Nghiên cứu sự đột biến vùng D-Loop của hệ gen ti thể ở người tiếp xúc nghề nghiệp với bức xạ ion hóa liều thấp

Kết quả phân tích tương ñồng và phả hệ dựa trên dữ liệu chuỗi nucleotide vùng D-loop Mức độ tương đồng (%) về nucleotide giữa các chuỗi so sánh được trình bày ở Bảng 2. Các chuỗi của người bình thường có mức độ tương đồng cao (98 - 99%), số sai khác phản ánh mức độ đa hình các tộc người vốn gặp. Chuỗi nucleotide của các mẫu nghiên cứu cùng với tất cả các chuỗi mẫu người ung thư và các chuỗi mà chúng tôi dùng để so sánh (gồm 12 chuỗi) được sắp xếp bằng GENEDOC2.5 (Nicholas và Nicholas, 1997) và đưa vào phân tích phả hệ bằng chương trình MEGA4.0 (Tamura và cs, 2007). Kết quả được trình bày ở Hình 2 cho thấy, các chủng phân chia thành 2 nhóm rõ rệt, trong đó, mẫu NX2 (VN) của người nhiễm xạ ở Việt Nam tập hợp cùng với mẫu ung thư của người Trung Quốc, tạo nên một nhóm riêng biệt (Hình 2). Các mẫu nhiễm xạ khác (mẫu còn lại của người nhiễm xạ), tuy có những đột biến nhất định ở vùng D-loop, nhưng mức độ đột biến không lớn và vẫn tập hợp cùng các mẫu phân tích từ người bình thường của Việt Nam, châu Á, và châu Phi (Hình 2). Kết quả phân tích quan hệ phả hệ giữa các mẫu, một lần nữa khẳng định sự nhóm họp cùng nhau của các mẫu có mức độ đột biến vật lý do nhiễm xạ và có đột biến do tác nhân sinh học ung thư. Những mẫu nhiễm xạ khác, tuy vẫn cùng với các mẫu bình thường nhưng mức độ phân nhánh đã xa hơn, và có thể trải qua nhiều thế hệ phân chia tế bào của những người lao động nghề nghiệp, đến lúc nào đó, trong họ có thể xuất hiện đột biến như mẫu số 2 (NX2 (VN). Sự đột biến mức độ cao, và tỷ lệ người nhiễm xạ đột biến ty thể trên mức cho phép cảnh báo thực trạng an toàn lao động và an toàn sinh học trong môi trường nghề nghiệp. Cần có những biến pháp hữu hiệu đảm bảo môi trường cho người lao động tránh bị đột biến ty thể.

pdf8 trang | Chia sẻ: hachi492 | Ngày: 25/01/2022 | Lượt xem: 115 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Nghiên cứu sự đột biến vùng D-Loop của hệ gen ti thể ở người tiếp xúc nghề nghiệp với bức xạ ion hóa liều thấp, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Tổng quan Y Học TP. Hồ Chí Minh * Tập 14 * Phụ bản của Số 4 * 2010 Chuyên ñề Ung Bướu 3 NGHIÊN CỨU SỰ ĐỘT BIẾN VÙNG D-LOOP CỦA HỆ GEN TY THỂ Ở NGƯỜI TIẾP XÚC NGHỀ NGHIỆP VỚI BỨC XẠ ION HÓA LIỀU THẤP Nguyễn Hữu Nghĩa*, Đặng Trần Trung*, Phạm Xuân Mai*, Đái Duy Ban**, Lờ Thanh Hòa**, Nguyễn Thị Bích Nga** SUMMARY ANALYSIS OF MUTATIONS IN MITOCHONDRIAL D-LOOP REGION INDUCED BY RADIATION IN OCCUPATIONAL WORKERS IN VIETNAM Nguyen Huu Nghia, Dang Tran Trung, Pham Xuan Mai, Dai Duy Ban, Le Thanh Hoa, Nguyen Thi Bich Nga * Y Hoc TP. Ho Chi Minh – Vol.14 - Supplement of No 4 – 2010 : 3 - 9 Genetic marker for mitochondrial D-loop region (of 369-370 bp in size) from blood isolates of 40 occupational workers frequently exposed to radiation was obtained and comparatively analyzed with D-loop sequence from Chinese breast cancer patient, and normal humans including Kinh (Vietnam), Han and Chinese (China), Fillipino (Asia) and Morrocian (Africa). As results, it revealed that there are 40 nucleotide mutations among the isolates compared, of