TaKaRa TaqTM HotStart Polymerase (Takara, Nhật Bản) và 20 ng genomic DNA. Chu kỳ luân nhiệt được thực hiện trên máy GeneAmp® PCR system 9700 (Applied Biosystems, Mỹ) bao gồm giai đoạn biến tính ban đầu ở 980C trong 2 phút, theo sau bằng 40 chu kỳ gồm biến tính ở 980C trong 10 giây, gắn mồi ở 600C trong 15 giây, tổng hợp chuỗi DNA ở 720C trong 1 phút và kết thúc bằng giai đoạn kéo dài sản phẩm ở 720C trong 5 phút. Sản phẩm PCR được phát hiện bằng điện di trên thạch agarose 1,5% có nhuộm ethidium bromide và quan sát dưới màn soi gel Pringraph (Atto, Nhật Bản). Sản phẩm PCR được tinh sạch bằng QIAquick Gel Extraction kit (Qiagen, Mỹ) và được kiểm tra lại bằng điện di trên thạch agarose 1,5%. Trong mỗi đợt thực nghiệm luôn có một tube chứng âm, trong đó genomic DNA được thay bằng nước cất đã dùng để pha master mix. Bảng 1: Các đoạn mồi dùng trong nghiên cứu Tên mồi Trình tự (5’--- 3’) Exon được khuếch đại Sản phẩm PCR (bp) EGFR.18F CATGGTGAGGGCTGAGGTGA 18 (EGFR) 252 EGFR.18R CTTGCAAGGACTCTGGGCT EGFR.19F GCATGTGGCACCATCTCACA 19 (EGFR) 217 EGFR.19R GAGAAAAGGTGGGCCTGAGG EGFR.20F ACCTGGAAGGGGTCCATGTG 20 (EGFR) 341 EGFR.20R TGCTATCCCAGGAGCGCAGA EGFR.21F TCACAGCAGGGTCTTCTCTGTTT 21 (EGFR) 212 EGFR.21R ATGCTGGCTGACCTAAAGCC KRAS.E2F AGGCCTGCTGAAAATGACTGAATA 2 (KRAS) 178 KRAS.E2R CTGTATCAAAGAATGGTCCTGCAC Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 4 * 2011 Nghiên cứu Y học Chuyên Đề Điều Dưỡng Kỹ Thuật Y Học 169 Thực hiện giải trình tự chuỗi DNA Sản phẩm PCR đã được tinh sạch sẽ được thực hiện phản ứng cycle sequencing với BigDye Terminator Version 3.1 từ Applied Biosystems, theo 2 chiều xuôi và ngược cho mỗi exon. Sản phẩm sau đó được kết tủa bằng ethanol, hòa tan trong Hi-Di formamide, biến tính ở 950C trong 2 phút trước khi làm lạnh đột ngột. Trình tự DNA được đọc bằng máy ABI 3130 Genetic Analyzer, với POP-7 polymer và capillary 50 cm (Applied Biosystems, Mỹ). Kết quả được phân tích bằng phần mềm SeqScape, so sánh với trình tự tham chiếu của EGFR và KRAS để chẩn đoán tình trạng đột biến của các exon. Quy trình chẩn đoán đột biến gen được thực hiện tại Trung tâm Y Sinh học Phân tử, Đại học Y Dược TP. Hồ Chí Minh. Các số liệu được xử lý thống kê bằng phần mềm SPSS 16.0. KẾT QUẢ VÀ BÀN LUẬN Đặc điểm lâm sàng – giải phẫu bệnh Trong thời gian từ tháng 11/2010 – 08/2011, chúng tôi đã tiến hành phân tích đột biến gen EGFR và KRAS cho 71 trường hợp, bao gồm 46 bệnh nhân nam và 25 nữ, tỷ lệ nam/nữ là 1,8/1. Tuổi trung bình của bệnh nhân là 59 tuổi (khoảng tuổi 22 - 83). Đa số bệnh nhân được chẩn đoán carcinôm tuyến, với các giai đoạn xâm lấn và di căn. Các dạng mô bệnh học khác bao gồm carcinôm tế bào gai, carcinôm tế bào lớn và carcinôm phế quản phế nang. Tiền căn hút thuốc lá không được ghi nhận đầy đủ trong hồ sơ bệnh án. Đột biến gen EGFR Các nghiên cứu trước đây đều cho thấy đột biến EGFR trong ung thư phổi tập trung tại 4 exon 18 – 21. Chúng