which, apart from variations resulting from polymorphism common among human clades, many are originated from mutated DNA synthesis due to affection of radiation or cancer. Majority of 40 studied humans have point-mutations dominant in 9 positions and the second human (isolate: NX2(VN)) possesses largest number of mutations compared to normal ones. Mutations at 7 positions in this NX2 human are similar to those found in a patient having breast cancer (BRC-BN10(CN)) due to the malsynthesis of DNA in mitochondrial genome. Severe mutations including point-, insertion-deletion (indel) are mostly consequence of damaging DNA syntheis, giving a rise to warn that attention to biological safety must be paid in order to protect occupational workers exposed to radiation. Key words: D-loop, mitochondrion, polymorphism, exposure to radiation, mutation, pathogenicity. ĐẶT VẤN ĐỀ Các tác nhân gây ung thư trong đó có bức xạ ion hóa thường gây nên nhiều dạng đột biến nghiêm trọng trong hệ gen ty thể của người và động vật (Hochhauser, 2000; Kim và CS, 2006). Trong các dạng đột biến, đột biến đứt đoạn và đột biến điểm thường gặp nhiều nhất, người ta gọi đó là “đột biến thường xuyên” (CD, common deletion (Wang và cs, 2007). Hệ gen ty thể ở người (Homo sapiens) có độ dài là 16569 cặp nucleotide, mã hóa cho 13 gen cho sản phẩm protein, 2 gen RNA ribôxôm, 22 gen của RNA vận chuyển và một phần không gen có chứa vùng Dloop điều hòa sao chép gen (Anderson và CS, 1981). Vùng D-loop trong hệ gen ty thể của người hiện đại có độ dài 1158 cặp nucleotide, giới hạn giữa RNA vận chuyển Proline (tRNAPro) và RNA vận chuyển Phenylalanine (tRNAPhe), và là vùng * Viện Y Học Phóng xạ và U Bướu Quân Đội ; ** Viện Công nghệ Sinh Học Địa chỉ liên lạc: BS. Nguyễn Hữu Nghĩa. Email: nghiaubqd@hotmail.com Tổng quan Y Học TP. Hồ Chí Minh * Tập 14 * Phụ bản của Số 4 * 2010 Chuyên ñề Ung Bướu 4 điều hòasự nhân lên của ty thể trong tế bào. Vùng này có nhiều cấu trúc lặp và có điễm mầm (origin), có nhiều biến đổi đặc trưng cho loài, và nhiều đột biến diễn tiến của nhiều bệnh và hội chứng, trong đó có ung thư và chịu tác động của các tác nhân ngoại lai (Rosson và Keshgegian, 2004; Pang và CS, 2007). Hệ gen ty thể bao gồm nhiều gen mã hóa tổng hợp protein enzym cần thiết cho quá trình ô xy hóa-khử, mà vùng D- loop chịu trách nhiệm vai trò điều hòasinh tổng hợp (Irwin, 2008). Do vai trò quan trọng như vậy, hệ gen ty thể luôn luôn là đích chịu tác động của các tác nhân gây đột biến, trong đó có tác nhân sinh học và vật lý (Wallace, 1999). Trong nghiên cứu này chúng tôi giới thiệu kết quả phát hiện một số loại hình đột biến xảy ra ở vùng D-loop trên một số đối tượng trong số 40 đối tượng tiếp xúc với bức xạ ion hóa trong lao động nghề nghiệp, cảnh báo cần nâng cao an toàn lao động trong môi trường bức xạ ion hóa. NGUYÊN LIỆU VÀ PHƯƠNG PHÁP Mẫu nghiên cứu Mẫu nghiên cứu: Máu chống đông thu nhận từ 40 đối tượng đang lao động trong môi trường bức xạ ion hóa liều thấp. Mẫu được bảo quản ở điều kiện lạnh –20°C, sử dụng để tách chiết DNA tổng số. Tách chiết DNA tổng số Hệ gen ty thể cùng với hệ gen nhân là toàn bộ DNA có trong tế bào, gọi là DNA tổng số, được tách chiết bằng bộ hóa chất QIAamp DNA Kit (QIAGEN Inc.) theo qui trình của nhà sản xuất. Mô tả rút gọn như sau: Mẫu bệnh phẩm được ly tâm, lấy tế bào, xử lý với các dung môi của Kit, hấp phụ lên màng và ly chiết thu nhận DNA theo qui trình tách chiết. Tính toán hàm lượng DNA tổng số và sử dụng khoảng 150 nanogam trong dung tích là 50 microlit mỗi phản ứng PCR. Chọn mồi, thực hiện phản ứng RT-PCR Cặp mồi (primer) sử dụng cho phản ứng PCR (polymerase chain reaction), nhân đoạn DNA vùng D-loop, bao gồm mồi xuôi DLF, định vị trên RNA vận chuyển Proline (tRNAPro) (5’CTCCACCATTAGCACCCAAAGC3’) và mồi ngược DLR, định vị trên RNA vận chuyển Phenylalanine (tRNAPhe) (5’ CACGGAGGATGGTGGTCAAG 3’). Sản phẩm PCR có độ dài khoảng 440 nucleotide. DNA đích của vùng D-loop đã được nhân bản bằng PCR, với bộ hóa chất PCR Master Mix Kit (Promega). Chu trình nhiệt của PCR trên máy MJ (Mỹ) gồm các bước như sau: 940C/5 phút trong 1 chu kỳ; tiếp theo là 35 chu kỳ ở 940C/1 phút, 500C/1 phút và 720C/1 phút; chu kỳ cuối kéo dài 10 phút ở 720C. Bảng 1. Liệt kê các chuỗi DNA vùng D-loop phân tích so sánh với các mẫu nghiên cứu Ký hiệu chuỗi so sánh Loài Vùng gen Độ dài (bp) Nguồn gốc Số ñăng ký Ngân hàng gen NX1(VN) người (tiep xuc BX) D-loop 369 Việt Nam Đang ñăng ký NX2(VN) người (TXBX) D-loop 370 Việt Nam Đang ñăng ký Tổng quan Y Học TP. Hồ Chí Minh * Tập 14 * Phụ bản của Số 4 * 2010 Chuyên ñề Ung Bướu 5 NX3(VN) người (TXBX) D-loop 369 Việt Nam Đang ñăng ký NX4(VN) người (TXBX) D-loop 369 Việt Nam Đang ñăng ký NX6(VN) người (TXBX) D-loop 369 Việt Nam Đang ñăng ký BRC(BN10)- CN người (ung thư) D-loop 369 Trung Quốc EF429141 BT-VN71(Vie) người (bình thường) D-loop 369 Việt Nam DQ834256 BT-Viet0040 người (bình thường) D-loop 369 Việt Nam DQ535941 BT- CN(XJ8416) người (bình thường) D-loop 369 Trung Quốc AY255157 BT-han (SD10334)CN người (bình thường) D-loop 369 Trung Quốc AY255154 BT-Phil người (bình thường) D-loop 369 Philippine AF382012 BT-Mor người (bình thường) D-loop 369 Morroco AF381990 Tách dòng sản phẩm Sản phẩm PCR được tinh sạch bằng bộ hóa chất QIAquick PCR Purification Kit (QIAGEN) và được dòng hóa vào vector pCR2.1-TOPO của bộ hóa chất TA-cloning Kit (Invitrogen Inc.). Vector tái tổ hợp tiếp nhận sản phẩm PCR được chuyển nạp vào dòng tế bào DH5-T1 và chọn lọc khuẩn lạc theo phương pháp kháng sinh và chỉ thị màu (Sambrook và Russell, 2001). DNA của plasmid có chứa PCR (tái tổ hợp) được tách chiết với bộ hóa chất QIAprep Spin Plasmid Extraction Kit (QIAGEN Inc.). Chuỗi DNA được giải trình tự trên máy giải trình tự động ABI Genetic Analyzer Avant 3100 tại Viện Công nghệ sinh học, thực hiện với số lượng nhiều plasmid tái tổ hợp nhằm thu được kết quả chính xác. Xử lý số liệu, so sánh bằng ñối chiếu và phân tích phả hệ Bằng phương pháp truy cập Ngân hàng gen tại ( chúng tôi thu nhận hệ gen ty thể của người bình thường Việt Nam (DQ834256; DQ535941), Trung Quốc, Phillipine, Marốc và người Trung Quốc bị ung thư, để phân tích so sánh (Bảng 1). Sắp xếp, đối chiếu trình tự tương ứng của các chuỗi nucleotide bằng hệ chương trình máy tính AsemblyLIGNv1.9 và MacVector8.5 (Accelrys Inc.) trên máy tính Macintosh. So sánh đối chiếu và xử lý số liệu của các chuỗi bằng chương trình GENEDOC2.5 (Nicholas và