tôi đã sử dụng kỹ thuật giải trình tự DNA để khảo sát 4 exon này cho 71 bệnh nhân, phát hiện 30 trường hợp có đột biến EGFR (42%). Tỷ lệ này tương đồng với số liệu trong các nghiên cứu của Nhật Bản và Hàn Quốc(2,19), nhưng có phần thấp hơn số liệu từ Thái Lan và Đài Loan(8,21). Chúng tôi không thấy có mối liên quan giữa đột biến EGFR với giới tính (P = 0,82) hay loại mô học của NSCLC (P = 0,63) (Bảng 2). Trong 44 trường hợp carcinôm tuyến, 45% có đột biến EGFR; trong khi các loại mô học khác cũng mang đột biến với tỷ lệ cao là 37%. Các kết quả này gợi ý rằng trong thực hành lâm sàng, mọi trường hợp NSCLC có kế hoạch điều trị bằng thuốc ức chế EGFR như gefitinib và erlotinib đều nên được chẩn đoán đột biến EGFR, không xét tới các yếu tố lâm sàng – giải phẫu bệnh. Thậm chí có những báo cáo phát hiện đột biến EGFR trong cả ung thư phổi tế bào nhỏ(18). Việc xác định đột biến EGFR có ý nghĩa quyết định trong chọn lựa điều trị. Trong nhóm 261 bệnh nhân có đột biến EGFR, thời gian sống thêm không bệnh dài hơn có ý nghĩa khi điều trị bằng gefitinib so với carboplatin/paclitaxel; trong khi nhóm 176 bệnh nhân không có đột biến cho kết quả hoàn toàn ngược lại: bệnh nhân điều trị bằng carboplatin/paclitaxel có thời gian sống thêm không bệnh dài hơn(16). Hiệp hội Ung thư Châu Âu hướng dẫn nên khảo sát đột biến gen EGFR để chọn lựa bệnh nhân NSCLC phù hợp với điều trị bước ưu tiên bằng thuốc kháng EGFR(5). Bảng 2: Tương quan đột biến gen với đặc điểm lâm sàng – giải phẫu bệnh EGFR Bình thường (n = 41) Đột biến (n = 30) P Giới Nam 27 19 1 Nữ 14 11 Loại mô học Carcinôm tuyến 24 20 0,62 Khác * 17 10 KRAS Bình thường 20 18 0,63 Đột biến 21 12 *Bao gồm carcinôm tế bào gai, carcinôm gai –tuyến và carcinôm tế bào lớn Trong những đột biến được phát hiện, đột biến tại exon 21 chiếm tỷ lệ cao nhất (16 trường hợp, 53%), kế đến là exon 19 (7 trường hợp, 23%). Exon 18 và 20 ít bị đột biến hơn (5 trường hợp cho cả hai exon, 17%). Chúng tôi cũng phát hiện 2 đột biến trong vùng cắt nối của intron 18 (IVS18-3T>C và IVS18-1G>T). Đây là những đột Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 4 * 2011 Chuyên Đề Điều Dưỡng Kỹ Thuật Y Học 170 biến có thể ảnh hưởng tới quá trình nối ghép RNA của EGFR, nhưng chúng tôi không thể khẳng định được chính xác kiểu nối ghép sai vì không có mẫu mô phù hợp cho khảo sát ở mức RNA. Kết quả nghiên cứu cho thấy các đột biến rất đa dạng, phân bố cả vùng exon và intron, bao gồm các đột biến điểm và mất đoạn (Hình 1). Để phát hiện được tất cả các đột biến này, kỹ thuật giải trình tự DNA là phù hợp nhất. Một số kỹ thuật khác dựa trên nguyên tắc ASO-PCR (allele specific oligonucleotide) hoặc ARMS-PCR (amplification refractory mutation system) chỉ tập trung phát hiện những đột biến đã biết trước, có thể sẽ bỏ sót những đột biến mới. Tuy nhiên, kỹ thuật giải trình tự DNA đòi hỏi phải có ít nhất 30% số tế bào ung thư trong mẫu ly trích