Nicholas, 1997), sau đó phân tích phả hệ chương trình MEGA4.0 (Tamura và CS, 2007). KẾT QUẢ VÀ BÀN LUẬN Kết quả thu nhận và phân tích ñột biến các chuỗi DNA vùng D-loop của nhóm nghiên cứu Tổng quan Y Học TP. Hồ Chí Minh * Tập 14 * Phụ bản của Số 4 * 2010 Chuyên ñề Ung Bướu 6 Từ các mẫu nghiên cứu, chúng tôi sử dụng cặp mồi bám vào 2 đầu vùng D-loop (DLF-DLR), thu được sản phẩm PCR là đoạn DNA có độ dài 440 bp, điện di trên gel agarose 1% để kiểm tra. Tách dòng chọn lọc, và giải trình trình tự, từ đó, chọn chuỗi có độ dài khoảng 369-370 bp đưa vào phân tích. Trình tự và phân tích biến đổi thành phần nucleotide của phân đoạn DNA trong vùng D-loop thu nhận từ hệ gen ty thể các mẫu của người lao động nhiễm xạ, của người bị ung thư vú, của người bình thường Việt Nam và một số tộc người đại diện các châu của thế giới được trình bày ở hình 1. Có tất cả 40 vị trí có sự sai khác về nucleotide giữa các chủng, chủ yếu là các dạng đột biến điểm hoặc đột biến điểm thêm vào hay bớt đi 1 nucleotide. Những sai khác thuộc dạng đa hình giữa các chủng/tộc người thường gặp trên thế giới, ví dụ tại vị trí 88, 93, 153, 156, 261, 262, 328, 366 là những dấu hiệu bình thường phân biệt các tộc người (Hình 1). Tuy nhiên, so với chuỗi DNA vùng D- loop của các tộc người bình thường trên thế giới và người Việt Nam (VN-71 và Viet0040), tất cả các mẫu của người nhiễm xạ đều có những đột biến khác biệt, trong đó mẫu số 2 (NX2 (VN)) có hiện tượng đột biến thêm nucleotide ở vị trí 320 và 323 (Hình 1). Những đột biến khác còn được tìm thấy ở vị trí 104, 146, 147, 181, 187, 238, 299, chỉ có ở mẫu (NX2(VN)) và mẫu bị ung thư của người Trung Quốc (mẫu BRC- (BN10)CN), và có lẽ mang đặc tính đột biến do tác động của các tác nhân sinh học và vật lý ảnh hưởng đến quá trình sinh tổng hợp DNA (phần đóng khung ở Hình 1). Mẫu nghiên cứu số 1 (mẫu NX1 (VN) không có nhiều đột biến do nhiễm xạ, có thể coi là còn ở mức độ bình thường; các mẫu nhiễm xạ khác (mẫu NX3(VN), NX4(VN), NX6(VN)) tuy có nhiều sai khác hơn nhưng cũng không lớn đến mức vượt xa so với bình thường. Như vậy, trong số mẫu nghiên cứu, một mẫu có thể coi là bị đột biến do nhiễm xạ nghề nghiệp được xác định bằng sinh học phân tử, và điều này cần chú ý công tác bảo hộ an toàn bức xạ, thực sự chưa đảm bảo an toàn sinh học. Kết quả phân tích tương ñồng và phả hệ dựa trên dữ liệu chuỗi nucleotide vùng D-loop Mức độ tương đồng (%) về nucleotide giữa các chuỗi so sánh được trình bày ở Bảng 2. Các chuỗi của người bình thường có mức độ tương đồng cao (98 - 99%), số sai khác phản ánh mức độ đa hình các tộc người vốn gặp. Chuỗi nucleotide của các mẫu nghiên cứu cùng với tất cả các chuỗi mẫu người ung thư và các chuỗi mà chúng tôi dùng để so sánh (gồm 12 chuỗi) được sắp xếp bằng GENEDOC2.5 (Nicholas và Nicholas, 1997) và đưa vào phân tích phả hệ bằng chương trình MEGA4.0 (Tamura và cs, 2007). Kết quả được trình bày ở Hình 2 cho thấy, các chủng phân chia thành 2 nhóm rõ rệt, trong đó, mẫu NX2 (VN) của người nhiễm xạ ở Việt Nam tập hợp cùng với mẫu ung thư của người Trung Quốc, tạo nên một nhóm riêng biệt (Hình 2). Các mẫu nhiễm xạ khác (mẫu còn lại của người nhiễm xạ), tuy có những đột biến nhất định ở vùng D-loop, nhưng mức độ đột biến không lớn và vẫn tập hợp cùng các mẫu phân tích từ người bình thường của Việt Nam, châu Á, và châu Phi (Hình 2). Kết quả phân tích quan hệ phả hệ giữa các mẫu, một lần nữa khẳng định sự Tổng quan Y Học TP. Hồ Chí Minh * Tập 14 * Phụ bản của Số 4 * 2010 Chuyên ñề Ung Bướu 7 nhóm họp cùng nhau của các mẫu có mức độ đột biến vật lý do nhiễm xạ và có đột biến do tác nhân sinh học ung thư. Những mẫu nhiễm xạ khác, tuy vẫn cùng với các mẫu bình thường nhưng mức độ phân nhánh đã xa hơn, và có thể trải qua nhiều thế hệ phân chia tế bào của những người lao động nghề nghiệp, đến lúc nào đó, trong họ có thể xuất hiện đột biến như mẫu số 2 (NX2 (VN). Sự đột biến mức độ cao, và tỷ lệ người nhiễm xạ đột biến ty thể trên mức cho phép cảnh báo thực trạng an toàn lao động và an toàn sinh học trong môi trường nghề nghiệp. Cần có những biến pháp hữu hiệu đảm bảo môi trường cho người lao động tránh bị đột biến ty thể. Bảng 2. So sánh mức độ tương đồng (%) của chuỗi nucleotide vùng D-loop giữa các mẫu nghiên cứu (Ghi chú: Các mẫu đánh số như danh sách ở bảng 1) 1 2 3 4 5 6 7 8 9 10 11 12 1 94 97 97 97 96 98 98 97 98 98 98 2 94 94 94 97 95 95 94 95 95 95 3 97 97 96 98 98 97 98 98 98 4 97 95 97 97 97 97 98 97 5 96 97 97 97 98 98 98 6 97 97 96 97 97 97 7 99 98 98 98 98 8 98 98 98 98 9 98 98 98 10 98 98 11 98 12 BÀN LUẬN Xem xét trong số 40 người lao động trong môi trường bức xạ và xem xét chuỗi DNA vùng D-loop, xuất hiện có một số mức độ đột biến trầm trọng, trong đó những đột biến thêm-bớt (indel mutation), một loại hình đột biến nguy hiểm đặc biệt nếu xảy ra trong D-loop ảnh hưởng đến vai trò điều hòasao chép gen ty thể, và đột biến mức độ giống nhau với mẫu người bị ung thư (Hochhauser, 2000; Rosson và Keshgegian, 2004). Hệ gen ty thể có hệ số nhân lên nhiều và nhanh như sự phân chia tế bào, và hệ số đột biến cao so với hệ gen nhân do chịu áp lực tác động của tác nhân sinh học, vật lý, hóa chất, dược chất, ung thư, nhiễm xạ (Kim và CS, 2006; Wang và CS, 2007). Nếu như người lao động tiếp xúc hoặc phơi nhiễm với phóng xạ không được bảo vệ chu đáo, rất có thể dễ bị đột biến xảy ra trong hệ gen ty thể ảnh hưởng đến chức năng sinh học của cơ thể và có tính di truyền. Điều này cảnh báo cần nghiêm túc thực hiện qui định an toàn sinh học trong môi trường lao động có bức xạ và các môi trường phơi nhiễm với các tác nhân gây đột biến ty thể. Kết quả nghiên cứu của chúng tôi góp phần làm sáng tỏ một số vấn đề an toàn lao động và quan hệ sinh học trong môi trường làm việc tại Việt Nam. Tổng quan Y Học TP. Hồ Chí Minh * Tập 14 * Phụ bản của Số 4 * 2010 Chuyên ñề Ung Bướu 8 SO SÁNH D-LOOP HỆ GEN TY THỂ * 20 * 40 * 60 * 80 * 100 1--NX1(VN) : AAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATAATGTACAGTACCAT : 100 2--NX2(VN) : ......................................................................................T.....G....... : 100 3--NX3(VN) : ...................................................A............................A.....T............. : 100 4--NX4(VN) : ................................................................................A.....T.....G....... : 100 5--NX6(VN) : ......................................................................................T.....G....... : 