DNA thì mới có thể phát hiện được đột biến(13). Như vậy những trường hợp mẫu mô quá nhỏ không thể đánh dấu phân biệt vùng mô lành và mô u sẽ có thể có kết quả âm tính giả. Kỹ thuật chẩn đoán đột biến gen bằng pyrosequencing cũng cho phép đọc tất cả các kiểu đột biến trong vùng khảo sát và có độ nhạy cao hơn kỹ thuật giải trình tự chuỗi DNA hiện đang ứng dụng trong nghiên cứu này. Tuy nhiên, hiện tại kỹ thuật pyrosequencing vẫn chưa được ứng dụng tại Việt Nam. Gần đây, kỹ thuật COLD-PCR (co- amplification at lower denaturation temperature) có thể cho phép khuếch đại ưu thế dòng alen mang đột biến, giúp cải thiện độ nhạy của kỹ thuật giải trình tự chuỗi DNA (11). Hình 1: (A) Phân bố các đột biến gen EGFR. (B) Đột biến exon 19. (C) Đột biến exon 21 Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 4 * 2011 Nghiên cứu Y học Chuyên Đề Điều Dưỡng Kỹ Thuật Y Học 171 Đột biến gen KRAS Trong các nghiên cứu lâm sàng, đột biến codon 12 và 13 của KRAS đã được chứng minh là yếu tố gây kháng nguyên phát với các thuốc ức chế EGFR (15, 24). Hơn 95% trường hợp đột biến KRAS xảy ra ở codon 12 và 13 của exon 2; các đột biến KRAS tại codon 61 và 146 rất hiếm gặp và ý nghĩa lâm sàng cũng chưa rõ ràng (4). Trong nghiên cứu này, chúng tôi giải trình tự exon 2 của gen KRAS, là vùng có chứa codon 12 và 13. Trên 71 bệnh nhân đã được khảo sát KRAS, có 24 trường hợp mang đột biến ở codon 12 hay codon 13 được phát hiện, chiếm 34% (Hình 2). Tỷ lệ này tương đồng với nhiều nghiên cứu trước đây (3, 15). Ngoài codon 12 và 13, chúng tôi còn phát hiện 9 trường hợp có đột biến tại các codon 9, 10, 14, 15, 18, 22 và 33. Các kết quả này đều được khẳng định bằng cách lập lại thí nghiệm 2 lần từ bước PCR. Một số trong các đột biến này cũng đã được báo cáo trong cơ sở dữ liệu COSMIC (Catalogue Of Somatic Mutations In Cancer), tuy nhiên ý nghĩa trong lâm sàng vẫn chưa được tìm hiểu. A B Hình 2: Đột biến codon 12 và 13 của gen KRAS. Trong số 33 bệnh nhân có mang đột biến KRAS (46,5%), 7 trường hợp đột biến ở hai codon, phù hợp tính đa dòng tế bào trong ung thư nói chung và ung thư phổi nói riêng(10). Một điểm rất đáng quan tâm là chúng tôi phát hiện đột biến KRAS trong cả nhóm có mang đột biến EGFR lẫn nhóm không có đột biến EGFR (Bảng 2). Các nghiên cứu trước đây thường ghi nhận rằng đột biến EGFR và đột biến KRAS loại trừ lẫn nhau(3, 24). Tuy nhiên, khi ứng dụng kỹ thuật có độ nhạy cao để phát hiện đột biến KRAS, như kỹ thuật mutant-enriched sequencing, cũng có những nghiên cứu ghi nhận đột biến KRAS gặp trong những trường hợp có đột biến EGFR và là nguyên nhân kháng thuốc nguyên phát (14). Kết quả nghiên cứu của chúng tôi cho thấy trong UTPKTBN cần khảo sát đồng thời cả hai đột biến EGFR và KRAS để chọn lựa bệnh nhân cho điều trị thuốc ức chế EGFR một cách thích hợp. KẾT LUẬN Đột biến EGFR được phát hiện với tỷ lệ cao trên bệnh nhân Việt Nam bị UTPKTBN, nhưng có thể kèm theo đột biến KRAS gây kháng với erlotinib hoặc gefitinib. Giải trình tự chuỗi DNA để chẩn đoán đột biến 2 gen này nên được thực hiện để giúp chọn lựa bệnh nhân phù hợp cho điều trị thuốc kháng EGFR. Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Tập 15 * Phụ bản của Số 4 * 2011 Chuyên Đề Điều Dưỡng Kỹ Thuật Y Học 172 KINH PHÍ Nghiên cứu này được thực hiện với nguồn kinh phí được cấp bởi Sở Khoa học và Công nghệ Thành phố Hồ Chí Minh. TÀI LIỆU THAM KHẢO 1. Anh PT, Duc NB (2002). The situation with cancer control in Vietnam. Jpn J Clin Oncol;32 Suppl:S92-7. 2. Bae NC, Chae MH, Lee MH, Kim KM, Lee EB, Kim CH, et al (2007). EGFR, ERBB2, and KRAS mutations in Korean non- small cell lung cancer patients. Cancer Genet Cytogenet;173(2):107-13. 3. Do H, Krypuy M, Mitchell PL, Fox SB, Dobrovic A (2008). High resolution melting analysis for rapid and sensitive EGFR and KRAS mutation detection in formalin fixed paraffin embedded biopsies. BMC Cancer;8:142. 4. Edkins S, O'Meara S, Parker A, Stevens C, Reis M, Jones S, et al (2006). Recurrent KRAS codon 146 mutations in human colorectal cancer. Cancer Biol Ther;5(8):928-32. 5. Felip E, Gridelli C, Baas P, Rosell R, Stahel R (2011). Metastatic non-small-cell lung cancer: consensus on pathology and molecular tests, first-line, second-line, and third-line therapy: 1st ESMO Consensus Conference in Lung Cancer; Lugano 2010. Ann Oncol;22(7):1507-19. 6. Ferlay J, Shin HR, Bray F, Forman D, Mathers C, Parkin DM (2010). Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer;127(12):2893-917. 7. Herbst RS, Heymach JV, Lippman SM (2008). Lung cancer. N Engl J Med;359(13):1367-80. 8. Huang SF, Liu HP, Li LH, Ku YC, Fu YN, Tsai HY, et al (2004). High frequency of epidermal growth factor receptor mutations with complex patterns in non-small cell lung cancers related to gefitinib responsiveness in Taiwan. Clin Cancer Res;10(24):8195-203. 9. Inoue A, Suzuki T, Fukuhara T, Maemondo M, Kimura Y, Morikawa N, et al (2006). Prospective phase II study of gefitinib for chemotherapy-naive patients with advanced non- small-cell lung cancer with epidermal growth factor receptor gene mutations. J Clin Oncol;24(21):3340-6. 10. Kerr KM (2009). Pulmonary adenocarcinomas: classification and reporting. Histopathology;54(1):12-27. 11. Li J, Wang L, Mamon H, Kulke MH, Makrigiorgos GM (2008). Replacing PCR with COLD-PCR enriches variant DNA sequences and redefines the sensitivity of genetic testing. Nat Med;14(5):579-84. 12. Lynch TJ, Bell DW, Sordella R, Gurubhagavatula S, Okimoto RA, Brannigan BW, et al (2004). Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med;350(21):2129-39. 13. Marchetti A, Martella C, Felicioni L, Barassi F, Salvatore S, Chella A, et al (2005). EGFR mutations in non-small-cell lung cancer: analysis of a large series of cases and development of a rapid and sensitive method for diagnostic screening with potential implications on pharmacologic treatment. J Clin Oncol;23(4):857-65. 