100 6--BRC-(BN : ......................................................................................T.....G....... : 100 7--BT-VN71 : ......................................................................................T............. : 100 8--BT-Viet : ......................................................................................T............. : 100 9--BT-CN(X : ......................................................................................T.....G....... : 100 10-BT-han( : .............................G........................................................T.....G....... : 100 11-BT-Phil : ......................................................................................T.....G....... : 100 12-BT-Mor : ......................................................................................T.....G....... : 100 * 120 * 140 * 160 * 180 * 200 1--NX1(VN) : AAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCTCATGCTTACAAGCAAGTACAGCAATCAACCTTCAACTATCACAC : 200 2--NX2(VN) : ...C.......................T.................CC.....C..C........................C.....C............. : 200 3--NX3(VN) : .......................................................C................C........................... : 200 4--NX4(VN) : .......................................................C.....................TG..................... : 200 5--NX6(VN) : .......................................................C.........................................T.. : 200 6--BRC-(BN : ...C.........................................CC.....C..C........................C.....C............. : 200 7--BT-VN71 : ....................................................C..C............................................ : 200 8--BT-Viet : ....................................................C..Y............................................ : 200 9--BT-CN(X : ....................................................C..C..................................G......... : 200 10-BT-han( : .......................................................C............................................ : 200 11-BT-Phil : .......................................................C............................................ : 200 12-BT-Mor : .......................................................C..............................C............. : 200 * 220 * 240 * 260 * 280 * 300 1--NX1(VN) : ATCAACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCCTAACAGTACATAGTACATAAAGCCATTTACCGTACATAG : 300 2--NX2(VN) : .....A....-..........................A...................T..T...A.................................G. : 299 3--NX3(VN) : ...................................G........................T....................................... : 300 4--NX4(VN) : ..................................C.........................T....................................... : 300 5--NX6(VN) : ...........T................C...............................T..................G.................... : 300 6--BRC-(BN : .....................................A......................T.............C.......................G. : 300 7--BT-VN71 : ....................T............................................................................... : 