14. Marchetti A, Milella M, Felicioni L, Cappuzzo F, Irtelli L, Del Grammastro M, et al (2009). Clinical implications of KRAS mutations in lung cancer patients treated with tyrosine kinase inhibitors: an important role for mutations in minor clones. Neoplasia;11(10):1084-92. 15. Miller VA, Riely GJ, Zakowski MF, Patel JD, Heelan RT, et al (2008). Molecular characteristics of bronchioloalveolar carcinoma and adenocarcinoma, bronchioloalveolar carcinoma subtype, predict response to erlotinib. J Clin Oncol;26(9):1472-8. 16. Mok TS, Wu YL, Thongprasert S, Yang CH, Chu DT, Saijo N, et al (2009). Gefitinib or carboplatin-paclitaxel in pulmonary adenocarcinoma. N Engl J Med;361(10):947-57. 17. Ngoan le T, Lua NT, Hang LT (2007). Cancer mortality pattern in Viet Nam. Asian Pac J Cancer Prev;8(4):535-8. 18. Okamoto I, Araki J, Suto R, Shimada M, Nakagawa K, Fukuoka M (2006). EGFR mutation in gefitinib-responsive small-cell lung cancer. Ann Oncol;17(6):1028-9. 19. Paez JG, Janne PA, Lee JC, Tracy S, Greulich H, Gabriel S, et al (2004). EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science;304(5676):1497- 500. 20. Parra HS, Cavina R, Latteri F, Zucali PA, Campagnoli E, Morenghi E, et al (2004). Analysis of epidermal growth factor receptor expression as a predictive factor for response to gefitinib ('Iressa', ZD1839) in non-small-cell lung cancer. Br J Cancer;91(2):208-12. 21. Sriuranpong V, Chantranuwat C, Huapai N, Chalermchai T, Leungtaweeboon K, Lertsanguansinchai P, et al (2006). High frequency of mutation of epidermal growth factor receptor in lung adenocarcinoma in Thailand. Cancer Lett;239(2):292-7. 22. Sugio K, Uramoto H, Ono K, Oyama T, Hanagiri T, Sugaya M, et al (2006). Mutations within the tyrosine kinase domain of EGFR gene specifically occur in lung adenocarcinoma patients with a low exposure of tobacco smoking. Br J Cancer;94(6):896-903. 23. Tamura K, Okamoto I, Kashii T, Negoro S, Hirashima T, Kudoh S, et al (2008). Multicentre prospective phase II trial of gefitinib for advanced non-small cell lung cancer with epidermal growth factor receptor mutations: results of the West Japan Thoracic Oncology Group trial (WJTOG0403). Br J Cancer;98(5):907-14. 24. Tiseo M, Rossi G, Capelletti M, Sartori G, Spiritelli E, Marchioni A, et al (2009). Predictors of gefitinib outcomes in advanced non-small cell lung cancer (NSCLC): study of a comprehensive panel of molecular markers. Lung Cancer;67(3):355-60. 25. Uramoto H, Sugio K, Oyama T, Ono K, Sugaya M, Yoshimatsu T, et al (2006). Epidermal growth factor receptor mutations are associated with gefitinib sensitivity in non-small cell lung cancer in Japanese. Lung Cancer;51(1):71-7.

Các file đính kèm theo tài liệu này:

  • pdfdot_bien_gen_egfr_va_kras_tren_benh_nhan_ung_thu_phoi_khong.pdf
Tài liệu liên quan