300 8--BT-Viet : .................................................................................................... : 300 9--BT-CN(X : ...................T.....................T..................T....................................... : 300 10-BT-han( : ............................................................T.............C......................... : 300 11-BT-Phil : ..........................................................T.T....................................... : 300 12-BT-Mor : ............................................................TC...................................... : 300 * 320 * 340 * 360 * 1--NX1(VN) : CACATTACAGTCAAATCCC-TTC-TCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGAACACCA : 369 2--NX2(VN) : ...................C...C.........................A...............C..... : 370 3--NX3(VN) : ...................-...-.........................................C..... : 369 4--NX4(VN) : ...................-...-...C.........................A...........C..... : 369 5--NX6(VN) : ...................-...-...C.....................................C..... : 369 6--BRC-(BN : ...................-...-.........................................C..... : 369 7--BT-VN71 : ...................-...-.........................................C..... : 369 8--BT-Viet : ...................-...-.........................................C..... : 369 9--BT-CN(X : ...................-...-...C.....................................C..... : 369 10-BT-han( : ...................-...-.........................................C..... : 369 11-BT-Phil : ...................-...-...C.....................................C..... : 369 12-BT-Mor : ...................-...-.........................................C..... : 369 Hình 1. So sánh trình tự 369-370 nucleotide của chuỗi DNA vùng D-loop thu nhận hệ gen ty thể của các đối tượng lao động tiếp xúc nhiễm xạ (NX1(VN); NX2(VN); NX3(VN); NX4(VN); NX6(VN)), 1 mẫu người Trung Quốc bị ung thư vú (BRC- (BN10)CN), với người bình thường (2 mẫu người Việt Nam (BT-VN71(Vie); BT- Viet0040), 2 mẫu người Trung Quốc (BT-CN(XJ8416); BT-han(SD10334)CN) người Philippine (BT-Phil),1 mẫu người Morroco (BT-Mor)). Ghi chú: dấu (.): Biểu thị giống với trình tự nucleotide vùng D-loop thu nhận từ người Việt Nam nhiễm xạ 1 (NX1(VN); sai khác về nucleotide được thể hiện bằng các chữ cái ký hiệu của chúng. Đột biến điểm đứt đoạn giữa các chủng thể hiện bằng dấu (-) và đóng khung dọc. Đột biến giống nhau có tính bệnh lý của mẫu người nhiễm xạ (NX2(VN)) và ung thư (BRC- (BN10)CN) được đóng khung dọc để đối chiếu phân tích. Các vị trí sai khác mang tính đa hình các tộc người được chỉ dẫn bằng mũi tên. Tổng quan Y Học TP. Hồ Chí Minh * Tập 14 * Phụ bản của Số 4 * 2010 Chuyên ñề Ung Bướu 9 7--BT-VN71(Vie) 8--BT-Viet0040 1--NX1(VN) 3--NX3(VN) 9--BT-CN(XJ8416) 4--NX4(VN) 5--NX6(VN) 11-BT-Phil 10-BT-han(SD10334)CN 12-BT-Mor 2--NX2(VN) 6--BRC-(BN10)-CN 0.005 Hình 2. Mối quan hệ phả hệ giữa các mẫu so sánh phân tích dựa vào dữ liệu chuỗi nucleotide vùng D-loop. Mẫu nhiễm xạ NX2(VN) hoàn toàn đồng nhất đột biến như mẫu người bị ung thư và nhóm thành một tập hợp riêng biệt. KẾT LUẬN VÀ ĐỀ NGHỊ Lao động nghề nghiệp trong môi trường bức xạ ion hóa liều thấp, ở vùng D- loop hệ gen ty thể bị đột biến điểm và/hoặc đột biến đứt đoạn với mức độ cao so với người bình thường, trong đó trên 40 đột biến điểm (point-) và thêm bớt (indel-mutation) trong vùng DNA có độ dài 369-370 bp, Đặc biệt có trường hợp xuất hiện đột biến ảnh hưởng chức năng ty thể. Cần có những biện pháp đảm bảo an toàn lao động tuyệt đối cho người làm việc trong môi trường bức xạ liều thấp, tránh ảnh hưởng lớn đến chức năng sinh học. Cần có chương trình nghiên cứu diện rộng về đột biến hệ gen ty thể và hệ gen nhân trên nhóm lao động phơi nhiễm với các tác nhân ảnh hưởng di truyền tại Việt Nam.g TÀI LIỆU THAM KHẢO 1. Anderson S, Bankier AT, Barrell BG, de-Bruijn MH, Coulson AR, Drouin J, Eperon IC, Nierlich DP, Roe BA, Sanger F, Schreier PH, Smith AJ, Staden R and Young IG (1981). Sequence and organization of the human mitochondrial genome. Nature 290, 457-465. 2. Đái Duy Ban, Lê Thanh Hoà, Nguyễn Văn Vũ, Hoàng Minh Châu, Nguyễn Bích Nga, Đái Hằng Nga, và 9 tác giả khác. (2003). Bước đầu nghiên cứu ung thư vú bệnh nhân Việt Nam bằng phương pháp sinh học phân tử sử dụng chỉ thị di truyền hệ gen ty thể vùng D-Loop, tr 825-829. Sách: "Những vấn đề nghiên cứu cơ bản trong khoa học sự sống". Báo cáo khoa học Hội nghị toàn quốc lần thứ hai, nghiên cứu cơ bản trong sinh học, nông nghiệp, y học. Huế 25-26/7/2003. Nhà xuất bản Khoa học và Kỹ thuật, Hà Nội, Việt Nam, 1145 trang. 3. Hochhauser D (2000). Relevance of mitochondrial DNA in cancer. Lancet 356, 181-182. 4. Irwin JA, Saunier JL, Strouss KA, Diegoli TM, Sturk KM, O'Callaghan JE, Painter CD, Hohoff C, Brinkmann B and Parsons TJ (2008). Mitochondrial control region sequences from a Vietnamese population sample. Int. J. Legal Med. In press. Tổng quan Y Học TP. Hồ Chí Minh * Tập 14 * Phụ bản của Số 4 * 2010 Chuyên ñề Ung Bướu 10 5. Kim GJ, Fiskum GM, Morgan WF (2006). A role for mitochondrial dysfunction in perpetuating radiation-induced genomic instability. Cancer Res. 66(21):10377-83. 6. Nicholas KB and Nicholas HB (1997). Genedoc: a tool for editing and annotating multiple sequence alignments. Distributed by the author. 7. Pang LJ, Shao JY, Liang XM, Xia YF, Zeng YX (2007). Mitochondrial DNA somatic mutations are frequent in nasopharyngeal carcinoma. Cancer Biol Ther. 2007 Nov 3;7(2) [Epub ahead of print] 8. Rosson D and Keshgegian AA. (2004). Frequent mutations in the mitochondrial control region DNA in breast tissue. Cancer Lett. 215(1):89-94. 9. Sambrook J and Russell DW (2001). Molecular Cloning. A Laboratory Manual. 3rd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 10. Tamura K, Dudley J, Nei M and Kumar S (2007). MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol., 24, p. 1596-1599. 11. Wallace DC (1999). Mitochondrial diseases in man and mouse. Science 283, 1482-1487. 12. Wang L, Kuwahara Y, Li L, Baba T, Shin RW, Ohkubo Y, Ono K, Fukumoto M (2007). Analysis of Common Deletion (CD) and a novel deletion of mitochondrial DNA induced by ionizing radiation. Int J Radiat Biol. 83(7):433-42.

Các file đính kèm theo tài liệu này:

  • pdfnghien_cuu_su_dot_bien_vung_d_loop_cua_he_gen_ti_the_o_nguoi.pdf
Tài liệu liên quan